KR102350706B1 - Astaxanthin producing method using microalgae cultivation system - Google Patents

Abstract

The present invention relates to a method for producing astaxanthin using a system for culturing microalgae in outdoor culture conditions, optimizing light conditions using a two-stage culture process, adding a nitrogen source during the growth period, and using a chemical inducer during the induction period Therefore, it has the advantage of being able to effectively produce astaxanthin even under sunlight conditions.

Description

Astaxanthin producing method using microalgae cultivation system

The present invention relates to a method for producing astaxanthin using a system for culturing microalgae in outdoor culture conditions.

The combustion of fossil fuels such as coal, oil and natural gas for energy production is a _{major cause of increasing the concentration of CO 2 in} the atmosphere, which is a cause of global warming. In order to solve this CO ₂ emission problem, a lot of research on the biological conversion of _{CO 2 using microalgae is being conducted.} Among several species of microalgae, Haematococcus pluvialis (Haematococcus pluvialis) is a freshwater species, and belongs to Chlorophyceae species, Volvocales genus, and Haematococcacae family. Previous studies have shown that Haematococcus accumulates large amounts of astaxanthin in environments unsuitable for survival, such as nutrient depletion (nitrogen, phosphorus), high luminosity, and salinity stress. The maximum astaxanthin accumulation rate reaches 5-6%, and it is the most abundant source of astaxanthin on the planet.

Haematococcus has a morphologically distinct life cycle: a green flagellate cell state (growth phase) and a red cell in the astaxanthin-induced phase of a non-motivating cyst (cyst) state. High light conditions along with nitrogen deficiency are the most effective methods for astaxanthin induction. Therefore, a two-stage culture method was devised to increase astaxanthin productivity: the growth phase proceeds under favorable conditions for growth, enabling high-concentration cell culture, and in the induction phase, various stress conditions are given to accumulate intracellular astaxanthin in large quantities. do. Recently, the two-stage culture system has been widely used as an efficient system for astaxanthin production in the Haematococcus industry and researchers. In general, it is difficult to culture the cells at a high concentration during the growth phase. Therefore, it is expected that it is necessary to develop a process for culturing cells in the growth phase in large quantities and maximally producing astaxanthin.

However, since hematococcus does not have a sugar transporter, it cannot grow well under heterotrophic conditions under sugar addition conditions. Therefore, studies have been conducted to allow photoautotrophic microalgae without a transporter that enables sugar intake to grow in heterotrophic conditions through gene introduction. Specifically , the microalgae Volvox carteri and the diatom Phaeodactylum tricornutum in which the Monosaccharide/H ⁺ symporter gene was introduced from the microalga Parachlorella kessleri (that is, Chlorella kessleri ) have a hexose uptake protein HUP1 producing gene, It can grow by consuming glucose. Heterotrophic conditions have the advantage of enabling high-concentration cell culture in a sterile environment. If such a gene is introduced into Hematococcus, Hemacoccus fluvialis having the HUP1 gene can produce astaxanthin by consuming 2-deoxy glucose, a toxic glucose, under heterotrophic conditions. The maximum biomass yield was found to be 0.2 mg/L based on dry cell weight. However, the metabolically engineered strain has a low productivity, so it is difficult to apply it to a mass culture field.

Korean Patent Publication No. 10-2013-0038605

An object of the present invention relates to a method for producing astaxanthin using wild-type microalgae applicable in outdoor culture conditions, and a first reactor ( To provide a method for producing astaxanthin by increasing the production of biomass in the green stage and increasing the astaxanthin accumulation rate in the biomass by using a chemical inducer in the second reactor (red stage).

In order to achieve the above object,

The present invention provides a growth process for growing biomass by supplying a growth phase medium, microalgae, carbon dioxide and nitrogen source to the inside of the first reactor; and

It provides an astaxanthin production method comprising a production process for producing astaxanthin in the presence of sunlight by supplying an induction phase medium and a carbon source to a culture medium containing the biomass supplied from the first reactor.

1 is a schematic diagram showing a method for producing astaxanthin using the microalgae culture system according to the present invention. Referring to Figure 1, the first reactor is a growth process of growing biomass by irradiating light of low intensity through a screen while supplying the growth phase medium, microalgae, carbon dioxide and nitrogen source, and the second reactor is from the first reactor. Astaxanthin can be produced in the presence of sunlight while supplying a carbon source, which is an induction phase medium and a chemical inducer, at a certain concentration to the transferred biomass culture medium. In addition, when the nitrogen concentration of the culture solution in the first reactor is depleted and becomes less than the preset concentration, a part of the culture solution is transferred to the second reactor, and when the culture solution is completed from the first reactor to the second reactor, the growth phase medium is added to the first reactor Microalgae can be continuously grown by re-supplying as much as the amount of culture medium. In this case, the first reactor and the second reactor may use a column-type reactor.

The microalgae are not particularly limited as long as they are microalgae strains that produce carotenoids such as astaxanthin or beta-carotene as secondary metabolites. Specifically, the microalgae may be Haematococcus, Chlorella or Duniriella.

As an example, the astaxanthin production method according to the present invention is not particularly limited as long as the nitrogen source in the first reactor is an inorganic nitrate or an inorganic ammonium salt. Specifically, the nitrogen source in the first reactor is potassium nitrate (KNO ₃ ), calcium nitrate (Ca(NO ₃ ) ₂ ), sodium nitrate (NaNO ₃ ), ammonium chloride (NH ₄ Cl) or ammonium sulfate ((NH ₄ ) ₂ SO ₄ ) can be used to perform the growth process, and a nitrogen source can be supplied when the cell growth of microalgae reaches the logarithmic phase. Specifically, the growth process may supply the nitrogen source at a concentration of 1 mM to 10 mM, more specifically, the nitrogen source may be supplied at a concentration of 1 mM to 8 mM, 2 mM to 8 mM, 3 mM to 8 mM, 3 mM to 6 mM or It can be supplied at a concentration of 2 mM to 4 mM. For example, the nitrogen source may be additionally supplied by dividing it into two or more times. By supplying the nitrogen source as described above, it is possible to increase the growth of biomass even under low light conditions.

In addition, the growth process may be performed under light conditions of 10 to 80 μE/m ^{2 /s.} Specifically, the growth process is 20 to 80 μE/m ² /s, 20 to 70 μE/m ² /s, 20 to 50 μE/m ² /s, 30 to 80 μE/m ² /s, 30 to 60 μE /m ² /s or 30 to 50 μE/m ² /s light conditions.

In the astaxanthin production method according to the present invention, when the nitrogen concentration of the culture medium in the first reactor is depleted and becomes less than a preset concentration, a part of the culture solution may be transferred to the second reactor. Specifically, by measuring the nitrogen concentration of the culture medium in the first reactor in real time, before reaching the nitrogen concentration “0” where biomass growth is terminated, a part of the culture medium is transferred to the second reactor by controlling the culture medium transfer pump. can be transported

Additionally, when the transfer of the culture medium from the first reactor to the second reactor is completed, the growth phase medium may be re-supplied as much as the amount of the culture solution to the first reactor to continuously grow microalgae.

As another example, in the astaxanthin production method according to the present invention, one or more carbon sources selected from the group consisting of ethanol and acetate may be supplied to the second reactor to perform the production process. Specifically, the carbon source in the second reactor may be ethanol or acetate, and in high light conditions (200 μE/m ² /s or more), acetate is used as the carbon source, and in low light conditions (200 μE/m ² /s or less) Ethanol can be used as a carbon source. While the carbon source as described above is used as a carbon source for astaxanthin production, it can serve to promote astaxanthin production by increasing oxidative stress in biomass cells as a chemical inducer. In particular, when ethanol is used as a carbon source, excellent biomass (astaxanthin) production efficiency can be exhibited even under low luminous conditions.

The production process may be performed by supplying the carbon source to the second reactor at a concentration of 0.5 mM to 20 mM. Specifically, the production process may supply the carbon source at a concentration of 0.5 mM to 10 mM, 0.5 mM to 5 mM, 1 mM to 20 mM, 1 mM to 10 mM, 0.8 mM to 7 mM, or 1 mM to 5 mM. By supplying the carbon source as described above, it is possible to improve the production of astaxanthin even in low light conditions.

In addition, the production process can be performed under light conditions of 100 to 200 μE/m ^{2 /s.} Specifically, the growth process is 100 to 180 μE/m ² /s, 100 to 150 μE/m ² /s, 130 to 200 μE/m ² /s, 130 to 180 μE/m ² /s, 130 to 160 μE /m ² /s or 130 to 150 μE/m ² /s light conditions.

The first reactor and the second reactor may independently be any one of a stirred reactor, a plate reactor, a tubular reactor, a column reactor, and a polymer film reactor. Specifically, the first reactor and the second reactor may be a stirred reactor, a plate-type reactor, a tubular reactor, a column-type reactor, or a polymer film-type reactor having the same capacity, and more specifically, may be a column-type reactor.

According to the present invention, by optimizing light conditions using a two-stage culture process, adding a nitrogen source during the growth period, and supplying a carbon source (chemical inducer) during the induction period, the culture period is shortened even in sunlight conditions and wild-type strains are used. It has the advantage of effectively producing astaxanthin.

1 is a schematic diagram showing a method for producing astaxanthin using the microalgae culture system according to the present invention.
Figure 2 is a biomass concentration (A), residual nitrogen concentration (B), residual phosphorus concentration (C), intracellular protein concentration (D) and carotenoid / chlorophyll according to the nitrogen concentration in the microalgal culture system according to the present invention It is a graph showing the ratio (E).
3 is a graph showing the biomass concentration and astaxanthin concentration according to the type and concentration of the carbon source and the light intensity condition in the microalgal culture system according to the present invention: (A) is a medium light intensity condition of ^{130-150 μE/m 2 /s} , and (B) is a low luminous intensity condition of ^{30-50 μE/m 2 /s.}
4 is a cell growth curve (biomass concentration (a-1, b-1), astaxanthin concentration (a-2, b-2), residual carbon concentration (a) for each type of carbon source in the microalgal culture system according to the present invention; -3,b-3) is a graph showing: (A) is ^{a medium luminous intensity condition of 130 to 150 μE/m 2} /s, and (B) is a low luminous intensity condition of ^{30 to 50 μE/m 2 /s.}
5 is a total fatty acid methyl ester (Total FAME) amount (A) according to each light intensity and carbon source type in the microalgae culture system according to the present invention, FAME components at ^{medium light intensity (130 ~ 150 μE / m 2 /s)} It is a graph showing the amount of FAME component (C) at low light intensity (30-50 μE/m ^{2 /s) (B).}
6 is a graph showing the concentration of biomass (A) and the concentration of dichlorofluoresin (B) according to time for each ethanol concentration in the microalgae culture system according to the present invention. At this time, the light intensity condition is 130-150 μE/m ² /s.
7 is a graph showing the concentration of dichlorofluorescein (A) and the concentration of malondialdehyde (B) under autotrophic conditions and ethanol 1mM conditions, respectively, by light intensity in the microalgal culture system according to the present invention (B).
Figure 8 is a carbon source (acetate, ethanol, glucose) in the microalgal culture system according to the present invention, along with 1 mM, sesamol (sesamol) or DCMU (3- (3,4-dichlorophenyl) -1,1-dimethylurea) injection The concentration of biomass (a-1,b-1), the concentration of dichlorofluorescein (a-2,b-2) and the concentration of malondialdehyde (a-3,b-3) over time in one case The graph is shown: (A) is ^{a medium luminous intensity condition of 130 to 150 μE/m 2} /s, and (B) is a low luminous intensity condition of ^{30 to 50 μE/m 2 /s.}
9 is a graph of the transcription amount of genes related to astaxanthin biosynthesis according to time according to the presence or absence of ethanol addition in the microalgal culture system according to the present invention, (A) is ipi-1, (B) is ipi-2, (C) is psy, (D) is pds, (E) crtO, (F) is a graph regarding the gene of crtR-b. At this time, the light intensity condition is 130-150 μE/m ² /s.

Hereinafter, the configuration and effects of the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example

The strain used in the present invention was purchased from the National Institute for Environmental Studies, Tsukuba, Japan as Haematococcus pluvialis NIES-144. The media used were modified NIES-C and NIES-N media, and the components thereof are shown in Table 1 below. In addition, the outdoor culture conditions of the H. pluvialis mass culture process under autotrophic conditions are shown below.

Photosynthetic bioreactor (height: 40cm, width:45cm, side:5cm, capacity:6L, “V”) The first reactor and the second reactor were manufactured by stirring using air bubbles in the form of a bubble column with a volume of 100L for the maximum internal spacing of the ruler groove: 15cm*3.

The prepared first reactor includes NIES-C medium (autotrophic medium, purpose: growth), and the second reactor includes NIES-N medium (autotrophic medium, purpose: induction of astaxanthin accumulation through nutrient deprivation stress) included.

- Gas supply: For the outdoor culture process, flue gas from the Pangyo branch of the Korea District Heating Corporation was used, and the CO ₂ concentration was observed to be about 3 to 6%.

- Injection flow rate: 0.1 vvm (vessel volume per minute)

- Incubation temperature: 23±3 ^o C

- Photoperiod: (roughly) light-dark period 12:12

- For buffer conditions, a buffer solution was prepared by aeration of the flue gas using 10 mM KOH solution for one day.

NIES-C NIES-N ingredient Content (/L) ingredient Content (/L) Ca(NO3) ₂ 0.15 g CaCl ₂ ·2H ₂ O 0.13 g KNO ₃ 2 mM
2mM + 2mM
4 mM
4mM + 4mM
8 mM KCl 0.07 g buffer condition KOH 10 mM
more than 12 hours flue gas aeration
+phosphate buffer buffer condition KOH 10 mM
more than 12 hours flue gas aeration
+phosphate buffer MgSO ₄ 7H ₂ O 0.04 g MgSO ₄ 7H ₂ O 0.04 g Thiamine 0.01 mg Thiamine 0.01 mg Biotin 0.10 μg Biotin 0.10 μg Vitamin B12 0.01 μg Vitamin B12 0.01 μg PIV metal solution
(per liter)
1 g Na _{2 EDTA}
FeCl ₃ 6H ₂ O 0.196 g
MnCl ₂ .4H ₂ O 0.036 g
ZnSO ₄ 7H ₂ O 0.022 g
CoCl ₂ 6H ₂ O 4 mg
Na ₂ MoO ₄ ·2H ₂ O 2.5 mg 3 ml PIV metal solution
(per liter)
1 g Na _{2 EDTA}
FeCl ₃ 6H ₂ O 0.196 g
MnCl ₂ .4H ₂ O 0.036 g
ZnSO ₄ 7H ₂ O 0.022 g
CoCl ₂ 6H ₂ O 4 mg
Na ₂ MoO ₄ ·2H ₂ O 2.5 mg 3 ml

Experimental Example 1 - Development of fed-batch for high-concentration cell biomass growth in outdoor culture

In order to evaluate the effect on the nitrogen source concentration and the type of carbon source in the microalgal culture system according to the present invention, nitrogen source conditions were created as follows. A modified NIES-C medium was used as the medium, and the nutrient conditions except for the nitrogen source were the same as those of the NIES-C medium, and the results of culturing under these conditions are shown in FIG. 2 .

- Initial nitrogen source concentration: 1 mM (Control, initial feed), 2 mM (initial feed), 2 mM (initial feed) + 2 mM (additional feed), 4 mM (initial feed), 4 mM (initial feed) +4 mM (additional feed), 8 mM (initial feed)

- Additional supply of nitrogen source substrate in Green stage: 9 days after cell inoculation

- Nitrogen source substrate concentration: 2 mM, 4 mM, respectively

In addition, before entering the induction phase, experiments were performed on the astaxanthin accumulation efficiency and accumulation rate from the green resting cell using various carbon sources, and the results are shown in FIG. 3 .

The initial culture condition was 1.0 g/L, a 300 ml flask was used, and the culture volume was 100 ml. For the light conditions, high light conditions (130~150 μE/m ² /s) and low light conditions (30~50 μE/m ² /s) were used, respectively, and carbon source types were glucose, acetate, ethanol, and NIES- as a control. N medium (autotrophic conditions) was used. Carbon source concentrations were injected at 1 mM, 5 mM, 10 mM, and 20 mM, respectively.

2 is a cell growth curve during the growth phase in the process of culturing microalgae with a microalgae culture system using power plant combustion gas and sunlight. Referring to FIG. 2 , when cell growth reached an exponential phase, nitrogen sources, which are essential limiting substrates for cell growth, were respectively 1 mM (control) and 2 mM+2 mM. Biomass concentration (A), residual nitrogen concentration (B), residual phosphorus concentration (C), intracellular protein concentration (D) and carotenoids according to each nitrogen concentration while supplying 4 mM, 4 mM+4 mM, and 8 mM The ratio (E) of /chlorophyll was determined. Specifically, as the culture proceeds in the 1 mM nitrogen source condition, the carotenoid/chlorophyll ratio rises to a maximum of 8.6, which means that the cells have changed from the flagellate form to the cyst form. At this time, the concentration of the nitrogen source in the cell drops to almost zero, and the cells are transferred to the induction phase line based on the incubation period at this time. As can be seen in Figure 2A, the concentration of cell biomass is the highest in the conditions of 2 mM + 2 mM and 4 mM. However, if the nitrogen source concentration in the medium is excessive at the beginning, cell growth is inhibited. It can be seen that it is unfavorable to astaxanthin accumulation.

3 is a graph for biomass productivity and astaxanthin productivity according to the type and concentration of the carbon source for each luminous intensity condition. Referring to FIG. 3, acetate is an excellent carbon source under medium light intensity conditions (130-150 μE/m ² /s, FIG. 3A), and 0.132 g/L/day and 0.126 g/L/day at 10 mM and 20 mM conditions, respectively. day, the biomass production was also high. However, in the low light conditions (130-150 μE/m ² /s, FIG. 3B), the biomass production was sharply lowered in the acetate condition. Through this, it was confirmed that securing the amount of light is essential in order to consume acetate as a carbon source. Ethanol was effectively utilized as a carbon source in both medium and low light conditions. In particular, it effectively induced the accumulation of astaxanthin at a low concentration (1 mM), and on the contrary, the productivity was inhibited due to excessive production of reactive oxygen species at a high concentration.

Experimental Example 2 - Effect of a carbon source in outdoor culture

In order to evaluate the effect on the carbon source effect in the microalgal culture system according to the present invention, an experiment for optimizing the carbon source conditions was conducted under the following conditions.

- Flask experiment for optimizing carbon source conditions

1) Culture volume: using 300 ml flask, 100 ml each

2) Medium condition: NIES-N medium

3) Carbon source supply conditions: 1 mM, 5 mM, 10 mM, and 20 mM each of glucose, sodium acetate, and ethanol are injected into the bicarbonate buffer.

4) Light conditions: 130~150 μE/m ² /s (medium light, outdoor culture lacking light conditions), 30~50 μE/m ² /s (low light)

In outdoor culture, carbon sources in the medium cause contamination due to inflow of external microorganisms, so 1 mM of each carbon source was applied to culture. First, for the composition of the medium in the reactor, a buffer solution is prepared by aeration of the exhaust gas using a 10 mM KOH solution for about one day. Then, after inoculating the carbon source and NIES-N medium components, the cells were transferred as shown in FIG. 1 to proceed with the induction process.

According to FIG. 4 below, biomass growth, astaxanthin production, and residual carbon source concentration were shown for the experimental group in which the carbon source concentration was adjusted to medium and low light intensity, respectively, in outdoor culture. Referring to Figure 4, glucose is not a favorable carbon source for astaxanthin production and biomass growth, this is because glucose is not used as a carbon source in the microalgae Haematococcus fluvialis. Acetate and ethanol are used as carbon sources, and although the use of acetate depends on the light intensity, it has been shown that ethanol is consumed as an effective carbon source even at low light intensity. In general, when the intracellular C/N ratio increases, the photosynthetic electron transport system is inhibited, organelles are damaged, reactive oxygen species are generated, intracellular NADP ⁺ is reduced to NADPH, and intracellular oxidative stress is reduced. The excess reduced NADPH in the cell is consumed for astaxanthin and FAME synthesis. Ethanol's intracellular reactive oxygen species generation effect not only triggers the astaxanthin biosynthesis mechanism in the cell, but also excessively produces NADPH, and this effect occurs regardless of light conditions. Not only does it show the effect of tin synthesis, but it is also used as a carbon source during the culture period.

These results are also related to the fatty acid production of Figure 5 below. FAME (fatty acid, fatty ethly methyl ester) is associated with astaxanthin accumulation. Acetate and ethanol conditions showed the highest accumulation of FAME. In particular, when ethanol was supplied, the amount of FAME accumulation was excellent even under low light conditions. Fatty acids in hematococcus are mainly C16 and C18, and although it was advantageous for lipid accumulation as the amount of light increased (up to 22%), even under the condition of generating reactive oxygen species using ethanol, the cells consume NADPH and synthesize fatty acids, so the low light The lipid production was also higher than that of the acetate condition.

Experimental Example 3 - Optimization of ethanol conditions through the investigation of astaxanthin biosynthesis mechanism

In order to know about the astaxanthin biosynthesis mechanism in the microalgal culture system according to the present invention, the experiment was conducted under the following conditions.

- Red stage culture using optimized carbon source conditions

1) Conditions for composition of bicarbonate buffer in red stage: Aeration for more than 12 hours with 0.1 vvm of flue gas in 10 mM KOH solution

2) Carbon source conditions: 1 mM each of glucose, sodium acetate, and ethanol were injected into the bicarbonate buffer.

3) Light conditions: 130~150 μE/m ² /s (medium light), 30~50 μE/m ² /s (low light)

- rtPCR (real-time PCR) gene primer conditions are shown in [Table 2]

Gene Primer sequence (5'-3') 18S Forward TGCCTAGTAAGCGCGAGTCA Reverse CCCACCGCTAAAGTCAATCC ipi-1 Forward GTGGACGAAGTCAGGTAC Reverse CGTGTTTGTCAGTGTTTAGG ipi-2 Forward CACTGACAAAACACGAGGAT Reverse AATATGATGCACCATTGACTC psy Forward ATGCCATTGAGAAGAATGACTA Reverse TGACCACTTGCTGTTCTG pds Forward GCCACCTCACAAACTCAT Reverse ACCTCCTACCTGTCTTGG crtO Forward GGAGAAGGAGAAGGAGGT Reverse GAAGGTGGTGGCTTGTAG crtR-b Forward TGAAGCCAACGACTTGTT Reverse ATGCCGTATAGCGTGATG

As can be seen in FIG. 6 , the generation of reactive oxygen species due to ethanol induces astaxanthin biosynthesis at a certain concentration, but an excessive amount of reactive oxygen species may rather damage cells. The amount of reactive oxygen species inside the cell can be quantified through DCF measurement. When biomass production and reactive oxygen species concentration were measured in ethanol 1 mM, 5 mM, 10 mM, and 20 mM conditions, respectively, as the ethanol concentration increased, It can be seen that the biomass concentration decreases. It can be seen that the concentration of reactive oxygen species appears high during the initial 0 to 2 days of induction, and then gradually decreases in the cell.

Accordingly, ethanol concentration optimization conditions that can efficiently induce astaxanthin accumulation while minimizing cell damage were derived, and autotrophic conditions and 1 mM ethanol addition conditions were compared. As shown in FIG. 7 , the concentration of reactive oxygen species and the concentration of lipid peroxide were measured, respectively, and the concentration of MDA (malondialdehyde), a polyunsaturated fatty acid oxide caused by reactive oxygen species and reactive oxygen species, was increased in the ethanol-added condition compared to the autotrophic condition. It was confirmed that the increase was confirmed, and the concentration was higher in the medium light condition. Through this, it was possible to derive the fact that the degree of generation of reactive oxygen species differs depending on the light conditions, and that light is also involved in the oxidative stress of cells. Low light conditions are disadvantageous for astaxanthin accumulation because oxidative stress applied to cells is relatively low, but the use of chemical inducers such as ethanol can increase the degree of oxidative stress.

Referring to FIG. 8 , when sesamol, which inhibits oxidative stress, and DCMU, which inhibits photosystem II, are used, intracellular oxidative stress is rapidly reduced. Sesamol is an antioxidant that suppresses cellular oxidative stress and reduces NADPH supply by inhibiting the malic cycle of cells. As a result, the amount of NADPH that can be consumed for astaxanthin and lipid synthesis is reduced. DCMU inhibits photosystem II activity, resulting in the inability to grow cells regardless of light conditions. Through this, it can be deduced that the involvement of photosystem II during the induction phase of hematococcus cells is essential, and that irradiation with a certain amount of light is necessary for astaxanthin production.

9 shows the observed activity of genes involved in the biosynthesis of astaxanthin in Haematococcus under the ethanol addition condition. Compared with autotrophic conditions, it was confirmed through rt-PCR data that the level of transcription of genes involved in astaxanthin biosynthesis rapidly increased within the first 12 hours after entering the induction phase. Ipi, a gene involved in producing an enzyme (IPP isomerase) that provides a carbon source substrate for astaxanthin biosynthesis, and an enzyme involved in transforming carotenoids into astaxanthin (CRTR-B (β-carotene hydroxylase): β-carotene The activity of crtb-O, a gene involved in the production of β-carotene ketolases/oxygenases that converts to astaxanthin), increased 9-fold and 17.5-fold, respectively. Through this, ethanol generates reactive oxygen species and helps to increase astaxanthin accumulation by increasing the activity of genes involved in astaxanthin biosynthesis. can increase production.

Claims (9)

a growth process of growing biomass by supplying a growth phase medium, microalgae, carbon dioxide and nitrogen sources to the inside of the first reactor; and
Astaxanthin production method comprising a production process for producing astaxanthin in the presence of sunlight by supplying an induction phase medium and a carbon source to a culture medium containing the biomass supplied from the first reactor:
In the growth process, the nitrogen source is supplied in 2 mM to 4 mM, divided into two or more times,
light conditions are 30 μE/m ² /s to 50 μE/m ² /s,
In the production process, ethanol is supplied at 0.5 mM to 5 mM as a carbon source,
Light conditions range from 130 μE/m ² /s to 150 μE/m ² /s. The method of claim 1,
Astaxanthin production method, characterized in that when the nitrogen concentration of the culture solution in the first reactor is depleted and becomes less than the preset concentration, a part of the culture solution is transferred to the second reactor. The method of claim 1,
When the transfer of the culture medium from the first reactor to the second reactor is completed, astaxanthin production method, characterized in that the microalgae are continuously grown by re-supplying the growth phase medium to the first reactor as much as the amount of the culture solution. The method of claim 1,
The first reactor and the second reactor are independently astaxanthin production method, characterized in that any one of a stirred reactor, a plate-type reactor, a tubular reactor, a column-type reactor, and a polymer film-type reactor. delete delete delete delete delete

Images