KR102453522B1 - Spermidine derivatives, use thereof and preparation method thereof - Google Patents

Abstract

Disclosed herein are spermidine derivative compounds, uses thereof, and methods for preparing the same. The spermidine derivative compound may be N,N'-dicumaroylspermidine. The spermidine derivative compound provides an effect of preventing, ameliorating and/or treating allergic diseases without cytotoxicity. The method for preparing the spermidine derivative compound comprises the steps of: preparing an extract of Chichi; systemically fractionating the extract of the borage extract with hexane, dichloromethane, ethyl acetate, butyl alcohol and water to obtain a hexane layer; and separating the hexane layer by chromatography.

Description

SPERMIDINE DERIVATIVES, USE THEREOF AND PREPARATION METHOD THEREOF

Disclosed herein are spermidine derivative compounds, uses thereof, and methods for preparing the same.

Lithospermum erythrorhizon is a perennial plant belonging to the Borraginaceae genus Lithospermum, and is a representative plant containing shikonin and its derivatives in the root. Chichi is native to Korea, Japan and China, and has been used for a long time in folk medicine to treat skin rashes, acne, eczema, measles, detoxification, fever and constipation. Recently, it is used as a cosmetic raw material and high-quality natural dyes.

Allergic rhinitis presents with symptoms such as sneezing, clear runny nose, and stuffy nose, and at the same time, a heavy head and tears may come out. It appears a lot during the changing seasons or cold seasons of the year, and is often confused with a cold.

Allergic rhinitis is one of autoimmune diseases accompanied by an inflammatory response, and in patients with allergic rhinitis, interleukin-4 (interleukin-4, IL-4), interleukin-5 (IL-5), interleukin-13 (IL -13) is known to increase expression.

Currently, if you suffer from allergic rhinitis, anti-allergic agents, antihistamines, antibiotics or anti-inflammatory drugs are prescribed. Histamine secreted by a cellular immune response causes inflammation of blood vessels. Under normal circumstances, histamine secretion helps to prevent infection, but if it responds to an antigen such as pollen, it causes an allergy. At this time, antihistamines act by inhibiting histamine secreted from cells to prevent infection. In general, antihistamines do not have a high therapeutic effect on allergic rhinitis, and cause drowsiness, dizziness, dry mouth, excitement, and loss of appetite. There may be side effects such as abdominal pain and constipation. And it is known to have no effect on nasal congestion. In addition, since antihistamines are not a fundamental treatment, but only temporarily control symptoms, their efficacy is only 12 to 24 hours. Therefore, there is a problem that antihistamines have to be taken continuously. When taking antihistamines, it is not recommended to take them every day because they are metabolized by the liver or kidney and absorbed throughout the body. In addition, as one of the prescriptions for allergic rhinitis, a topical steroid sprayed into the nose is used to eliminate nasal congestion. This also eliminates symptoms at the moment of use, but long-term use can cause sinusitis, so use for more than 2 weeks. shouldn't Antibiotics and anti-inflammatory drugs only provide temporary relief.

As such, there is a high demand for a therapeutic agent for allergic rhinitis, which has no side effects and has excellent therapeutic effects, because a method for curing allergic rhinitis is not known yet.

KR 10-0793081 B1

In one aspect, the present disclosure aims to provide a spermidine derivative compound, a salt thereof, a hydrate thereof, a solvate thereof, or an isomer thereof.

In another aspect, an object of the present disclosure is to provide a composition for anti-allergy comprising a spermidine derivative compound, a salt thereof, a prodrug thereof, a hydrate thereof, a solvate thereof, or an isomer thereof as an active ingredient.

In another aspect, the present disclosure aims to provide a method for preparing a spermidine derivative compound.

In one aspect, the present disclosure provides a spermidine derivative compound having a structure represented by Formula 1 below, a salt thereof, a hydrate thereof, a solvate thereof, or an isomer thereof.

[Formula 1]

The R ₁ , R ₂ and R ₃ are each independently hydrogen, p-coumaroyl (p-coumaroyl), feruloyl (feruloyl), caffeoyl (caffeoyl), benzoyl (benzoyl), cinnamoyl (cinnamoyl), or vanilloyl.

In an exemplary embodiment, R ₁ and R ₃ are each independently p-coumaroyl (p-coumaroyl), feruloyl or caffeoyl, and R ₂ may be hydrogen. .

In an exemplary embodiment, the compound may be N,N'-dicumaroylspermidine having a structure represented by the following Chemical Formula 1a.

[Formula 1a]

In an exemplary embodiment, the compound may be isolated from Lithospermum erythrorhizon .

In an exemplary embodiment, the compound may be isolated from borage roots.

In another aspect, the present disclosure provides a composition for anti-allergy comprising a spermidine derivative compound, a salt thereof, a prodrug thereof, a hydrate thereof, a solvate thereof, or an isomer thereof as an active ingredient.

In an exemplary embodiment, the compound may have a structure of Formula 1 below.

[Formula 1]

The R ₁ , R ₂ and R ₃ are each independently hydrogen, p-coumaroyl (p-coumaroyl), feruloyl (feruloyl), caffeoyl (caffeoyl), benzoyl (benzoyl), cinnamoyl (cinnamoyl), or vanilloyl.

In an exemplary embodiment, the compound may be N,N'-dicumaroylspermidine having the structure of Formula 1a below.

[Formula 1a]

In an exemplary embodiment, the composition may have degranulation inhibitory activity of mast cells.

In an exemplary embodiment, the composition may have an activity of inhibiting the expression of one or more cytokines selected from the group consisting of IL-3, IL-4 and IL-13.

In an exemplary embodiment, the active ingredient may be included in an amount of 0.001 to 10% by weight based on the total weight of the composition.

In an exemplary embodiment, the composition may be a pharmaceutical composition for preventing or treating allergic diseases.

In an exemplary embodiment, the composition may be a food composition for alleviating allergic diseases.

In an exemplary embodiment, the composition may be a cosmetic composition for improving allergic diseases.

In an exemplary embodiment, the allergic disease is allergic rhinitis, allergic asthma, hay fever, Quincke's edema, anaphylaxis, hives, allergies It may be one or more selected from the group consisting of allergic conjunctivitis, allergic keratitis, atopic dermatitis and allergic contact dermatitis.

In another aspect, the present disclosure provides a method for preparing the spermidine derivative compound, the method comprising the steps of: 1) preparing a borage extract; 2) systemically fractionating the extract of the borage extract with hexane, dichloromethane, ethyl acetate, butyl alcohol and water to obtain a hexane layer; and 3) separating the hexane layer by chromatography to obtain N,N'-dicumaroylspermidine having a structure represented by Formula 1a.

In an exemplary embodiment, the extract of borage in step 1) may be an alcohol extract.

In an exemplary embodiment, the alcohol may include ethanol.

In an exemplary embodiment, step 3) may be to perform chromatography using a mixed solvent of water and methanol as a mobile phase.

In an exemplary embodiment, in step 3), a 95% (v/v) methanol fraction is obtained by performing chromatography, and then an eluting solvent is added to N,N'-dicuma with a structure represented by Formula 1a. It may be to isolate ilspermidine.

In an exemplary embodiment, the elution solvent may be 95% (v/v) methanol.

In one aspect, the technology disclosed in the present disclosure is effective in providing a spermidine derivative compound, a salt thereof, a hydrate thereof, a solvate thereof, or an isomer thereof.

In another aspect, the technology disclosed in the present disclosure is effective in providing an anti-allergy composition comprising a spermidine derivative compound, a salt thereof, a prodrug thereof, a hydrate thereof, a solvate thereof, or an isomer thereof as an active ingredient.

In another aspect, the technology disclosed in the present disclosure is effective in providing a method for preparing a spermidine derivative compound.

1 shows the results of HPLC analysis of a borage extract according to an embodiment.
2 shows the cytotoxicity evaluation results of N,N'-dicumaroylspermidine compounds according to an experimental example (Nor: Normal, DCS: N,N'-dicumaroylspermidine, *** : p<0.001).
FIG. 3 is a diagram showing the main HMBC (Heteronuclear multiple-bond correlation spectroscopy) association of N,N'-dicumaroylspermidine compounds.
4 is a HR-ESI-MS (High resolution - Electrospray ionization - Mass spectrometry) diagram of the N,N'-dicumaroylspermidine compound.
5 shows a ¹ H-NMR spectrum of the N,N'-dicumaroylspermidine compound.
6 shows a ¹³ C-NMR spectrum of the N,N'-dicumaroylspermidine compound.
FIG. 7 shows a Heteronuclear single-quantum correlation spectroscopy (HSQC) NMR spectrum of the N,N'-dicumaroylspermidine compound.
FIG. 8 shows a Heteronuclear multiple-bond correlation spectroscopy (HMBC) NMR spectrum of the N,N'-dicumaroylspermidine compound.
9 shows a COZY (correlation spectroscopy) NMR spectrum of the N,N'-dicumaroylspermidine compound.
10 shows the test results of mast cell degranulation inhibitory efficacy of N,N'-dicumaroylspermidine according to an experimental example (Nor: Normal, Con: Control, DCS 100: N,N'-dicumaroyls) Fermidine 100 μM, DCS 50: N,N′-dicumaroylspermidine 50 μM, Ro: Rottlerin (Rottlerin, positive control), ***: p<0.001).
11 shows a comparison result of mast cell degranulation inhibitory efficacy of N,N'-dicumaroylspermidine, lysospermic acid and salvianolic acid A according to an experimental example (Nor: Normal, Con: Control, DCS 100: N,N'-dicumaroylspermidine 100 μM, DCS 50: N,N′-dicumaroylspermidine 50 μM, Li 100: lysospermic acid 100 μM, Li 50: lysospermic acid 50 μM, Sal 100: salvianolic acid A 100 μM, Sal 50: salvianolic acid A 50 μM, Ro: rotlerin, *: p<0.05, ***: p<0.001).
12 shows a comparison result of mast cell degranulation inhibitory efficacy of N,N'-dicumaroylspermidine and spermidine according to an experimental example (Nor: Normal, Con: Control, DCS: N,N' -dicumaroylspermidine, SP: spermidine, Ro: rotlerin, **: p<0.01, ***: p<0.001).
13 shows the results of an experiment on the inhibition of cytokine expression of N,N'-dicumaroylspermidine according to an experimental example (Nor: Normal, Con: Control, DCS: N,N'-dicumaroylspermidine) Dean, Ro: rotlerin, *: p<0.05, **: p<0.01, ***: p<0.001).

Hereinafter, the present disclosure will be described in detail.

In one aspect, the present disclosure provides a spermidine derivative compound, a salt thereof, a hydrate thereof, a solvate thereof, or an isomer thereof.

In another aspect, the present disclosure provides a composition for anti-allergy comprising a spermidine derivative compound, a salt thereof, a prodrug thereof, a hydrate thereof, a solvate thereof, or an isomer thereof as an active ingredient.

In the present disclosure, "active ingredient" refers to a component capable of exhibiting a desired activity by itself or in combination with a carrier having no activity by itself.

In the present disclosure, "allergy" refers to a reaction state different from the normal or hypersensitivity state that an organism appears in contact with a certain foreign substance (allergen), and refers to a change in the reaction in vivo caused by an antigen-antibody reaction. The type of the foreign material is not limited, and may include, for example, pollen, drugs, vegetable fibers, fine dust, bacteria, food, dyes, or chemicals, but is not limited thereto. "Anti-allergic" means preventing, reducing, alleviating, ameliorating and/or treating such allergic reactions.

In an exemplary embodiment, the compound may have a structure of Formula 1 below.

[Formula 1]

The R ₁ , R ₂ and R ₃ are each independently hydrogen, p-coumaroyl (p-coumaroyl), feruloyl (feruloyl), caffeoyl (caffeoyl), benzoyl (benzoyl), cinnamoyl (cinnamoyl), or vanilloyl.

[p-Kumaroyl]

[Feruloyl]

[Cafe Oil]

[benzoyl]

[Cinnamoil]

[Vanilloyl]

In an exemplary embodiment, R ₁ and R ₃ are each independently p-coumaroyl (p-coumaroyl), feruloyl or caffeoyl, and R ₂ may be hydrogen. .

In an exemplary embodiment, the compound may be N,N'-dicumaroylspermidine having a structure represented by the following Chemical Formula 1a.

[Formula 1a]

As used herein, "salt" is meant to include "pharmaceutically acceptable salts". The “salt” or “pharmaceutically acceptable salt” refers to a salt according to one aspect of the present disclosure that is pharmaceutically acceptable and has the desired pharmacological activity of the parent compound. Examples include conventional salts formed with inorganic or organic acids or inorganic or organic bases and acid addition salts of quaternary ammonium. The salt is formed by (1) an inorganic acid such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like; or acetic acid, propionic acid, hexanoic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, malic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, 3-(4-hydroxybenzoyl) Benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethane-disulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo[2,2,2]-oct-2-ene-1-carboxylic acid, glucoheptonic acid, 3-phenylpropionic acid, trimethylacetic acid, tert -acid addition salts formed with organic acids such as butylacetic acid, lauryl sulfuric acid, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid, muconic acid, and the like; or (2) salts formed when an acidic proton present in the parent compound is substituted. Specific examples of suitable base salts are sodium, lithium, potassium, magnesium, aluminum, calcium, zinc, N,N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, N-methylglucosamine and procaine. salts of

As used herein, "pharmaceutically acceptable" means that it can be used in animals, more specifically humans, by avoiding significant toxic effects when used in conventional medical dosages, and may be approved by the government or a regulatory body equivalent thereto. or approved, or listed in the Pharmacopoeia or recognized as other common pharmacopeias.

In an exemplary embodiment, the compound may be included in the composition in the form of a prodrug. The "prodrug" refers to a drug whose physical and chemical properties are controlled by chemically changing a drug, and although it does not show physiological activity itself, it is converted into the original drug by chemical or enzymatic action in the body after administration to improve its efficacy can perform That is, when a prodrug is administered, it is converted into an active drug through chemical conversion through metabolic processes. In general, such prodrugs are functional derivatives of compounds and are readily converted into the desired compounds in vivo. For example, conventional methods for selecting and preparing suitable prodrug derivatives are described in "Design Of Prodrugs", H Bund Saard, Elsevier, 1985. The entire contents of this document are incorporated herein by reference.

As used herein, "hydrate" refers to a compound to which water is bound, and is a broad concept including inclusion compounds that do not have a chemical bonding force between water and the compound.

As used herein, "solvate" refers to a higher-order compound formed between a molecule or ion of a solute and a molecule or ion of a solvent.

In an exemplary embodiment, the compound may be included in the composition in the form of an isomer. The "isomer" refers to a relationship between compounds having the same chemical formula but not the same, and the types of such isomers include structural isomers, geometric isomers, stereoisomers, and optical isomers.

Structural isomers refer to compounds having the same molecular formula but different structures. The geometric isomer refers to isomers having different spatial arrangements of atoms or groups of atoms bonded to two atoms connected by a double bond. Stereoisomers refer to compounds that have the same chemical constitution but differ from each other in terms of the arrangement of atoms or groups in space. Optical isomers (enantiomers) mean two stereoisomers of a compound that have non-superimposable mirror images of each other. By diastereomer is meant a stereoisomer that has two or more asymmetric centers and whose molecules are not mirror images of each other.

As used herein, "isomers" in particular refer to optical isomers (e.g., essentially pure enantiomers, essentially pure diastereomers or mixtures thereof), as well as conformational isomers. isomers) (i.e. isomers that differ only in the angle of one or more chemical bonds), position isomers (especially tautomers) or geometric isomers (e.g., cis-trans isomers) can

"Essentially pure" as used herein, e.g., when used in reference to enantiomers or diisomers, is at least about 90%, specifically at least about 95% of the specific compound exemplified by the enantiomer or diastereomer. , at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% (w/w).

In an exemplary embodiment, the compound may be isolated from Lithospermum erythrorhizon .

In an exemplary embodiment, the compound may be isolated from borage roots.

In an exemplary embodiment, the composition may have degranulation inhibitory activity of mast cells.

In an exemplary embodiment, the composition may have an activity of inhibiting the expression of one or more cytokines selected from the group consisting of IL-3, IL-4 and IL-13.

In an exemplary embodiment, the active ingredient may be included in an amount of 0.001 to 10% by weight based on the total weight of the composition. In another aspect, the active ingredient is 0.001 wt% or more, 0.01 wt% or more, 0.1 wt% or more, 1 wt% or more, 2 wt% or more, 3 wt% or more, 4 wt% or more, or 5 wt% or more, based on the total weight of the composition It may be included in an amount greater than or equal to 10 wt%, less than or equal to 10 wt%, less than or equal to 9 wt%, less than or equal to 8 wt%, less than or equal to 7 wt%, less than or equal to 6 wt% or less than or equal to 5 wt%.

In an exemplary embodiment, the composition may be a pharmaceutical composition for preventing or treating allergic diseases.

In an exemplary embodiment, the composition may be a food composition for alleviating allergic diseases.

In an exemplary embodiment, the food composition may be a health functional food composition.

In an exemplary embodiment, the composition may be a cosmetic composition for improving allergic diseases.

In the present disclosure, "for the prevention or treatment of allergy" is intended to include all of the use of the prevention or treatment of allergy and allergy-related diseases. The method of prevention or treatment is not limited, for example, it is possible to prevent the disease by fundamentally inhibiting the production of allergens, etc., but is not limited thereto.

In the present disclosure, "for allergen improvement" includes all uses for reducing or alleviating allergy and allergy-related diseases. Specifically, it may include reducing or alleviating the degree of a disease that has already occurred, and considering that the composition of the present disclosure fundamentally inhibits allergens, it will be possible to prevent allergies and diseases related to allergies, but is limited thereto it is not

Allergic diseases are mostly caused by chemical mediators (mainly histamine, prostaglandin, leukotriene, TNF-α, cytokines, etc.) released from mast cell granules in tissues activated by antigen-antibody reaction. The composition according to the present disclosure suppresses the degranulation of mast cells and suppresses the cytokine expression of IL-3, IL-4, and IL-13 that induces an allergic response, thereby not only alleviating the symptoms of allergic diseases, but also fundamentally eliminating allergic diseases without side effects. to provide an improvement and/or therapeutic effect.

In an exemplary embodiment, the allergic disease is allergic rhinitis, allergic asthma, hay fever, Quincke's edema, anaphylaxis, hives, allergies It may be one or more selected from the group consisting of allergic conjunctivitis, allergic keratitis, atopic dermatitis and allergic contact dermatitis.

In another aspect, the present disclosure provides a method for preparing the spermidine derivative compound, the method comprising the steps of: 1) preparing a borage extract; 2) systemically fractionating the extract of the borage extract with hexane, dichloromethane, ethyl acetate, butyl alcohol and water to obtain a hexane layer; and 3) separating the hexane layer by chromatography to obtain N,N'-dicumaroylspermidine having a structure represented by Formula 1a.

In an exemplary embodiment, the extract of borage in step 1) may be an alcohol extract.

In an exemplary embodiment, the alcohol extract may be extracted with a mixed solvent of water and alcohol.

In an exemplary embodiment, the alcohol may include ethanol.

In an exemplary embodiment, the alcohol may have a concentration of 70 to 94% by volume. In another exemplary embodiment, the alcohol is at least 70% by volume, at least 74% by volume, at least 78% by volume, at least 82% by volume, at least 88% by volume, or at least 92% by volume, and 94% by volume or less or 90% by volume or more It may have a concentration of less than or equal to.

In an exemplary embodiment, the alcohol may be 94% (v/v) ethanol.

In an exemplary embodiment, the extract of Chichi in step 1) may be extracted by reflux extraction after adding a mixed solvent of water and alcohol.

In an exemplary embodiment, the reflux extraction may be carried out at 70 to 100 °C. In another exemplary embodiment, the reflux extraction is 70 °C or higher, 75 °C or higher, 80 °C or higher, 85 °C or higher, or 90 °C or higher, 100 °C or lower, 95 °C or lower, 90 °C or lower, 85 °C or lower, 80 °C or higher It may be carried out at a temperature of ℃ or less or 75 ℃ or less.

In an exemplary embodiment, step 2) may be system fractionation by sequentially adding hexane, dichloromethane, ethyl acetate, butyl alcohol and water to the extract of chia.

In an exemplary embodiment, step 3) may be to perform chromatography using a mixed solvent of water and methanol as a mobile phase.

In an exemplary embodiment, in step 3), a 95% (v/v) methanol fraction is obtained by gel filtration chromatography, and then an elution solvent is added to N,N'-di having the structure represented by Formula 1a. It may be to isolate coumaroylspermidine.

In an exemplary embodiment, the elution solvent may be 95% (v/v) methanol.

In an exemplary embodiment, the pharmaceutical composition may further contain pharmaceutical adjuvants such as preservatives, stabilizers, wetting agents or emulsification accelerators, salts and/or buffers for regulating osmotic pressure, and other therapeutically useful substances, According to a conventional method, it can be formulated in the form of various oral or parenteral administration preparations.

The oral administration agents include, for example, tablets, pills, hard and soft capsules, solutions, suspensions, emulsifiers, syrups, powders, powders, fine granules, granules, pellets, etc., and these formulations include surfactants, diluents ( Examples: lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and glycine), lubricants (eg silica, talc, stearic acid and its magnesium or calcium salts and polyethylene glycol). Tablets may also contain binders such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and polyvinylpyrrolidine, optionally starch, agar, alginic acid or sodium salt thereof. It may contain pharmaceutical additives such as disintegrants, absorbents, colorants, flavoring agents and sweetening agents, such as. The tablet may be prepared by a conventional mixing, granulating or coating method.

In addition, the parenteral dosage form may be a transdermal dosage form, for example, injections, drops, ointments, lotions, gels, creams, sprays, suspensions, emulsions, patches, etc., but are limited thereto. it's not going to be

In an exemplary embodiment, the determination of the dosage of the active ingredient is within the level of those of ordinary skill in the art, and the daily dosage of the drug may vary depending on the degree of progression of the subject to be administered, the onset time, age, health status, complications, etc. Although it depends on factors, based on an adult, 1 μg/kg to 200 mg/kg of the composition in one aspect, and 50 μg/kg to 50 mg/kg in another aspect are administered in divided doses 1 to 3 times a day. and the dosage is not intended to limit the scope of the present disclosure in any way.

In an exemplary embodiment, the pharmaceutical composition may be an external preparation for the skin, and the external preparation for skin may include any drug applied outside the skin as a generic term, and pharmaceuticals of various formulations may be included herein.

In an exemplary embodiment, the food composition may be in a liquid or solid form, for example, various foods, beverages, gums, tea, vitamin complexes, health supplements, etc., powders, granules, tablets, It may be used in the form of capsules or beverages. The food composition of each formulation can be formulated by appropriately selecting ingredients commonly used in the field without difficulty by those skilled in the art according to the formulation or purpose of use.

There is no particular limitation on the liquid component that may be contained in the composition according to the present disclosure, and it may include various flavoring agents or natural carbohydrates as additional components like a conventional beverage. Examples of the natural carbohydrate include monosaccharides, disaccharides such as glucose and fructose, polysaccharides such as maltose and sucrose, conventional sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol etc. As the flavoring agent, natural flavoring agents (taumatin, stevia extract) and synthetic flavoring agents (eg, saccharin, aspartame, etc.) can be advantageously used. The proportion of the natural carbohydrate may be generally about 1 to 20 g, in one aspect, about 5 to 12 g per 100 ml of the composition disclosed in the present disclosure.

In an exemplary embodiment, the food composition comprises, in one aspect, various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and salts thereof, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like. In another aspect, it may include pulp for the production of natural fruit juices and vegetable beverages. The above components may be used independently or in combination. The proportion of the additive may vary, but is generally selected in the range of 0.001 to about 20 parts by weight per 100 parts by weight of the composition disclosed in the present disclosure.

In an exemplary embodiment, the cosmetic composition may further include a functional additive and a component included in a general cosmetic composition. The functional additive may include a component selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, high-molecular peptides, high-molecular polysaccharides, sphingolipids, and seaweed extract. Other ingredients included include oils and fats, moisturizers, emollients, surfactants, organic and inorganic pigments, organic powders, UV absorbers, preservatives, fungicides, antioxidants, plant extracts, pH adjusters, alcohols, pigments, fragrances, blood circulation Accelerators, cooling agents, limiting agents, purified water, and the like can be exemplified.

The formulation of the cosmetic composition is not particularly limited, and may be appropriately selected according to the purpose. For example, skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nourishing lotion, massage cream, nourishing cream, moisture cream, hand cream, foundation, essence, nourishing essence, pack, soap, cleansing It may be prepared in any one or more formulations selected from the group consisting of foam, cleansing lotion, cleansing cream, body lotion and body cleanser, but is not limited thereto.

When the formulation of the present disclosure is a paste, cream or gel, animal fiber, vegetable fiber, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component. can

When the formulation of the present disclosure is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, additional chlorofluorohydrocarbon, propane /may contain propellants such as butane or dimethyl ether.

When the formulation of the present disclosure is a solution or emulsion, a solvent, solvating agent or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 ,3-butylglycol oil, glycerol fatty esters, fatty acid esters of polyethylene glycol or sorbitan.

When the formulation of the present disclosure is a suspension, as the carrier component water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, microcrystalline Cellulose, aluminum metahydroxide, bentonite, agar or tracanth may be used.

When the formulation of the present disclosure is a surfactant-containing cleansing agent, as carrier components, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide Ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, linolin derivative or ethoxylated glycerol fatty acid ester and the like can be used.

Hereinafter, the present disclosure will be described in more detail through examples. These examples are only for illustrating the present disclosure, and it will be apparent to those of ordinary skill in the art that the scope of the present disclosure is not to be construed as being limited by these examples.

Example . from exhaustion separation of compounds

Jichi ( Lithospermum ) purchased in Jeongseon, Gangwon-do in August 2016 erythrorhizon ) was used to prepare a borage extract as follows. 33 g of dried borage roots were finely pulverized, and 94% (v/v) ethanol solution was added to the pulverized borage roots and extracted three times by reflux extraction at 70° C. for 4 hours. All of the ethanol solution was removed under vacuum from the extract obtained from the above series of processes to obtain 3 g of the extract of the extract of the extract of Bochi.

One of spermidine derivatives, N,N'-dicumaroylspermidine, was isolated using the prepared Jichi extract. First, the extract was subjected to systemic fractionation with hexane, methylene chloride, ethyl acetate, butanol and water. Thereafter, the hexane layer was further separated under water-methanol gradient (9:1 to 0:10) conditions using an ODS open column to obtain 5 fractions. The second separation material of the 5 fractions was further separated under the same conditions using an ODS open column, and separated by molecular weight under the conditions of 95% methanol as the elution solvent using Sephadex LH-20 column to obtain N,N'-dicumaroyls Fermidine was obtained.

[N,N'-dicumaroylspermidine]

Position 3 ^δ C ^δ H One 140.73 7.51 (1H, d, J=15.56) 2 116.24 6.42 (1H, d, J =15.68) 3 168.05 4 35.56 3.43 (2H, t, J =6.40) 5 26.58 1.89-1.99 (2H, m) 6 44.96 2.99-3.08 (2H, m) 7 47.62 2.99-3.08 (2H, m) 8 26.32 1.65-1.82 (2H, m) 9 23.28 1.65-1.82 (2H, m) 10 38.10 3.37 (2H, t, J =6.72) 11 168.93 12 116.91 6.42 (1H, d, J =15.68) 13 141.40 7.47 (1H, d, J=15.56) One' 126.02 2' 129.17 7.41 (1H, d, J =8.64) 3' 115.36 6.80 (1H, d, J =8.56) 4' 159.26 5' 115.36 6.80 (1H, d, J =8.56) 6' 129.17 7.41 (1H, d, J =8.64) One" 126.18 2" 129.30 7.42 (1H, d, J =8.68) 3" 115.39 6.80 (1H, d, J =8.56) 4" 159.42 5" 115.39 6.80 (1H, d, J =8.56) 6" 129.30 7.42 (1H, d, J =8.68)

In addition, chemical components were analyzed using HPLC, LC-MS, and NMR analysis methods for the prepared borage extract. The extract was loaded at 20 mg/ml and subjected to HPLC analysis. Table 2 below shows the HPLC analysis conditions, and Table 3 shows the name of the compound corresponding to each peak number in FIG.

Time Water
(0.1% Formic acid) Acetonitrile
(0.1% Formic acid) 0 95 5 2 95 5 40 50 50 60 50 50 61 30 70 71 30 70 72 20 80 85 20 80 90 5 95 95 95 5 Column: Hydrosphere C18 (Ø4.6x250 mm, 5 μm)
Flow rate: 0.7 ml/min
Injection volume: 10 μL
Detection wavelength: 280 nm
Running time: 95 min
Column temperature: 25 °C

No. compound name One N,N'-dicumaroylspermidine (N,N'-dicoumaroylspermidine) 2 Rosmarinic acid 3 Lithospermic acid 4 Salvianolic acid A 5 Shikonin 6 Shikonofuran D 7 Shikonofuran E 8 β-hydroxyisovalerylshikonin 9 Acetylshikonin 10 Deoxyshikonin 11 Anhydroalkannin 12 Isobutyrylshikonin 13 β,β-dimethylacryloylshikonin (β,β-dimethylacryloylshikonin) 14 Isovalerylshikonin 15 (α-methylbutyryl)shikonin ((α-methylbutyryl)shikonin)

Experimental Example 1. Cytotoxicity evaluation

The cytotoxicity of N,N'-dicumaroylspermidine was confirmed as follows. RBL-2H3 cells (rat, mast cells) were treated with the same amount of N,N'-dicumaroylspermidine at a concentration of 50 μM and cyconin at a concentration of 50 μM, respectively, and cultured for 24 hours. It was confirmed by MTT assay according to the method of

As a result, as shown in FIG. 2 , it was confirmed that cyconin, which is known as an active ingredient of Chichi, has high cytotoxicity and is not preferable in terms of harm to the human body. On the other hand, it was confirmed that N,N'-dicumaroylspermidine can be safely used without cytotoxicity due to high cell viability when treated with RBL-2H3, a mast cell, at the same concentration (50 μM) as cyconin.

Experimental Example 2. Degranulation inhibitory effect

In order to confirm the degranulation inhibitory effect of N,N'-dicumaroylspermidine, an allergic reaction of mast cells was induced, and β-hexosaminidase (β- The degranulation inhibitory efficacy of N,N'-dicumaroylspermidine was tested through the activity of hexosaminidase) and the amount of histamine released.

Specifically, RBL-2H3 cells were aliquoted in a 24-well plate at a concentration of 1×10 ⁵ cells/well, and 100 units/mL penicillin, 100 μg/mL streptomycin, and 5% (v/v) fetal bovine serum were added. It was cultured overnight in MEM medium at 37° C., 5% CO ₂ and humidified conditions. After completion of the culture, the cells were washed with 1×PBS buffer, and the cells were sensitized by incubation with 100 ng/mL of DNP-IgE (Sigma, Co., Ltd) for 24 hours. Siraganian buffer (119 mM NaCl, 5 mM KCl, 5.6 mM glucose, 0.4 mM MgCl ₂ , 1 mM CaCl ₂ , 25 mM piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES), 0.1% bovine After washing twice with 400 μl of bovine serum albumin (BSA) and 40 mM NaOH, pH 7.2), Siraganian buffer was filled at 180 μl/well and incubated for 10 minutes. In 20 μl, each concentration of N,N'-dicumaroylspermidine, lysospermic acid, salvianolic acid A, spermidine, and rotlerin was added and incubated for 1 hour, then DNP to induce hypersensitivity reaction. -BSA (Dinitrophenyl-albumin from bovine serum, Sigma, Co., Ltd.) 100 ng/mL was added and incubated for 1 hour again. Thereafter, the reaction was stopped on ice for 10 minutes, and the supernatant was taken and centrifuged at 17,000 × g at 4° C. for 10 minutes.

To measure the activity of β-hexosaminidase after transferring 50 μl of the supernatant to a 96 well pool, 1 mM p-nitrophenyl-N-acetyl-β prepared in 0.1 M citrate buffer buffer (pH 4.5) -D-glucosaminide 50 μl was put in a 96-well plate and incubated at 37 °C. After 1 hour of incubation, the reaction was terminated with 0.1 M Na ₂ CO ₃ buffer (pH 10.0), and the amount of p-nitrophenol was measured by absorbance at 405 nm to determine the activity of β-hexosaminidase. did. Each result is expressed as the average value of three experiments.

As a result, it was confirmed that N,N'-dicumaroylspermidine had anti-allergic activity by inhibiting degranulation of mast cells. It was found to be significantly higher than that of other compounds contained in lysospermic acid or salvianolic acid A (see FIGS. 10 and 11 ). In addition, it was confirmed that N,N'-dicumaroylspermidine had significantly higher anti-allergic activity compared to when spermidine was treated at the same concentration of 100 μM (see FIG. 12 ).

Experimental example 3. Cytokine Inhibition Efficacy

In order to confirm the cytokine secretion inhibitory efficacy of N,N'-dicumaroylspermidine, RBL-2H3 cells were cultured in the same manner as in Experimental Example 2 to induce an allergic reaction of mast cells, N,N'- Dicoumaroylspermidine and rotlerin were treated at a concentration of 50 μM. Total RNA was isolated from mast cells using RNeasy mini kit (Qiage), and cDNA was prepared using random primers and Superscript III (Invitrogen). Real-time PCR for quantitative analysis was performed using an Applied Biosystems® 7500 instrument, and primers corresponding to each cytokine gene are shown in Table 4. All expressions were indicated by correction with GAPDH, a housekeeping gene.

Gene product Forward primer (5'-3') Reverse primer (3'-5') IL-3 ACAATGGTTCTTGCCAGCTCTAC AGGAGCGGGAGCAGCAT IL-4 CAGGGTGCTTCGCAAATTTTAC ACCGAGAACCCCAGACTTGTT IL-13 AGGAGCTGAGCAACATCACAC CCATAGCGGAAAAGTTGCTT GAPDH TTCACCACCATGGAGAAGGC GGCATGGACTGTGGTCATGA

As a result, as shown in FIG. 13, N,N'-dicumaroylspermidine suppressed the cytokine expression of IL-3, IL-4, and IL-13 inducing allergy, indicating that it has excellent anti-allergic activity. Confirmed.

Formulation examples of the composition according to an aspect of the present disclosure will be described below, but other various formulations may also be applied, which is not intended to limit the present disclosure, but merely to describe in detail.

[ Formulation example One] soft capsules

Mix N,N'-dicumaroylspermidine 20 mg, palm oil 2 mg, hydrogenated palm oil 8 mg, yellow wax 4 mg and lecithin 6 mg, and fill 400 mg per capsule according to the usual method to obtain soft capsules. prepared.

[ Formulation example 2] tablets

20 mg of N,N'-dicumaroylspermidine, 100 mg of glucose, 50 mg of red ginseng extract, 96 mg of starch and 4 mg of magnesium stearate were mixed, and 40 mg of 30% ethanol was added according to a conventional method to granulate. After forming, it was dried at 60° C. and compressed into tablets using a tablet press.

[ Formulation example 3] granules

After mixing 20 mg of N,N'-dicumaroylspermidine, 100 mg of glucose, 50 mg of red ginseng extract and 600 mg of starch, 100 mg of 30% ethanol was added according to a conventional method to form granules, and then at 60 ° C. was dried in the oven, and the granules were filled in a sachet. The final weight of the contents was 1 g.

[ Formulation example 4] Ointment

An ointment was prepared in a conventional manner according to the composition described below (% by weight).

N,N'-dicumaroylspermidine .............. 3.0

Glycerin ............................... 8.0

Butylene Glycol ............... 4.0

Liquid Paraffin ............................... 15.0

Beta glucan ............................... 7.0

Carbomer ............................... 0.1

Caprylic/Capric Triglycerides.......3.0

Squalane ............................... 1.0

Cetearyl Glucoside ............... 1.5

Sorbitan Stearate...............0.4

Cetearyl Alcohol...............1.0

Beeswax................................... 4.0

Preservatives, colorants, fragrances ............... Appropriate amount

Purified water............................... Remaining amount

[ Formulation example 5] Drinks

20 mg of N,N'-dicumaroylspermidine, 10 g of glucose, 50 mg of red ginseng extract, 2 g of citric acid and 187.8 g of purified water were mixed and filled in a bottle. The final volume of the contents was 200 ml.

[ Formulation example 6] Manufacturing of health food

N,N'-dicumaroylspermidine ...............20 mg

vitamin mixture

Vitamin A Acetate ..............................70 μg

Vitamin E ..................................... 1.0 mg

Vitamin B1 ............................... 0.13 mg

Vitamin B2 ............................... 0.15 mg

Vitamin B6 ............................... 0.5 mg

Vitamin B12 ............................... 0.2 μg

Vitamin C .................................. 10 mg

Biotin ............................................... 10 μg

Nicotinamide ............................... 1.7 mg

Folic acid .................................... 50 μg

Calcium pantothenate ............... 0.5 mg

mineral mixture

Ferrous sulphate ............................... 1.75 mg

Zinc Oxide ............................... 0.82 mg

Magnesium carbonate ............................... 25.3 mg

Potassium Phosphate ............................... 15 mg

Dibasic Calcium Phosphate ............................... 55 mg

Potassium citrate ............................... 90 mg

Calcium carbonate ............................... 100 mg

Magnesium Chloride .................... 24.8 mg

The composition ratio of the vitamin and mineral mixture is a composition that is relatively suitable for health food in a preferred embodiment, but the mixing ratio may be arbitrarily modified. The granules can be prepared, and health food can be prepared according to a conventional method.

[ Formulation example 7] Manufacture of health drinks

N,N'-dicumaroylspermidine ....................20 mg

Citric acid ............................... 1000 mg

Oligosaccharides .................................... 100 g

Plum Concentrate ............................... 2 g

Taurine ............................................... 1 g

Purified water was added to the total ...............900 ml

After mixing the above ingredients according to a conventional health drink manufacturing method, stirring and heating at 85° C. for about 1 hour, the resulting solution was filtered and obtained in a sterilized 2L container, sealed and sterilized, and then stored in a refrigerator. Although the composition ratio is prepared by mixing ingredients suitable for relatively favorite beverages in a preferred embodiment, the mixing ratio may be arbitrarily modified according to regional and national preferences such as demanding class, demanding country, and use.

[ Formulation example 8] Nourishing Cream

A nourishing cream was prepared in a conventional manner according to the composition described below (% by weight).

N,N'-dicumaroylspermidine............. 0.1

Glycerin ............................... 3.5

Butylene Glycol .............................. 3.0

Liquid paraffin ............................... 7.0

Beta Glucan ............................... 7.0

Carbomer................................... 0.1

Caprylic/Capric Triglycerides .....3.0

Squalane ............................... 5.0

Cetearyl Glucoside ............... 1.5

Sorbitan Stearate ....................0.4

Polysorbate 60.............................. 1.2

Tromethamine ............................... 0.1

Preservatives, fragrances.............................. Appropriate amount

Purified water ............................... Remaining amount

Above, specific parts of the present disclosure have been described in detail, for those of ordinary skill in the art, these specific techniques are only preferred embodiments, and it is clear that the scope of the present disclosure is not limited thereby. something to do. Accordingly, it is intended that the substantial scope of the present disclosure be defined by the appended claims and their equivalents.

Claims (16)

It is a pharmaceutical composition for the prevention or treatment of allergic diseases,
The composition comprises a spermidine derivative compound, a salt thereof, a prodrug thereof, a hydrate thereof, or a solvate thereof as an active ingredient,
The compound has a structure represented by the following formula (1).
The allergic diseases include allergic rhinitis, allergic asthma, hay fever, Quincke's edema, anaphylaxis, hives, allergic conjunctivitis, At least one selected from the group consisting of allergic keratitis, atopic dermatitis, and allergic contact dermatitis, a pharmaceutical composition for the prevention or treatment of allergic diseases.
[Formula 1]

The R ₁ and R ₃ are each independently p-coumaroyl (p-coumaroyl), feruloyl or caffeoyl, and R ₂ is hydrogen. The method of claim 1,
The composition has one or more cytokine expression inhibitory activity selected from the group consisting of IL-3, IL-4, and IL-13 that has degranulation inhibitory activity of mast cells, for the prevention or treatment of allergic diseases pharmaceutical composition. The method of claim 1,
The compound is N,N'-dicumaroylspermidine (N,N'-dicoumaroylspermidine) having a structure represented by the following Chemical Formula 1a, a pharmaceutical composition for preventing or treating allergic diseases.
[Formula 1a]

It is a cosmetic composition for the improvement of allergic diseases,
The composition comprises a spermidine derivative compound, a salt thereof, a prodrug thereof, a hydrate thereof, or a solvate thereof as an active ingredient,
The compound has a structure represented by the following formula (1).
The allergic diseases include allergic rhinitis, allergic asthma, hay fever, Quincke's edema, anaphylaxis, hives, allergic conjunctivitis, At least one selected from the group consisting of allergic keratitis, atopic dermatitis and allergic contact dermatitis, a cosmetic composition for improving allergic diseases.
[Formula 1]

The R ₁ and R ₃ are each independently p-coumaroyl (p-coumaroyl), feruloyl or caffeoyl, and R ₂ is hydrogen. 5. The method of claim 4,
The composition has a degranulation inhibitory activity of mast cells, or has one or more cytokine expression inhibitory activity selected from the group consisting of IL-3, IL-4 and IL-13, a cosmetic composition for improving allergic diseases . 5. The method of claim 4,
The compound is N,N'-dicumaroylspermidine (N,N'-dicoumaroylspermidine) having a structure represented by the following Chemical Formula 1a, a cosmetic composition for the improvement of allergic diseases.
[Formula 1a]

It is a food composition for the improvement of allergic diseases,
The composition comprises a spermidine derivative compound, a salt thereof, a prodrug thereof, a hydrate thereof, or a solvate thereof as an active ingredient,
The compound has a structure represented by the following formula (1).
The allergic diseases include allergic rhinitis, allergic asthma, hay fever, Quincke's edema, anaphylaxis, hives, allergic conjunctivitis, Allergic keratitis (allergic keratitis), atopic dermatitis (atopic dermatitis) and allergic contact dermatitis (allergic contact dermatitis) at least one selected from the group consisting of, a food composition for improving allergic diseases.
[Formula 1]

The R ₁ and R ₃ are each independently p-coumaroyl (p-coumaroyl), feruloyl or caffeoyl, and R ₂ is hydrogen. 8. The method of claim 7,
The composition has a degranulation inhibitory activity of mast cells, or has one or more cytokine expression inhibitory activity selected from the group consisting of IL-3, IL-4 and IL-13, food composition for improving allergic diseases . 8. The method of claim 7,
The compound is N,N'-dicumaroylspermidine (N,N'-dicoumaroylspermidine) having a structure represented by the following Chemical Formula 1a, a food composition for the improvement of allergic diseases.
[Formula 1a]

delete A method for preparing a spermidine derivative compound, the method comprising:
1) preparing a borage extract;
2) systemically fractionating the extract of the borage extract with hexane, dichloromethane, ethyl acetate, butyl alcohol and water to obtain a hexane layer; and
3) Separating the hexane layer by chromatography to obtain N,N'-dicumaroylspermidine having a structure represented by Chemical Formula 1a; Manufacturing method:
[Formula 1a]

. 12. The method of claim 11,
The method for producing a spermidine derivative compound, wherein the extract of borage in step 1) is an alcohol extract. 13. The method of claim 12,
The method for producing a spermidine derivative compound, wherein the alcohol includes ethanol. 12. The method of claim 11,
In step 3), chromatography is performed using a mixed solvent of water and methanol as a mobile phase, a method for producing a spermidine derivative compound. 15. The method of claim 14,
In step 3), a 95% (v/v) methanol fraction was obtained by performing chromatography, and then an elution solvent was added to separate N,N'-dicumaroylspermidine having a structure represented by Formula 1a. A method for preparing a phosphorus, spermidine derivative compound. 16. The method of claim 15,
The elution solvent is 95% (v/v) methanol, the method for producing a spermidine derivative compound.

Images