KR20070099208A - Std kit - Google Patents

Abstract

Specific primers of 10 kinds of STD(sexually transmitted disease)-causing bacteria are provided to amplify specific gene by geometric progression, thereby capable of detecting a very small amount of pathogen with high efficiency and easily diagnosing the STDs, which are hard to be detected at an early stage and to prevent complications. A primer capable of diagnosing various STD-causing bacteria is selected from the group consisting of 1/2 primer specifically amplifying selected Neisseria gonorrhea DNA, 3/4 primer specifically amplifying selected Chlamydia trachomatis DNA, 5/6 primer specifically amplifying selected Ureaplasma urealyticum DNA, 7/8 primer specifically amplifying selected Gardnerella vaginalis DNA, 9/10 primer specifically amplifying selected Mycoplasma hominis DNA, 11/12 primer specifically amplifying selected Mycoplasma genitalium DNA, 13/14 primer specifically amplifying selected Herpes simplex virus I DNA, 15/16 primer specifically amplifying selected Herpes simplex virus II DNA, 17/18 primer specifically amplifying selected Candida albicans DNA, and 19/20 primer specifically amplifying selected Trichomonas vaginalis DNA, wherein the amplification of the 10 kinds of the STD bacteria is performed by PCR using nucleic acids obtained from a biological sample as a target DNA.

Description

STD detection method and diagnosis kit using polymerase chain reaction {STD KIT}

Figures 1a to 1j shows a picture of electrophoresis after PCR using a nucleotide sequence primer specifically present in each pathogen, using the genomic DNA extracted after culturing each of the nine pathogens as a template.

2a to 2j show electrophoresis after PCR using a nucleotide sequence primer specifically present in each pathogen, using genomic DNA extracted from a sample infected with each pathogen as a template.

The present invention uses polymerase chain reaction (M-PCR) to quickly and accurately detect 9 pathogens that cause sexually transmitted diseases. The present invention relates to PCR kits and methods for diagnosing pathogen infection.

Sexually Transmitted Disease (STD) is a disease that is transmitted through sexual contact with people who have pathogens. 1879 German A.L.S. Nicer discovered gonococcus, a gonorrhea pathogen, and Miyagawa Yonetsugi of Japan found Miyagawa body as a pathogen of groin lymphoma. Subsequent research revealed that Miyagaosome is chlamydia trachomatis belonging to chlamydia.

Since the 1970s, there has been a variety of sexual acts.

It has become widespread, including smear, chlamydia, fungi, and parasites, and its main path of infection is sexual activity with infected people. Since it was first reported to the World Medical Association in 1981, it is spreading rapidly around the world and the number of patients is expected to continue to grow. As of November 1996, about 600 patients were reported in Korea. STDs can appear in men, women, and people of all ages, and tend to be more common in people in their late teens and early and mid-20s. Sexually transmitted diseases, which are highly infectious diseases, are not enough to have sex education, and the infection rate of teenagers has increased, which is a social problem. It can be a social problem. In addition, sexually transmitted diseases have many problems, including not only physical harm to themselves, but also serious physical disabilities to sexual partners and descendants. Therefore, it is urgently needed to develop and prevent the early diagnosis of these pathogens.

Previous methods of diagnosing sexually transmitted diseases include collecting and staining infected sites and examining them under a microscope. Microscopic examination of Gram-negative diplococci in gonorrhea, and Gram-positive media in the case of Candida fungi and herpes viruses, etc. There is a method of examining the identification of culture, and these methods are cumbersome, complicated, and require a long time because they are based on the morphological or growth characteristics of the bacteria. Recently, fast and simpler methods of targeting genes have been increasingly used and developed. In this method, a species-specific primer of a specific nucleotide sequence of a pathogen is produced for a specific gene, and a test method using PCR is developed and used.

PCR is a simple and convenient way to exponentially amplify a DNA sequence of a specific region with only a small amount of DNA. It is a primer that specifically binds to the DNA to be amplified, and Taq DNA polymerase which is stable at high temperatures. By using denaturation step, annealing step, and extension step repeatedly, it is possible to quickly and accurately diagnose even a small amount of DNA.

Studies related to pathogen detection using PCR include PCR (Monica M., Chris JLM Meiler, Servaas A, Rene Pol., And Addriaan JC van den Brule. Combination of PCR Targeting targeting the VD2 region of chlamydia's omp1 gene). the VD2 of omp1 and reverse line blot analysis for typing of urogenital chlamydia trachomatis serovars in cervical scrape specimens . Journal of Clinical Microbiology. July : 2935-2939 (2004)), PCR (U chaudhry and D Saluja. Detection of Neisseria gonorrhoeae by PCR using orf1 gene as target. Feb; 78 (1): 72-78 (2002)) PCR studies of Myco Plasma Hominis include (Beverly E. Sha, Hua Y. Chen, Qiong J. Wang, M. Reza Zariffard, Mardge H. Cohen and Gregory T. Spear.Utility of amsel criteria, nugent score, and quantitative PCR for Gardnerella vaginalis , Mycoplasma hominis , and Lactobacillus spp . For diagnosis of bacterial vaginosis in human immunodeficiency virus-infected women. Journal of Clinical MicroBiology: Sept 4607-4612 (2005)). As the number of sexually transmitted infections increases and infections caused by various species increase, useful methods for early detection, treatment and prevention are urgently needed.

An object of the present invention is Chlamydia, which causes sexually transmitted diseases trachomatis ), Neisseria gonorrhea), Mycoplasma hoe varnish (Mycoplasma hominis ), Ureaplasma urealyticum ), Mycoplasma genitalium , Herpes simplex virus I & II), Gardnerella vaginalis ), Candida albicans , Trichomonas vaginalis ) An object of the present invention is to provide a diagnostic kit PCR method using specific primers of 10 pathogens. In addition, sexually transmitted diseases may be missed during treatment because they do not have symptoms in the early stages, which may pose a risk for complications. The present invention aims to diagnose sexually transmitted infections early.

In order to achieve the above object, in the present invention, a diagnostic kit was prepared using species-specific primers of specific nucleotide sequences of target genes of nine pathogens to be amplified.

In the present invention, primers were prepared using a species-specific sequence portion of each pathogen, and a diagnostic kit and a PCR method were developed based on the primers.

Neisseria gonorrhea ) is gyrA, Chlamydia trachomatis ), Ureaplasma urealyticum ), Gardnerella vaginalis ), Mycoplasma hominis is a 16S rRNA, Herpes simplex virus) type 1 is UL38 capsid protein, type 2 integral membrane protein is UL20, Mycoplasma Jenny de Solarium (Mycoplasma genitalium ) produced specific primers targeting mgpA protein, Candida albicans (18s) rRNA gene, and Trichomanas (betarichonas vaginalis) beta-tubulin 1 gene.

In general, a pair of primers is used for PCR to detect a single pathogen, and thus, 10 pairs, or 18 primers, are required to perform PCR for 10 kinds of targets. In order to identify them at one time, we focused on the development of primers with common PCR reaction conditions. As a result, 10 pairs of primers were used to apply them to the PCR reaction at the same time to detect 10 species.

When preparing a PCR primer according to the present invention, various restrictions such as the A, G, C, T content ratio of the primer, prevention of dimmer formation of the primer, prohibition of repeating three or more times of the same base sequence, and other PCR reactions in the condition the mold (template) DNA amount, a primer concentration, and the conditions such as the concentration of dNTP, Mg concentration of ^{2 +,} and the reaction temperature, and the reaction time should be adequate.

9 kinds of pathogens provided by the present invention were developed to suit such a PCR technique, the size of the PCR primers and PCR amplification products by these are as follows.

TABLE 1

Strain name Potential primer Reverse Primer Size of amplification products N. gonorrhea NgGF: SEQ ID NO: 1 NgGR: SEQ ID NO: 2 214 bp C. trachomatis CT16F: SEQ ID NO: 3 CT16R: SEQ ID NO: 4 841 bp U. urealyticum UU16F: SEQ ID NO: 5 UU16R: SEQ ID NO: 6 677 bp G. vaginalis GV16F: SEQ ID NO: 7 GV16R: SEQ ID NO: 8 360 bp M. hominis MH16F: SEQ ID NO: 9 MH16R: SEQ ID NO: 10 334 bp M. genitalium MGpaF: SEQ ID NO: 11 MGpaR: SEQ ID NO: 12 448 bp Herpes simplex virus  I HSV1F: SEQ ID NO: 13 HSV1R: SEQ ID NO: 14 341 bp Herpes simplex virus II HSV2F: SEQ ID NO: 15 HSV2R: SEQ ID NO: 16 625 bp C. albicans CA18F: SEQ ID NO: 17 CA18R: SEQ ID NO: 18 129 bp T. vaginalins TVF: SEQ ID NO: 19 TVR: SEQ ID NO: 20 413 bp

Hereinafter, the present invention will be described in more detail based on examples. However, these Examples are only illustrative of the present invention, the scope of the present invention is not limited to these.

Example 1  : Culture and Genome of Standard Strains DNA  detach

STD standard strains were obtained from the American Type Culture Collection (ATCC) and Gangnam Cha Hospital, and their DNA extraction was performed using an Intronbio DNA kit (Intronbio, G-spin genomic DNA extraction Kit. Cat. No. 17281).

After culturing the strain cultured in 1.5 ㎖ tube with platinum and added 100 ul TP buffer of Intron Bio DNA kit was suspended. After reacting for 30 minutes at 37 ℃ TG buffer 150 ul was added and mixed well and reacted at 65 ℃ for 30 minutes. Then add 250 ul of TB buffer and mix well. Add 250 ul of 80% ethanol and mix well. Transfer the mixture to the column and centrifuge for 1 minute at 12,000 rpm. The column was put in 500 ul of washing solution, and then centrifuged at 12,000 rpm for 2 minutes. The column was transferred to a 1.5 ml new tube, 150 ul of Elution buffer was added, and the reaction was performed at room temperature for 5 minutes, followed by centrifugation at 12,000 rpm for 1 minute. The final product was used as template DNA for PCR.

Standard strains used were as follows:

N. gonorrhea ) (ATCC 21825)

Chlamydia trachomatis ) (ATCC VR-88)

Ureaplasma urealyticum ) (ATCC 29557)

Gardnerella vaginalis ) (ATCC 49145)

Mycoplasma Hominis hominis ) (ATCC 43519)

Mycoplasma Zenitarium genitalium ) (ATCC 49895)

Candida albicans ), Trichomonas vaginalis ), Herpes simplex virus I & II) (Sold at Pocheon College of Oriental Medicine)

Example 2  : 10 kinds of pathogens for diagnosis primer  Design and synthesis

Neisseria gonorrhea ), Chlamydia trachomatis ), Ureaplasma urealyticum ), Gardnerella vaginalis ), Mycoplasma hominis , Herpes simplex virus I & II), Mycoplasma Zenitarium genitalium ), Candida albicans , Trichomonas vaginalis )

In the preparation of primers capable of diagnosing 10 pathogens, the same PCR conditions were designed and synthesized. The first primer pair NgGF / NgGR is Neisseria gonorrhea ) is designed to specifically detect and the size of the amplification product is 214 bp. The base sequence of this PCR primer is as follows.

PCR primer NgGF: 5'gcgcaaaagctatctcgact (SEQ ID NO: 1)

PCR primer NgGR: 5'ggtgtcgtaaactgcggaat (SEQ ID NO: 2)

The second PCR primer pair CT16F / CT16R is Chlamydia trachomatis ) is designed to specifically detect the size of the amplification product is 841 bp. The nucleotide sequence is as follows.

PCR primer CT16F: 5'ggggatcttaggacctttcg (SEQ ID NO: 3)

PCR primer CT16R: 5'atatgtccttgcggaaaacg (SEQ ID NO: 4)

The third PCR primer pair UU16F / UU16R was designed to specifically detect ureaplasma ( Ureaplasma urealyticum ), and the size of the amplification product was 677 bp.

PCR primer UU16F: 5'tggatcacctcctttcttcg (SEQ ID NO: 5)

PCR primer UU16R: 5'cgggattatcaccctctgtg (SEQ ID NO: 6)

The fourth PCR primer pair GV16F / GV16R is a Gardnerella vaginalis ) is designed to specifically detect the size of the amplification product is 360 bp.

PCR primer GV16F: 5'ggatgccttggtagacagga (SEQ ID NO: 7)

PCR primer GV16R: 5'ctctacggctgggaattcaa (SEQ ID NO: 8)

Five PCR primers MH16F / MH16R is Mycoplasma hoe Nice (Mycoplasma hominis ) is designed to specifically detect and the size of the amplification product is 334 bp.

PCR primers MH16F: 5'caatggctaatgccggatacgc (SEQ ID NO: 9)

PCR primers MH16R: 5'ggtaccgtcagtctgcaat (SEQ ID NO: 10)

Sixth PCR primer pair MgpaF / MgpaR is Mycoplasma Jenny de Solarium (Mycoplasma genitalium ) is designed to specifically detect the size of the amplification product is 448 bp.

PCR primers MgpaF: 5'agtggcgaagtggaccatac (SEQ ID NO: 11)

PCR primers MgpaR: 5'attatgtcctcccccaccat (SEQ ID NO: 12)

7th PCR primer pairs HSV1F / HSV1R is herpes (Herpes simplex Virus I) is designed to detect specifically, and the size of the amplification product is 341 bp.

PCR primer HSV1F: 5'atgaagaccaatccgctacc (SEQ ID NO: 13)

PCR primers HSV1R: 5'atcacttggcgggttagatg (SEQ ID NO: 14)

8th PCR primer pairs HSV2F / HSV2R is herpes (Herpes simplex virus II) is designed to detect specifically, and the size of the amplification product is 625 bp.

PCR primer HSV2F: 5'cgggatgatgttcctttgtt (SEQ ID NO: 15)

PCR primer HSV2R: 5'tccaaaagcgtgctagaaaaa (SEQ ID NO: 16)

The ninth PCR primer pair CA18F / CA18R was designed to specifically detect Candida albicans , and the size of the amplification product was 129 bp.

PCR primer CA18F: 5'gggtttgcttgaaagacggta (SEQ ID NO: 17)

PCR primers CA18R: 5'ttgaagatatacgtggtggacgtta (SEQ ID NO: 18)

Tenth PCR primer pair TVF / TVR was obtained from Trichomonas vaginalis ) is designed to specifically detect the size of the amplification product is 413 bp.

PCR primers TVF: 5'aaattggtgccaagttctgg (SEQ ID NO: 19)

PCR primers TVR: 5'gagaaggagtgtgccgagac (SEQ ID NO: 20)

Example 3  : Pathogen Diagnosis Of kit  Configuration

Ten pairs of PCR primers (SEQ ID NOS: 1 to 20) synthesized in Example 2 were mixed with the PCR premixed solution to construct a diagnostic kit as shown in Table 2.

[Table 2]

Kit Components 20 pmol of primer mixture (SEQ ID NOS: 1-20) PCR premixture (PCR premixture: Tris-HCl 60mmol / L, KCl 80mmol / L, MgCl2 3mmol / L Dithiothreitol 2mmol / L, tween 20 0.02% v / v, dATP, dCTP, dGTP, dTTP 0.4mmol / L, Bromophenol Blue 0.01% g / v, Taq polymerase 25 unit)

Example 4  Manufactured On the primer  Specificity test

DNA extracted from the standard strain was used as a template, and PCR-reacted with the primer mixture prepared in Example 3 to amplify the specific gene of the strain. In order to sufficiently denature the PCR conditions, the mixture was heat-treated at 94 ° C. for 3 minutes, and then reacted 40 times at 94 ° C. for 30 seconds, 57 ° C. for 30 seconds, and 72 ° C. for 1 minute, and finally extended at 72 ° C. for 10 minutes. After the reaction, the amplified gene product was electrophoresed on 2% agarose gel, and then amplification of the specific gene was confirmed.

Figures 1a to 1j is a picture of the electrophoresis after PCR using a primer of the nucleotide sequence specifically present in each pathogen, M lane is 100 bp molecular weight label, C lane is distilled water (negative control group), lane 1 Silver Neisseria gonorrhea ), lane 2 chlamydia

(Chlamydia trachomatis), Lane 3 is urea plasma (Ureaplasma urealyticum), Lane 4 is Gardnerella (Gardnerella vaginalisLane 5, Mycoplasma Hominis (Mycoplasma hominisLane 6 is Mycoplasma Zenitarium (Mycoplasma genitalium), Lane 7 is herpes (Herpes simplex virus I), lane 8 is herpes (Herpes simplex virus II), lane 9 is Candida (Candida albicansLane 10, Trichomanas (Trichomonas vaginalis). As shown here, it can be seen that only specific primers for each pathogen are amplified.

2a to 2j were confirmed by the same method as in FIG. 1 using a clinical specimen commissioned by Woman Biotech. As shown here, it can be confirmed that only specific primers for each pathogen are amplified.

The present invention is designed by the same PCR conditions for the production of specific primers for 10 kinds of STD (Sexually Transmitted Disease) to be identified by exponentially amplifying only specific genes, it is possible to detect pathogens with high detection efficiency and trace amounts. In addition, because there are no symptoms in the early stage, it is very useful for early prevention because it can be easily diagnosed even in cases of sexually transmitted diseases that are difficult to detect early.

Claims (4)

The SEQ ID NO: 1/2 primer to the SEQ ID NO: 19/20 primer is a primer that can diagnose a variety of STD pathogens, Sequence Listing 1/2 primers were selected from Neisseria gonorrhea ) can specifically amplify DNA, SEQ ID NO: 3/4 Primer was selected from Chlamydia trachomatis ) can specifically amplify DNA, SEQ ID NO: 5/6 primers were selected Ureaplasma urealyticum ) can specifically amplify DNA, SEQ ID NO: 7/8 Primer was selected Gardnerella vaginalis ) can specifically amplify DNA, SEQ ID NO: 9/10 Primer was selected from Mycoplasma Hominis hominis ) can specifically amplify DNA, SEQ ID NO: 11/12 Primer was selected from Mycoplasma Genitarium genitalium ) can specifically amplify DNA, SEQ ID NO: 13/14 Primer was selected for Herpes simplex virus I) can specifically amplify DNA, SEQ ID NO: 15/16 Primers were selected Herpes simplex virus II) can specifically amplify DNA, SEQ ID NO: 17/18 primers can specifically amplify selected Candida albicans DNA, SEQ ID NO: 19/20 Primer was selected Trichomonas vaginalis ) synthesized primers capable of specifically amplifying DNA The method of claim 1, A method of amplifying 10 STD species DNAs by performing polymerase chain reaction (PCR) using a nucleic acid obtained from a biological sample as a target DNA. The method of claim 1, A method for diagnosing infection with a species specific primer by performing polymerase chain reaction (PCR) using a nucleic acid obtained from a sample as a target DNA. The method of claim 1, Kits for diagnosing various STD pathogens, including PCR premixes.

Images