KR102463256B1 - Composition for Low-temperatuer Preservation or Cryopreservation of Fat Tissue Using Caffeine, etc. and the Preservation Method of Fat Tissue Using the Same - Google Patents

Abstract

According to the present invention, disclosed are a composition for low-temperature or frozen storage of adipose tissue using caffeine and the like having excellent storage effects such as high cell viability and maintenance of cell characteristics after storage, and a method for storing adipose tissue using the same. The present invention includes caffeine and three amino acids that are adenosine, alanine, and glutathione.

Description

A composition for low-temperature or frozen storage of adipose tissue using caffeine and the like, and a method for storing adipose tissue using the same. and the Preservation Method of Fat Tissue Using the Same}

The present invention relates to a composition for storing adipose tissue at low temperature or freezing using caffeine and the like, and a method for storing adipose tissue using the same.

Adipose tissue plays an important role in maintaining body shape as well as buffering important organs in the human body, and since it is a tissue that exists abundantly anywhere in the body, it can be easily collected from most patients without changing the contour of the donor site. Transplantation has been performed clinically

This adipose tissue transplantation is a procedure in which adipose tissue extracted from one part of the body is re-injected into another body part. is being used In addition, there is no ethical problem, can be extracted in large amounts, can be collected under local anesthesia, can cause minimal pain to the patient, and can be safely performed through accumulated know-how and advanced instruments. In addition, adipose tissue has the advantage that it is easy to obtain in relatively large quantities compared to other tissues that can be the source of adult stem cells such as bone marrow, skin, muscle, liver and brain.

For such adipose tissue transplantation, if there is a time interval between adipose tissue extraction and re-injection, the extracted adipose tissue is stored at low temperature or frozen. It is very important because it has a great effect on engraftment. Therefore, it can be said that an appropriate storage method is required to minimize damage to adipose tissue during low-temperature or frozen storage.

The present invention discloses a method for storing adipose tissue at low temperature or frozen using caffeine or the like.

It is an object of the present invention to provide a composition for storing adipose tissue at low temperature or freezing using caffeine and the like, and a method for storing adipose tissue using the same.

Other objects or specific objects of the present invention will be set forth below.

As confirmed in the examples below, the present invention provides a composition for low temperature or frozen storage of adipose tissue containing caffeine and a mixture of three amino acids (ie, a mixture of adenosine, alanine, and glutathione) was prepared and the effect of low temperature or frozen storage of adipose tissue of this composition was evaluated by the viability of stem cells isolated from the adipose tissue, etc. Also, when the expression levels of Sox2, Oct4, c-myc, Klf4, and Nanog, which are known as stem cell pluripotency marker genes, were measured, CD73, which is known as a specific marker gene for adipose-derived stem cells. This was completed by confirming that there was no special effect on the characteristics of adipose tissue at the same level as the control (stored in PBS or glucose solution) even when the expression level of CD105 was measured.

The present invention is provided based on the experimental results as described above, and the composition for storing adipose tissue of the present invention includes caffeine and three amino acids, adenosine, alanine, and glutathione. characterized.

Caffeine (CAS ID: 58-08-2) is a kind of plant alkaloid in which four nitrogen atoms form a unique ring structure with carbon and oxygen. It is a colorless substance with In the present invention, caffeine may be used separately from coffee beans or the like, or purchased commercially available.

In the present invention, adenosine, alanine, and glutathione may be L-form amino acids.

In the composition of the present invention, caffeine and the three amino acids may be included in an amount of 100 to 300 μM and each amino acid in an amount of 1 to 10 μM in order to exhibit a sufficient low temperature or cryopreservation effect (improving cell viability, maintaining cell characteristics).

The composition for storing adipose tissue of the present invention may include a preservative solution.

The stock solution may be a buffer or isotonic solution or a cell culture medium.

The buffer may be a saline solution containing citrate, phosphate, succinate, tartrate, fumarate, gluconate, oxalate, lactate, acetate, histidine, tris, and the like as a buffer. In particular, it may be Phosphate Buffered Saline (PBS), Tris Buffered Saline (TBS), HEPES Buffered Saline, Dulbecco's phosphate-buffered saline (DPBS), and the like.

The preservative also contains sodium chloride, potassium chloride, boric acid, sodium borate, mannitol, glycerin, propylene glycol, polyethylene, glycol, maltose, sucrose, erythritol, arabitol, xylitol, sorbitol trihalose, glucose, etc. as isotonic agents. It may be isotonic. The isotonic solution may be Ringer's solution, lactate Ringer's solution, acetate Ringer's solution, bicarbonate Ringer's solution, or 5% glucose aqueous solution, and may be prepared and used directly or purchased commercially.

The stock solution may also be a cell culture medium. The cell culture medium includes sugars, amino acids, and inorganic salts, and may optionally include vitamins, trace elements, antimicrobial agents, growth factors, hormones, buffers, isotonic agents, and the like.

Monosaccharides, disaccharides, etc. may be used as the saccharides, and specifically, glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, or a mixture thereof. can be used

Amino acids included in the cell culture medium include aspartic acid, glutamic acid, asparagine, serine, glutamine, histidine, glycine, threonine, arginine, alanine, tyrosine, cysteine, valine, methionine, norvaline, tryptophan, phenylalanine, isoleucine, leucine, lysine, hydroxyproline, sarcosine and/or proline. The amino acids are preferably synthetic amino acids, and such synthetic amino acids may be in the form of dipeptides, tripeptides. These dipeptides and tripeptides can be converted into free amino acids in cell culture containing cells.

In addition to sugars and amino acids, the cell culture medium contains inorganic salts such as sodium chloride, potassium chloride, calcium chloride, magnesium sulfate, sodium dihydrogen phosphate, which help to maintain osmotic balance and regulate membrane potential by providing sodium, potassium and calcium ions. may be additionally included.

Such a cell culture medium may be directly prepared or commercially available, for example, DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI 1640, F-10, F-12, DMEM/F12, MEM-α (Minimal Essential Medium-α), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), MacCoy's 5A medium, AmnioMax complete medium , AminoMaxⅡ complete medium, EBM (Endothelial Basal Medium) medium, Chang's Medium, MesenCult-XF, DMEM/HG (Dulbecco's Modified Eagle's Medium high glucose) medium, and MCDB+DMEM/LG (MCDB + Dulbecco's Modified Eagle's Medium low glucose) medium etc.

The composition for storing adipose tissue of the present invention may contain a known cryopreservative agent to improve cell viability and maintain properties during freezing and thawing. Such cryopreservatives may be, for example, glycerol, keratin or gelatine hydrolysates, acetamide, DMSO, ethylene glycol, propylene glycol, polyethylene glycol, sericin, isomaltooligosaccharide and the like.

In addition, the composition for storing adipose tissue of the present invention may further include chelating agents such as EDTA, EGTA, citric acid, and salicylate, solubilizing agents, antioxidants, proline, and amino acids such as glutamine.

In another aspect, the present invention provides a method for storing fat at low temperature or frozen.

The storage method of the present invention includes the steps of preparing a preservative solution containing caffeine and three kinds of amino acids, immersing adipose tissue in the preservative solution, and storing the preservative solution in which the adipose tissue is immersed at a low temperature or frozen.

In the method of the present invention, caffeine may be used separately from coffee beans or purchased from the market, and the amino acid may be an L-type amino acid.

Also, in the method of the present invention, the preservation solution may be a buffer solution, isotonic solution or a cell culture medium as described above.

In addition, in the method of the present invention, the storage may be made at 10° C. or less, preferably at 4° C. or less. If the storage period is longer than 3 days, it may be stored frozen at sub-zero temperatures.

Also, in the method of the present invention, the storage period is not particularly limited, but may be between 1 day and 7 days in general.

According to the present invention, it is possible to provide a composition for storing adipose tissue at low temperature or freezing using amino acids such as caffeine and adenosine, and a method for storing adipose tissue using the same. The composition and method for storing adipose tissue of the present invention have excellent storage effects such as high cell viability and maintaining cell characteristics after storage.

1 is a result of separating adipose-derived stem cells (ADSC) from human adipose tissue stored in a refrigerator for 48 hours with caffeine, a composition of the present invention, and a mixture of three amino acids and culturing for 3 days. .
2 is a result of thawing the cells of FIG. 1 after cryopreservation and culturing for 3 days.
3 is a result of confirming the expression level of the pluripotency marker gene in stem cells.
4 is a result of confirming the expression level of the adipose-derived stem cell-specific marker gene.

Hereinafter, the present invention will be described with reference to Examples. However, the scope of the present invention is not limited to these examples.

<Example 1> Preparation of a composition for storing adipose tissue at low temperature

A mixture of caffeine and a mixture of three amino acids, namely, adenosine, alanine, and glutathione, was used as an active ingredient in the preparation of a composition for storing human adipose tissue at a low temperature.

First, a 1M glucose solution to be used as a solvent for caffeine and a mixture of the three amino acids was prepared by mixing 200 mL of 0.85% physiological saline with 36.031 g of glucose. Next, a 1M caffeine solution was prepared by mixing 10 mL of 1M glucose with 1.942 g of caffeine powder and heating at 80° C. for 1 hour. In addition, the next 100 μM amino acid mixture solution was completely dissolved by adding 10 mL of 1M glucose solution to 267 mg of adenosine (L-Adenosine), 307 mg of glutathione, and 89 mg of alanine (L-Alanine), and then mixed again. prepared. A composition for storing adipose tissue at a low temperature of the present invention was prepared using the solutions thus prepared, and each component and the final concentration of the composition thus prepared are shown in Table 1 below. The composition of the present invention was named and labeled as FNPT (Frombio New Cold Preservative for Tissue) for convenience.

Composition for low-temperature storage of adipose tissue FNPT solution concentration Volume (10 mL) final concentration Glucose 1M 7 mL 700 μM Caffeine 1M 2 mL 200 μM amino acid mixture 100 μM 1 mL 10 μM

<Example 2> Confirmation of adipose tissue low temperature storage effect

Human adipose tissue used in this example was purchased from Goma Biotech Co., Ltd. (Seoul, Korea), and each 10 mL of PBS, glucose solution, and FNPT were placed in a 50 mL conical tube for low-temperature storage of adipose tissue. Each was dispensed, and about 10 g of adipose tissue was cut and immersed, and stored at 4° C. for 48 hours. After storage for 48 hours, stem cells were isolated from adipose tissue, and 95% air in DMEM (Dulbecco's Modified Eagle's Medium) supplemented with penicillin (100 U/ml), streptomycin (100 ug/ml) and 10% heat-inactivated serum; Incubated with 5% CO ₂ and 37 °C conditions. Stem cell isolation from adipose tissue was performed according to the method of Zuk et al. (Mol Biol Cell. 2002 Dec; 13(12): 4279-4295).

As can be seen in FIG. 1 , when the composition of the present invention is used, a significantly larger amount of viable cells can be isolated compared to tissues stored with PBS or glucose.

<Example 3> Confirmation of cell recovery level during culture after cryopreservation and thawing

Cells cultured according to Example 2 were stored in an LN2 tank for 7 days with 10% (w/v) DMSO and 90% (w/v) FBS in an amount of 1×10 ⁵ cells/mL, respectively, and then thawed, Penicillin (100 U/ml), streptomycin (100 ug/ml) and 10% heat-inactivated serum were added to DMEM (Dulbecco's Modified Eagle's Medium) for 3 days in 95% air, 5% CO ₂ and 37°C conditions. By observing and photographing at a magnification of 4×, the cell recovery level after cryopreservation was evaluated by checking the appearance, shape, and number of adherent cells in the culture dish.

As can be seen in Figure 2, cells isolated from adipose tissue stored using the composition of the present invention form normal cells even after cryopreservation of the cells, compared to the case of storage using PBS or glucose, and the cell viability was also superior.

<Example 4> Confirmation of expression level of stem cell pluripotency marker gene

qRT-PCR was performed on the stem cell pluripotency marker gene using the cells cultured according to Example 3 above.

Total RNA was isolated from the adhered cells using Trizol Reagent (Invitrogen). Then, cDNA was synthesized from 1 ㎍ total RNA using Superscript II reverse transcriptase (Invitrogen) and oligo dT. Real-time PCR was performed by the SYBR green method using the synthesized cDNA and the primers of the stem cell pluripotency marker gene shown in Table 2 below. SYBR Green I is an intercalating reagent that binds to double-stranded DNA and exhibits fluorescence. The interchelating reagent (Interchelator) emits fluorescence by binding to the double-stranded DNA synthesized by the PCR reaction, and the amount of the amplification product can be measured by detecting the fluorescence intensity.

Expression levels of Sox2, Oct4, c-myc, Klf4, and Nanog known as pluripotency marker genes of stem cells were confirmed using real-time PCR. At this time, the data were expressed as mean ± standard deviation based on the results of three independent experiments for each condition. The primer sequences of each factor are shown in Table 2 below.

Primer sequence of stem cell pluripotency marker gene Sox2-Forward GCTACAGCATGATGCAGGACCA Sox2-Reverse TCTGCGAGCTGGTCATGGAGTT Oct4-Forward CCTGAAGCAGAAGAGGATCACC Oct4-Reverse AAAGCGGCAGATGGTCGTTTGG c-myc-Forward CCTGGTGCTCCATGAGGAGAC c-myc-Reverse CAGACTCTGACCTTTTGCCAGG Klf4-Forward CATCTCAAGGCACACCTGCGAA Klf4-Reverse TCGGTCGCATTTTTGGCACTGG Nanog-Forward CTCCAACATCCTGAACCTCAGC Nanog-Reverse CGTCACACCATTGCTATTCTTCG

As a result, as shown in FIG. 3 , there is no significant difference in the expression of the stem cell pluripotency marker gene even if the preservation solution is different. was able to confirm

<Example 5> Confirmation of specific marker gene expression in adipose-derived stem cells

The expression level of a specific marker gene in adipose-derived stem cells was investigated in the same manner using the cDNA prepared in Example 4. CD73, known as a specific marker gene for adipose-derived stem cells. The expression level of CD105 was confirmed using real-time PCR, and the primer sequences of each factor are shown in Table 3 below.

Primer sequence of specific marker gene of adipose-derived stem cells CD73-Forward AAGTGTCGAGTGCCCAGTTTA CD73-Reverse TGATCCGACCTTCAACTGCT CD105-Forward TCCATTGTGACCTTCAGCCT CD105-Reverse CTTGGATGCCTGGAGAGTCA

As a result, there is no significant difference in the expression of a specific marker gene of adipose-derived stem cells even if the preservation solution is different as shown in FIG. It was confirmed that storage was possible.

Claims (9)

As a composition for adipose tissue low temperature or frozen storage comprising caffeine and three amino acids, adenosine, alanine, and glutathione,
The caffeine is 100 to 300 μM, each amino acid is characterized in that included in the composition at 1 to 10 μM, the composition.
According to claim 1,
The composition, characterized in that all amino acids are L-type amino acids.
delete According to claim 1,
The composition comprises a preservative,
The preservative solution is a buffer, isotonic solution, or a cell culture medium.
According to claim 1,
The composition further comprises a cryopreservative,
The cryopreservative is glycerol, keratin hydrolyzate, gelatin hydrolyzate, acetamide, DMSO, ethylene glycol, propylene glycol, polyethylene glycol, sericin or isomaltooligosaccharide.
Preparing a preservative solution containing caffeine and three amino acids, adenosine, alanine and glutathione, immersing adipose tissue in the preservative solution, freezing the preservative solution in which the adipose tissue is immersed at low temperature or freezing including the step of storing
The caffeine is 100 to 300 μM, and each amino acid is 1 to 10 μM, characterized in that it is included in the preservation solution,
A method for low temperature or frozen storage of adipose tissue.
7. The method of claim 6,
The method, characterized in that all of the amino acids are L-type amino acids.
delete 7. The method of claim 6,
The method, characterized in that the storage is made at 4 ℃.

Images