KR102369744B1 - Anti-inflammatory composition comprising buddleja davidii extract - Google Patents

Abstract

The present invention relates to an anti-inflammatory composition comprising an extract of Buddleja davidii .

Description

Anti-inflammatory composition comprising an extract of Budleya Davidi {ANTI-INFLAMMATORY COMPOSITION COMPRISING BUDDLEJA DAVIDII EXTRACT}

The present invention relates to an anti-inflammatory composition comprising an extract of Buddleja davidii .

Human skin is an organ in direct contact with the surrounding environment, and infections such as bacteria and fungi involved in various skin diseases easily occur. For example, Staphylococcus aureus, a Staphylococcus aureus that causes skin suppuration, Staphylococcus aureus , a skin flora, Staphlyococcus epidermidis , Acne Propionibacterium acnes acnes ), etc. exist on the skin, and these bacteria decompose the sebum or sweat secreted on the skin to generate odor, and the decomposition products stimulate the skin and cause inflammation. In particular, Propionibacterium acnes produces free fatty acids by decomposing sebum using lipase, which is a fatty acid degrading enzyme. These free fatty acids not only irritate the skin, but also cause inflammatory lesions such as papules, pustules, and nodules, which are red rashes seen in acne.

Antibacterial compounds such as triclocarban and triclosan have been used as antibacterial substances against these bacteria, but they are known to cause skin side effects such as skin burning, burning, and skin redness when used for a long period of time.

As described above, the conventional synthetic material for antibacterial and cosmetic composition including the same may cause skin irritation and a new composition of antibacterial material is needed in that skin troubles may occur.

Korean Patent Publication No. 10-2013-0121632

It is an object of the present invention to provide a composition for improving inflammation comprising an extract of Budleya Davidi.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating skin inflammatory diseases comprising the extract of Budleya Davidi.

Another object of the present invention is to provide a cosmetic composition for improving skin inflammation comprising the Budleya Davidi extract.

Another object of the present invention is to provide a food composition for improving skin inflammation comprising the Budleya Davidi extract.

One aspect of the present invention for achieving the above object, Buddleja davidii ( Buddleja davidii ) It relates to a composition for improving inflammation, comprising an extract.

Specifically, the inflammation may be caused by Propionebacterium acnes , but is not limited thereto.

In one embodiment of the present invention, when the inflammatory response caused by Propionebacterium acnes is treated with the Budleya Davidi extract of the present invention, it is confirmed that the inflammatory response is reduced by decreasing the expression of TLR-2 . was done (FIG. 1). In addition, when the Budleya Davidi extract was treated, the expression and activity of NF-kB was reduced (FIG. 3), and it was confirmed that the expression and activity of both p38 and JNK related to the MAPK pathway, which is another inflammatory reaction mechanism, were reduced. (Fig. 4).

Furthermore, it was confirmed that the expression of TNF-α, IL-1β, IL-6 and IL-8, known as pro-inflammatory cytokines, was also reduced (FIG. 5), the Budleya Davidi of the present invention By using the extract, it can be applied for the purpose of improving inflammation, as well as being used for prevention, treatment and/or improvement of inflammatory diseases.

In the present invention, "Buddleja davidii ( Buddleja davidii )" belongs to the family (Loganiaceae) and is a plant admiring flowers. It is widely cultivated as an ornamental plant, with varieties with various names. Its main habitat is Sichuan and Hebei in central China. The Budleya Davidi is mainly used for horticulture. Budleya disperses the cold, relieves lumps, stops pain, relieves headaches and joint pains caused by colds, and relieves lumps in the stomach and parasites. In addition, it is known to be effective in reducing heat, hemostatic action, and bruises and fractures, but the antibacterial effect on skin flora such as P. acnes and the effect of alleviating skin inflammation caused by it are not known in detail.

The "Budleya Davidi extract" is an extract obtained by extraction treatment of Budleya Davidi, a diluted or concentrated solution of the extract, a dried product obtained by drying the extract, a preparation or purified product of the extract, or a mixture thereof, etc. , including extracts of all formulations that can be formed using the extract itself and the extract.

In addition, the extract of the present invention may be extracted from a natural, hybrid or mutated plant of each of the corresponding plants, and may also be extracted from a plant tissue culture.

The method of extracting the extract of the present invention is not particularly limited, and may be extracted according to a method commonly used in the art. Non-limiting examples of the extraction method include hot water extraction, ultrasonic extraction, filtration, reflux extraction, and the like, and these may be performed alone or in combination of two or more methods.

The type of the extraction solvent used in the present invention is not particularly limited, and any solvent known in the art may be used. Non-limiting examples of the extraction solvent include water, C ₁ to C ₄ anhydrous or lower alcohol, a mixed solvent of water and lower alcohol, acetone, 1,3-butylene glycol, ethyl acetate, selected from the group consisting of chloroform It can be used individually as 1 or more types used, and 2 or more types can be mixed and used.

More specifically, water (or distilled water, purified water) may be used as the extraction solvent in the present invention. A solvent extract may be prepared by extracting Budleya Davidi one or more times using the solvent, and a dry extract obtained by distilling the solvent extract under reduced pressure and then freeze-drying or spray-drying may be prepared. In a specific embodiment of the present invention, water (or distilled water, purified water) was used to prepare a Budleya Davidi extract.

Another aspect of the present invention relates to a pharmaceutical composition for preventing or treating skin inflammatory diseases, comprising an extract of Budleya Davidi.

Specifically, the skin inflammatory disease may be one or more selected from the group consisting of acne, cellulitis, folliculitis, seborrheic dermatitis, and boils, but is not limited thereto, and all skin diseases including inflammation caused by skin flora may include More specifically, the skin flora may be Propionebacterium acnes , but is not limited thereto.

In the present invention, "acne" refers to an inflammatory disease that is infected by acne-causing bacteria or skin flora that occur in the hair follicles, hair follicles and surrounding tissues of the skin. Acne causative bacteria include Propionibacterium genus strains, more specifically Propionibacterium acnes , are known, and the term "acne skin" acne-causing bacteria or skin flora caused by acne, etc. It means skin prone to acne. The skin flora further expands the site of inflammation and can affect the worsening of acne, and the acne of the present invention can be applied regardless of the severity and type of acne, such as purulent acne.

In the present invention, “cellulitis” means acute purulent inflammation that appears in the dermis and subcutaneous tissue, and there is erythema, heat, edema, and pain in the dermis and subcutaneous tissue invaded by group A hemolytic streptococcus or Staphylococcus aureus. characteristic.

In the present invention, “folliculitis” refers to an inflammatory disease caused by bacteria in hair follicles, and Staphylococcus aureus is known as the most common causative organism. In the case of acne patients who have used antibiotics for a long time, Gram-negative bacteria may be the cause, and folliculitis caused by P. aeruginosa may occur after bathing in a hot tub.

In the present invention, "seborrheic dermatitis" is an inflammatory skin disease that tends to occur on the head, forehead, chest, armpits, etc., which secrete a lot of sebum, and is an inflammation that occurs as the proliferation of bacteria increases as the amount of sebum secretion increases. As one of the treatment methods, it is suggested to remove the strain that causes seborrheic dermatitis.

In the present invention, "a boil" is an inflammatory nodule that occurs in a hair follicle, and a nodule is called an abscess when the capsulitis becomes severe and enlarged. The main cause of boils is bacterial infection, the most common causative agent being staphylococcus.

It was confirmed that the composition of the present invention has excellent improvement and/or therapeutic effect on the inflammatory response caused by Propionibacterium acnes , a skin flora that causes inflammatory skin diseases, It can be applied to the treatment of inflammatory diseases.

For administration, the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier, excipient or diluent in addition to the Budleya Davidi extract of the present invention. The carrier, excipient and diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

In addition, the pharmaceutical composition of the present invention can be applied in any dosage form, specifically, it can be applied as an oral dosage form or a parenteral dosage form. The oral dosage form can be applied in the form of a liquid or tablet, and the parenteral dosage form can be in the form of a spray such as injection, application, or aerosol. More specifically, it may be in the form of an injection. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.

In addition, the pharmaceutical composition of the present invention may be applied in a pharmaceutically effective amount, and "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and effective Dosage levels depend on the patient's sex, age, type of disease, severity, drug activity, drug sensitivity, administration time, administration route and excretion rate, duration of treatment, factors including concomitant drugs, and other factors well known in the medical field. It may depend on factors.

Furthermore, the pharmaceutical composition of the present invention may be administered in combination with another therapeutic agent, and may be administered sequentially or simultaneously with other conventional therapeutic agents. In addition, the pharmaceutical composition of the present invention may be administered single or multiple. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, and can be easily determined as needed by those skilled in the art.

Another aspect of the present invention relates to a method of treating an inflammatory skin disease, comprising administering the pharmaceutical composition to a subject.

'Inflammatory skin disease' is as described above.

The term "subject" of the present invention includes animals or humans having a muscle disease or muscle damage whose symptoms can be improved by administration of the pharmaceutical composition according to the present invention.

By administering the pharmaceutical composition according to the present invention to an individual, muscle disease or muscle damage can be effectively prevented and treated.

The term "administration" of the present invention means introducing a predetermined substance into a human or animal by any suitable method, and the administration route of the pharmaceutical composition according to the present invention is through any general route as long as it can reach the target tissue. It may be administered orally or parenterally. In addition, the pharmaceutical composition according to the present invention can be administered by any device capable of moving the active ingredient to the target cell.

The preferred dosage of the pharmaceutical composition according to the present invention varies depending on the patient's condition and body weight, the degree of disease, drug form, administration route and period, but may be appropriately selected by those skilled in the art.

Another aspect of the present invention relates to a cosmetic composition for improving skin inflammation, comprising the Budleya Davidi extract.

The cosmetic composition of the present invention is a solution, external ointment, cream, foam, nourishing lotion, flexible lotion, pack, soft water, emulsion, makeup base, essence, soap, liquid detergent, bath agent, sunscreen cream, sun oil, suspension, emulsion Liquid, paste, gel, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, patch and spray can be prepared in a formulation selected from the group consisting of, but limited thereto not.

The cosmetic composition of the present invention may further include one or more cosmetically acceptable carriers to be formulated in general skin cosmetics, and common ingredients include, for example, oil, water, surfactant, humectant, lower alcohol, and thickener. , a chelating agent, a colorant, a preservative, a fragrance, and the like may be appropriately mixed, but the present invention is not limited thereto.

In addition, the cosmetic composition of the present invention can be used as a transdermal administration method, such as directly applied to the skin or sprayed, and the administration route of the composition of the present invention can be administered through any general route as long as it can reach the target tissue.

The amount of the composition of the present invention can be appropriately adjusted according to individual differences or formulations such as age and the degree of lesion, and it can be used for one week to several months by applying drops to the skin once to several times a day.

Another aspect of the present invention relates to a food composition for improving skin inflammation, comprising the Budleya Davidi extract.

There is no particular limitation on the type of the food. Foods to which the composition of the present invention can be added include sausages, meat, bread, chocolates, snacks, candy, confectionery, ramen, pizza, other noodles, gums, dairy products including ice cream, various soups, beverages, tea, drinks , alcoholic beverages, and vitamin complexes. When formulated into beverages, the liquid components added to the composition of the present invention are not limited thereto, but may contain various flavoring agents or natural carbohydrates as additional components as in conventional beverages. The above-mentioned natural carbohydrates include monosaccharides (eg, glucose, fructose, etc.), disaccharides (eg, maltose, sucrose, etc.) and polysaccharides (eg, common sugars such as dextrin, cyclodextrin, etc.), and xylitol, sorbitol , and may be a sugar alcohol such as erythritol.

The type of the food may specifically be a health functional food. The health functional food includes various nutrients, vitamins, minerals (electrolytes), synthetic flavoring agents and flavoring agents such as natural flavoring agents, coloring agents and enhancers (cheese, chocolate, etc.), pectic acid and salts thereof, organic acids, protective colloid thickening Agents, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonation agents used in carbonated beverages, and the like may be contained. In addition, the health functional food of the present invention may contain the pulp for the production of fruit and vegetable beverages. These components may be used alone or in combination, and the proportion of these additives is generally selected in the range of 0.001 to 50 parts by weight based on the total weight of the composition.

The health functional food is a food that emphasizes the bioregulatory function of food, and is a food with added value to act and express for a specific purpose using a physical, biochemical, and bioengineering method. The ingredients of these health functional foods are designed and processed to sufficiently exert the body control functions related to the body defense, regulation of body rhythm, prevention and recovery of diseases, and are food supplementary additives, sweeteners or functionalities that are acceptable as food. It may contain raw materials.

When the composition of the present invention is used as a health functional food (or health functional beverage additive), the composition may be added as it is or used with other food or food ingredients, and may be appropriately used according to a conventional method. The mixing amount of the composition may be appropriately determined depending on the purpose of its use (prevention, health or improvement, therapeutic treatment).

According to the present invention, the composition comprising the Budleya Davidi extract of the present invention not only exhibits excellent anti-inflammatory effect, but also does not cause side effects even when applied to the human body because it is non-toxic, so a pharmaceutical composition for treating inflammatory diseases, a cosmetic composition and It has high utility as a food composition.

It should be understood that the effects of the present invention are not limited to the above-described effects, and include all effects that can be inferred from the configuration of the invention described in the detailed description or claims of the present invention.

1 shows the results of confirming that the Budleya Davidi extract reduces the expression of TLR-2 increased by P. acnes again.
Figure 2 shows the experimental results for confirming whether the Budleya Davidi extract is toxic to human-derived cells (HaCaT).
3 shows the results of confirming that the Budleya Davidi extract reduced the activity of NF-κB, the activity of which was increased by P. acnes .
4 shows the results of confirming that the Budleya Davidi extract reduces the expression and activity of MAPK (p38 and JNK), the expression and activity of which are increased by P. acnes .
Figure 5 shows the results of confirming that the expression of pro-inflammatory cytokines (pro-inflammatory cytokines) is reduced according to the treatment of the Budleya Davidi extract.
6 is a schematic view showing the mechanism by which the Budleya Davidi extract reduces inflammation induced by P. acnes .

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples only illustrate the present invention, and the present invention is not limited by the following examples.

Example 1. Budleya Davidi ( Buddleja davidii ) Preparation of extract

The dried Buddleja davidii ( Buddleja davidii, origin: Jeju Island) was crushed, put in an extraction container, purified water was added 15 times, and then extracted by stirring at 60° C. for 3 hours. The extract was filtered with a filter paper and concentrated under reduced pressure at 50° C. until the filtrate was completely evaporated to prepare a Budleya Davidi extract.

Experimental Example 1. Budleya Davidi extract TLR-2 Confirmation of suppression of expression

In order to confirm the anti-inflammatory response by the Budleya Davidi extract, after treating the human - derived keratinocytes, HaCaT, with Propionebacterium acnes (P. The expression level was confirmed. Thereafter, it was confirmed whether the expression of TLR-2 was decreased again by the extract of Budleya Davidi.

Specifically, P. acnes (CCARM9009) was purchased from Seoul Women's University Culture Collection of Antibiotic-Resistant Microbe, CCARM, and as a medium, RCM (Reinforced Clostridial Medium) agar (BD, Becton, Dickinson and Company) ) and incubated for 48 to 72 hours at 37 ^o C, anaerobic conditions. Before use in the experiment, it was cultured again with log-phage, and after collecting microorganisms, it was killed at 80 ^o C for 30 minutes before use.

Human-derived keratinocytes (HaCaT) were used in the laboratory, and DMEM (Dulbecco's Modified Eagle's Medium) containing 10% fetal bovine serum (FBS) and 100 U/ml penicillin was used at 37 ^o C. Cells were cultured in a humidified incubator under 5% CO ₂ conditions. In the experiment, cells of 5 × 10 ⁵ cells per well were cultured in a 6-well plate for one day, and the extract was treated in the absence of FBS and then cultured for a specified time.

To confirm the expression of TLR-2 , total RNA was extracted using TRIzol reagent (Invitrogen, USA), and then cDNA was obtained using reverse transcriptase (Qiagen, USA). RP-PCR was performed using the two primers shown in Table 1 below.

division base sequence SEQ ID NO: TLR-2 _forward TGTCTTTGTGACCGCAATGGT One TLR-2 _reverse GTTGGACAGGTCAAGGCTTT 2

As a result, as shown in FIG. 1 , it was confirmed that when the Budleya Davidi extract of the present invention was treated, the expression of TLR-2 promoted by P. acnes was reduced.

Experimental Example 2. Confirmation of cytotoxicity of Budleya Davidi extract

In order to confirm whether the Budleya Davidi extract exhibits cytotoxicity to the human body, the human-derived keratinocytes, HaCaT cells, were each treated with the Budleya Davidi extract according to the concentration, and MTT assay was performed.

Specifically, cells of 10 ³ cells were put into each well of a 96-well tissue culture plate (SPL), and a designated amount of Budleya Davidi extract was added to the culture plate and cultured for 48 hours. Control DMSO was added to each plate so that the maximum concentration did not exceed 0.2%.

After 48 hours, 100ul 5mg/ml MTT (sigma Cat. M2128) was put, and then activity was measured at absorbance at 540nm using an ELISA reader (Epoch, BioTek, USA). All experiments were repeated three or more times.

As shown in FIG. 2 , it was confirmed that the treatment with the Budleya Davidi extract of the present invention did not inhibit the growth of cells and showed no toxicity. That is, it was confirmed that the Budleya Davidi extract had little effect on the growth of human cells and had little toxicity to the living body.

Experimental Example 3. Confirmation of expression regulation of inflammatory cytokines by Budleya Davidi extract

NF-kB is a transcription factor that regulates the expression of inflammatory cytokines, and when infected by P. acnes , which causes inflammation, NF-kB activity increases, thereby regulating the inflammatory response. Therefore, it was confirmed whether the Budleya Davidi extract regulates the expression and activity of NF-kB.

Specifically, 5×10 ⁵ HaCaT cells were put into each well of a 6-well plate, and then the Budleya Davidi extract was treated for 24 hours. After treatment with heat-killed P. acnes 100 MOI for 24 hours, cells were collected and then protein was extracted using RIPA lysis buffer. Then, after quantifying the protein using Bradford assay, 50 μg was separated by SDS-PAGE, and then western blotting was performed.

D14E12 (Cell Signaling) was used for NF-kB, and p-NF-kB was reacted for 12 hours using sc-101752 (santa cruz). It was confirmed using reagents.

As shown in FIG. 3 , it was confirmed that the expression and activity of NF-kB decreased in a concentration-dependent manner as a result of treatment with the Budleya Davidi extract of the present invention.

Experimental Example 4. Confirmation of MAPK pathway expression and activity regulation of Budleya Davidi extract

There are two mechanisms regulating the inflammatory response by microorganisms, including regulation by NF-kB and regulation by MAPK pathways (p38 and JNK). Therefore, it was confirmed whether the inflammation control by the Budleya Davidi extract is regulated by the MAPK pathway.

Specifically, Western blotting using p38 (9212, sc-17852-R) and JNK (9252, sc-6254) corresponding to the MAPK pathway in the same manner as the method for confirming the change in NF-kB activity used in Experimental Example 3 (western blotting) was performed. The p38 (9212) was purchased from Cell Signaling, p38 (sc-17852-R) was purchased from santa cruz, JNK (9252) was purchased from Cell Signaling, and JNK (sc-6254) was purchased from santa cruz.

As shown in FIG. 4 , it was confirmed that the expression and activity of both p38 and JNK related to the MAPK pathway were decreased in a concentration-dependent manner as a result of treatment with the Budleya Davidi extract of the present invention.

Experimental Example 5. Confirmation of regulation of pro-inflammatory cytokines by the extract of Budleya Davidi

TNF-α, IL-1β, IL-6 and IL-8 are known as pro-inflammatory cytokines and are involved in inducing inflammatory responses. Therefore, it was confirmed whether the expression of pro-inflammatory cytokines increased in expression by P. acnes was reduced by the Budleya Davidi extract.

Specifically, it proceeded in the same manner as in Experimental Example 1, and the primers used at this time are shown in Table 2 below.

division base sequence SEQ ID NO: TNF-α _forward ATAGCTCCCAGAAAAGCAAGC 3 TNF-α _reverse CACCCCGAAGTTCAGTAGACA 4 IL-1β _forward TCTTTGAAGAAGAGCCCGTCCTC 5 IL- 1β_reverse GGATCCACACTCTCCAGCTGCA 6 IL-6 _forward GTGTGAAAGCAGCAAAAGAGGC 7 IL-6 _reverse CTGGAGGTACTCTAGGTATAC 8 IL-8 _forward GCAGTTTTTGCCAAGGAGTGCT 9 IL-8 _reverse TTTCTGTGTTGGCGCAGTGTG 10

As a result, as shown in FIG. 5 , when the Budleya Davidi extract was treated, it was confirmed that the expression of all pro-inflammatory cytokines was decreased in a concentration-dependent manner.

That is, the above results confirmed that the Budleya Davidi extract of the present invention can inhibit the inflammatory reaction caused by microorganisms, in particular, the inflammatory response caused by P. acnes by acting complexly on a number of factors related to inflammation. The mechanism of the inflammatory response inhibitory effect is shown in FIG. 6 .

The above description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. For example, each component described as a single type may be implemented in a dispersed form, and likewise components described as distributed may be implemented in a combined form.

The scope of the present invention is indicated by the following claims, and all changes or modifications derived from the meaning and scope of the claims and their equivalents should be construed as being included in the scope of the present invention.

<110> University-Industry Cooperation Group of Kyung Hee University <120> ANTI-INFLAMMATORY COMPOSITION COMPRISING BUDDLEJA DAVIDII EXTRACT <130> 19PP31196 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TLR-2_forward <400> 1 tgtcttgtga ccgcaatggt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TLR-2_reverse <400> 2 gttggacagg tcaaggcttt 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TNF-a_forward <400> 3 atagctccca gaaaagcaag c 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TNF-a_reverse <400> 4 caccccgaag ttcagtagac a 21 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> IL-1beta_forward <400> 5 tctttgaaga agagcccgtc ctc 23 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IL-1beta_reverse <400> 6 ggatccacac tctccagctg ca 22 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IL-6_forward <400> 7 gtgtgaaagc agcaaagagg c 21 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IL-6_reverse <400> 8 ctggaggtac tctaggtata c 21 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IL-8_forward <400> 9 gcagttttgc caaggagtgc t 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IL-8_reverse <400> 10 tttctgtgtt ggcgcagtgt g 21

Claims (8)

A composition for improving inflammation caused by Propionebacterium acnes , comprising the Budleya Davidi extract. delete The composition for improving inflammation according to claim 1, wherein the extract is extracted with water, C ₁ to C ₄ lower alcohol, or a mixed solvent thereof. A pharmaceutical composition for preventing or treating skin inflammatory diseases caused by Propionebacterium acnes , comprising an extract of Budleya Davidi. According to claim 4, wherein the Propionebacterium acnes ( Propionebacterium acnes ) The skin inflammatory disease caused by acne, cellulitis, folliculitis, seborrheic dermatitis, and at least one selected from the group consisting of boils, the pharmaceutical composition. A method of treating an inflammatory skin disease caused by Propionebacterium acnes for non-human subjects, comprising administering the pharmaceutical composition of claim 4 . A cosmetic composition for improving skin inflammation caused by Propionebacterium acnes , comprising an extract of Budleya Davidi. A food composition for improving skin inflammation caused by Propionebacterium acnes , comprising an extract of Budleya Davidi.

Images