KR20210032671A - Astaxanthin producing method using microalgae cultivation system - Google Patents

Abstract

The present invention relates to a method for producing astaxanthin using a microalgae cultivation system in outdoor cultivation conditions. The present invention has the advantage of optimizing light conditions using a two-stage cultivation process, adding a nitrogen source during the growth period, and using a chemical inducer during the induction period, thereby effectively producing astaxanthin even under sunlight conditions.

Description

Astaxanthin producing method using microalgae cultivation system}

The present invention relates to a method for producing astaxanthin using a system for culturing microalgae under outdoor culture conditions.

The burning of fossil fuels such as coal, petroleum and natural gas for energy production is the main cause of increasing the concentration of CO ₂ in the atmosphere, which are the cause of global warming. In order to solve this CO ₂ emission problem, many studies on the biological conversion of _{CO 2 using microalgae are being conducted.} Among several species of microalgae, Haematococcus pluvialis (Hematococcus fluvialis ) is a freshwater species and belongs to the Chlorophyceae species, the Volvocales genus, and the Haematococcacae family. Previous studies have shown that hematococcus accumulates large amounts of astaxanthin in environments unsuitable for survival, such as nutrient depletion (nitrogen, phosphorus), high light intensity, and salinity stress. The maximum astaxanthin accumulation rate reaches 5-6%, making it the most abundant source of astaxanthin on the planet.

Hematococcus has a clearly distinct life cycle: green flagellate cells (growth phase) and red astaxanthin-induced cells in a non-motile cyst (cyst) state. Along with nitrogen deficiency, high light conditions are the most effective way to induce astaxanthin. Therefore, in order to increase the productivity of astaxanthin, a two-stage culture method was invented: the growth period proceeds under conditions favorable to growth, enabling high-concentration cell culture, and various stress conditions during the induction period to accumulate astaxanthin in a large amount in cells. do. Recently, the two-stage culture system has been widely used as an efficient system for the production of astaxanthin in the hematococcus industry and researchers. In general, it is difficult to cultivate cells at high concentration during the growing season. Therefore, it is expected that it is necessary to develop a process for culturing growth-phase cells in large quantities and maximizing astaxanthin production.

However, since hematococcus does not have a sugar transporter, it cannot grow well in a heterotrophic condition under a sugar addition condition. Therefore, studies have been conducted to grow photoautotrophic microalgae without a transporter that enables sugar intake to grow in heterotrophic conditions through gene introduction. Specifically , the microalgae Volvox carteri and the diatom Phaeodactylum tricornutum, which introduced the Monosaccharide/H ⁺ symporter gene from the microalgae Parachlorella kessleri (i.e., Chlorella kessleri ), have the hexose uptake protein HUP1 production gene, so they It can grow by consuming glucose. Heterotrophic conditions have the advantage of enabling high concentration cell culture in a sterile environment. If this gene is introduced into hematococcus, hematococcus fluvialis with the HUP1 gene can produce astaxanthin by consuming 2-deoxy glucose, a toxic glucose, under heterotrophic conditions. The maximum biomass production was found to be 0.2 mg/L based on dry cell weight. However, this metabolic engineered strain has a problem that is difficult to apply to mass cultivation sites due to low productivity.

Korean Patent Laid-Open Publication No. 10-2013-0038605

An object of the present invention relates to a method for producing astaxanthin using wild-type microalgae applicable in outdoor culture conditions, and a first reactor ( green stage), and by using a chemical inducing agent in the second reactor (red stage) to increase the rate of astaxanthin accumulation in the biomass, thereby providing a method of producing astaxanthin.

In order to achieve the above purpose,

The present invention is a growth process of growing biomass by supplying a growth medium, microalgae, carbon dioxide and nitrogen sources to the inside of the first reactor; And

It provides a method for producing astaxanthin comprising a production process of producing astaxanthin in the presence of sunlight by supplying an induction phase medium and a carbon source to a culture medium containing biomass supplied from the first reactor.

1 is a schematic diagram showing a method of producing astaxanthin using a microalgal culture system according to the present invention. Referring to FIG. 1, in the first reactor, a growth process of growing biomass by irradiating low-intensity light through a shielding film while supplying a growing medium, microalgae, carbon dioxide and nitrogen source is in progress, and the second reactor is from the first reactor. Astaxanthin can be produced in the presence of sunlight while supplying a carbon source, which is an induction medium and a chemical inducing agent, to the transferred biomass culture medium at a predetermined concentration. In addition, when the nitrogen concentration of the culture solution in the first reactor is depleted and falls below a preset concentration, a part of the culture solution is transferred to the second reactor, and when the culture solution is completed from the first reactor to the second reactor, the growth medium is added to the first reactor. Microalgae can be continuously grown by resupplying as much as the culture medium discharged. At this time, the first reactor and the second reactor may be a column type reactor.

The microalgae is not particularly limited as long as it is a microalgal strain that produces carotenoids such as astaxanthin or beta-carotene as secondary metabolites. Specifically, the microalgae may be hematococcus, chlorella, or duniriella.

As an example, the method for producing astaxanthin according to the present invention is not particularly limited as long as the nitrogen source in the first reactor is an inorganic nitrate or an inorganic ammonium salt. Specifically, the nitrogen source in the first reactor is potassium nitrate (KNO ₃ ), calcium nitrate (Ca(NO ₃ ) ₂ ), sodium nitrate (NaNO ₃ ), ammonium chloride (NH ₄ Cl) or ammonium sulfate ((NH ₄ ) ₂ SO ₄ ) can be used to perform the growth process, and when the cell growth of microalgae reaches the logarithmic period, a nitrogen source can be supplied. Specifically, the growth process may supply a nitrogen source at a concentration of 1 mM to 10 mM, and more specifically, a nitrogen source of 1 mM to 8 mM, 2 mM to 8 mM, 3 mM to 8 mM, 3 mM to 6 mM, or It can be supplied at a concentration of 2 mM to 4 mM. For example, the nitrogen source can be additionally supplied by dividing it into two or more times. By supplying the nitrogen source as described above, it is possible to increase the growth of biomass even in low light conditions.

In addition, the growth process can be carried out under light conditions of 10 to 80 μE/m ^{2 /s.} Specifically, the growth process is 20 to 80 μE/m ² /s, 20 to 70 μE/m ² /s, 20 to 50 μE/m ² /s, 30 to 80 μE/m ² /s, 30 to 60 μE /m ² /s or 30 to 50 μE/m ² /s in light conditions.

In the method for producing astaxanthin according to the present invention, when the concentration of nitrogen in the culture medium of the first reactor is depleted and the concentration is less than a preset concentration, a part of the culture medium may be transferred to the second reactor. Specifically, by measuring the nitrogen concentration of the culture medium in the first reactor in real time, controlling the culture medium transfer pump before reaching the nitrogen concentration “0” at which biomass growth ends, and transferring a part of the culture medium to the second reactor through the culture medium transfer line. Can be transported.

Additionally, when the transfer of the culture medium from the first reactor to the second reactor is completed, the growth medium is resupplied to the first reactor by the amount of the culture medium discharged, so that microalgae can be continuously grown.

As another example, the astaxanthin production method according to the present invention may perform the production process by supplying at least one carbon source selected from the group consisting of ethanol and acetate to the second reactor. Specifically, the carbon source in the second reactor may be ethanol or acetate, and in high light conditions (200 μE/m ² /s or more) acetate is used as the carbon source, and in low light conditions (200 μE/m ² /s or less) Ethanol can be used as a carbon source. The above-described carbon source is used as a carbon source for the production of astaxanthin, and may play a role of promoting the production of astaxanthin by increasing oxidative stress in biomass cells as a chemical inducing agent. In particular, when ethanol is used as a carbon source, it can exhibit excellent biomass (astaxanthin) production efficiency even under low light intensity conditions.

The production process may be performed by supplying a carbon source to the second reactor at a concentration of 0.5 mM to 20 mM. Specifically, the production process may supply a carbon source at a concentration of 0.5 mM to 10 mM, 0.5 mM to 5 mM, 1 mM to 20 mM, 1 mM to 10 mM, 0.8 mM to 7 mM, or 1 mM to 5 mM. By supplying the above carbon source, it is possible to improve the production of astaxanthin even in low light conditions.

In addition, the production process can be performed under light conditions of 100 to 200 μE/m ^{2 /s.} Specifically, the growth process is 100 to 180 μE/m ² /s, 100 to 150 μE/m ² /s, 130 to 200 μE/m ² /s, 130 to 180 μE/m ² /s, 130 to 160 μE /m ² /s or 130 to 150 μE/m ² /s in light conditions.

The first reactor and the second reactor may independently be any one of a stirred reactor, a plate reactor, a tubular reactor, a column reactor, and a polymer film reactor. Specifically, the first reactor and the second reactor may be a stirred reactor having the same capacity, a plate reactor, a tubular reactor, a column reactor or a polymer film reactor, and more specifically, a column reactor.

According to the present invention, by optimizing the light conditions using a two-stage culture process, adding a nitrogen source during the growth period, and supplying a carbon source (chemical inducing agent) during the induction period, the cultivation period is shortened even under sunlight conditions, and the wild-type strain is used. It has the advantage of being able to produce astaxanthin effectively.

1 is a schematic diagram showing a method of producing astaxanthin using a microalgal culture system according to the present invention.
2 is a concentration of biomass according to nitrogen concentration (A), residual nitrogen concentration (B), residual phosphorus concentration (C), intracellular protein concentration (D), and carotenoid/chlorophyll in the microalgal culture system according to the present invention. It is a graph showing the ratio (E).
3 is a graph showing the biomass concentration and astaxanthin concentration according to the type and concentration of carbon source and the light intensity condition in the microalgal culture system according to the present invention: (A) is an intermediate light intensity condition ^{of 130 to 150 μE/m 2 /s} And (B) is a low light intensity condition of 30 to 50 μE/m ^{2 /s.}
4 is a cell growth curve for each type of carbon source (biomass concentration (a-1,b-1), astaxanthin concentration (a-2,b-2), residual carbon concentration (a) in the microalgal culture system according to the present invention) It is a graph showing -3,b-3): (A) is ^{an intermediate light intensity condition of 130 to 150 μE/m 2} /s, and (B) is a low light intensity condition of ^{30 to 50 μE/m 2 /s.}
5 is a FAME component in the amount of total fatty acid methyl ester (Total FAME) according to the type of carbon source (A), and the medium light intensity (130-150 μE/m ² /s) according to the intensity of the microalgae in the microalgal culture system according to the present invention. It is a graph showing the amount of (B) and the amount of the FAME component (C) at ^{low luminosity (30-50 μE/m 2 /s).}
6 is a graph showing the concentration of biomass (A) and the concentration of dichlorofluoresin (B) according to time for each ethanol concentration in the microalgal culture system according to the present invention. At this time, the luminous intensity condition is 130 to 150 μE/m ² /s.
7 is a graph showing the concentration of dichlorofluorescein (A) and the concentration of malondialdehyde (B) under autotrophic conditions and ethanol 1mM conditions, respectively, by light intensity in the microalgal culture system according to the present invention.
Figure 8 is a carbon source (acetate, ethanol, glucose) 1mM in the microalgae culture system according to the present invention, sesamol (sesamol) or DCMU (3- (3,4-dichlorophenyl) -1,1-dimethylurea) injected In one case, the concentration of biomass (a-1,b-1), dichlorofluorescein concentration (a-2,b-2) and malondialdehyde concentration (a-3,b-3) over time It is a graph shown: (A) is ^{a medium luminous intensity condition of 130 to 150 μE/m 2} /s, and (B) is a low luminous intensity condition of ^{30 to 50 μE/m 2 /s.}
9 is a graph of the amount of transcription of genes related to astaxanthin biosynthesis according to time with or without ethanol addition in the microalgal culture system according to the present invention, (A) ipi-1, (B) ipi-2, (C) is psy, (D) is pds, (E) is crtO, (F) is a graph of the gene of crtR-b. At this time, the light intensity condition is 130 to 150 μE/m ² /s.

Hereinafter, the configuration and effects of the present invention will be described in more detail through examples. These examples are for illustrative purposes only, and the scope of the present invention is not limited by these examples.

Example

The strain used in the present invention was Haematococcus pluvialis NIES-144, which was purchased from National Institute for Environmental Studies, Tsukuba, Japan. The media used were modified NIES-C and NIES-N media, and their components are shown in Table 1 below. In addition, the outdoor culture conditions of the mass culture process of H. pluvialis in autotrophic conditions are shown below.

Low-density polyethylene film (LDPE) and polyethylene terephthalate and non-stretched polypropylene mixed film (PET+CPP, Filmax, CPP Film) is a photosynthetic bioreactor (height: 40cm, width: 45cm, side: 5cm, capacity: 6L, “V. The first reactor and the second reactor were manufactured by stirring the ”maximum inner spacing of the grooves: 15cm*3) using a 100L volume bubble column type air bubble.

The prepared first reactor contains NIES-C medium (autotrophic medium, purpose: growth), and the second reactor is NIES-N medium (autotrophic medium, purpose: induction of astaxanthin accumulation through nutrient deficiency stress) Included.

-Gas supply: For the outdoor culture process, exhaust gas discharged from the Pangyo branch of the Korea District Heating Corporation was used, and at this time, the CO ₂ concentration was observed to be about 3~6%.

-Injection flow rate: 0.1 vvm (vessel volume per minute)

-Incubation temperature: 23±3 ^o C

-Photoperiod: (approximately) contrast period 12: 12

-Buffer conditions are to prepare a buffer solution by aeration of the exhaust gas for about a day using 10 mM KOH solution.

NIES-C NIES-N ingredient Content (/L) ingredient Content (/L) Ca(NO3) ₂ 0.15 g CaCl ₂ 2H ₂ O 0.13 g KNO ₃ 2mM
2mM + 2mM
4 mM
4mM + 4mM
8mM KCl 0.07 g Buffer condition KOH 10 mM
Flue gas aeration over 12 hours
+phosphate buffer Buffer condition KOH 10 mM
Flue gas aeration over 12 hours
+phosphate buffer MgSO ₄ 7H ₂ O 0.04 g MgSO ₄ 7H ₂ O 0.04 g Thiamine 0.01 mg Thiamine 0.01 mg Biotin 0.10 ㎍ Biotin 0.10 ㎍ Vitamin B12 0.01 ㎍ Vitamin B12 0.01 ㎍ PIV metal solution
(per liter)
Na ₂ EDTA 1 g
FeCl ₃ ·6H ₂ O 0.196 g
MnCl ₂ 4H ₂ O 0.036 g
ZnSO ₄ 7H ₂ O 0.022 g
CoCl ₂ ·6H ₂ O 4 mg
Na ₂ MoO ₄ ·2H ₂ O 2.5 mg 3 ml PIV metal solution
(per liter)
Na ₂ EDTA 1 g
FeCl ₃ ·6H ₂ O 0.196 g
MnCl ₂ 4H ₂ O 0.036 g
ZnSO ₄ 7H ₂ O 0.022 g
CoCl ₂ ·6H ₂ O 4 mg
Na ₂ MoO ₄ ·2H ₂ O 2.5 mg 3 ml

Experimental Example 1 Development of fed-batch for high-concentration cell biomass growth in outdoor culture

In order to evaluate the effect on the nitrogen source concentration and the type of carbon source in the microalgae culture system according to the present invention, nitrogen source conditions were formulated as follows. A modified NIES-C medium was used as the medium, and the nutritional conditions except for the nitrogen source were the same as those of the NIES-C medium, and the results of culturing under the above conditions are shown in FIG. 2.

-Initial nitrogen source concentration: 1 mM (Control, initial supply), 2 mM (initial supply), 2 mM (initial supply) + 2 mM (additional supply), 4 mM (initial supply), 4 mM (initial supply) +4 mM (additional supply), 8 mM (initial supply)

-Additional supply of nitrogen source substrate at the green stage: 9 days after cell inoculation

-Nitrogen source substrate concentration: 2 mM, 4 mM, respectively

In addition, experiments were conducted on the astaxanthin accumulation efficiency and accumulation rate from the green resting cell using several carbon sources before entering the induction phase, and the results are shown in FIG. 3.

The initial culture conditions were 1.0 g/L and a 300 ml flask was used, and the culture volume was 100 ml. The light conditions were high light conditions (130~150 μE/m ² /s) and low light conditions (30~50 μE/m ² /s), respectively, and the carbon sources were glucose, acetate, ethanol, and NIES- N medium (autotrophic condition) was used. The carbon source concentration was injected at 1 mM, 5 mM, 10 mM, and 20 mM, respectively.

2 is a cell growth curve during a growing period in the process of culturing microalgae in a microalgae culture system using a power plant combustion gas and sunlight. Referring to FIG. 2, when the cell growth reaches the exponential phase, nitrogen sources, which are essential limiting substrates for cell growth, are 1 mM (control) and 2 mM+2 mM, respectively. Biomass concentration (A), residual nitrogen concentration (B), residual phosphorus concentration (C), intracellular protein concentration (D) and carotenoids according to each nitrogen concentration while supplying 4 mM, 4 mM+4mM, and 8 mM The ratio (E) of /chlorophyll was measured. Specifically, as the culture proceeds under 1 mM nitrogen source conditions, the carotenoid/chlorophyll ratio rises to a maximum of 8.6, which means that the cells have changed from flagellate form to cyst form. At this time, the concentration of the nitrogen source in the cells drops to almost zero, and the cells are transferred to the induction line by catching the culture period at this time. As can be seen in Figure 2A, the concentration of the cell biomass is the highest at 2mM + 2mM, 4 mM conditions. However, if the nitrogen source concentration in the medium is excessive initially, cell growth is inhibited, and if the nitrogen source in the medium is not consumed, the amount of astaxanthin accumulation and the rate of accumulation during the induction phase are inhibited. It can be seen that it is unfavorable to the accumulation of astaxanthin.

3 is a graph of biomass productivity and astaxanthin productivity according to types and concentrations of carbon sources for each light intensity condition. Referring to FIG. 3, acetate is an excellent carbon source under medium light conditions (130-150 μE/m ² /s, FIG. 3A), and 0.132 g/L/day and 0.126 g/L/ respectively under 10 mM and 20 mM conditions. By day, biomass production was also high. However, under low light conditions (130-150 μE/m ² /s, FIG. 3B), biomass production was rapidly lowered under acetate conditions. Through this, it was confirmed that it is essential to secure the amount of light in order to consume acetate as a carbon source. Ethanol was effectively utilized as a carbon source in both medium and low light conditions. In particular, at a low concentration (1 mM), the accumulation of astaxanthin was effectively induced, and at a higher concentration, the productivity was inhibited due to excessive production of reactive oxygen species.

Experimental Example 2 Effect of carbon source in outdoor culture

In order to evaluate the effect on the carbon source effect in the microalgae culture system according to the present invention, an experiment for optimizing the carbon source condition was conducted under the following conditions.

-Flask experiment for optimizing carbon source conditions

1) Culture volume: 300 ml flasks, 100 ml each

2) Medium condition: NIES-N medium

3) Carbon source supply conditions: 1 mM, 5 mM, 10 mM, and 20 mM of glucose, sodium acetate, and ethanol are added to the bicarbonate buffer, respectively.

4) Light condition: 130~150 μE/m ² /s (moderate light, outdoor culture light insufficient condition), 30~50 μE/m ² /s (low light)

In outdoor culture, since the carbon source in the medium causes contamination due to the influx of external microorganisms, each carbon source was applied at a time of 1 mM to carry out cultivation. First, a buffer solution is prepared by aeration of the exhaust gas for about a day using a 10 mM KOH solution for the composition of the medium in the reactor. Thereafter, after inoculating the carbon source and the NIES-N medium component, the cells were transferred as shown in FIG. 1 to proceed with the induction process.

According to FIG. 4 below, biomass growth, astaxanthin production, and residual carbon source concentration were shown for the experimental group in which the carbon source concentration was adjusted to medium and low light intensity, respectively, in outdoor culture. Referring to FIG. 4, glucose is not an advantageous carbon source for astaxanthin production and biomass growth, because glucose cannot be used as a carbon source in microalgae Hematococcus fluvialis. Acetate and ethanol are used as carbon sources, and the use of acetate depends on the light intensity, but ethanol was found to be consumed as an effective carbon source even at low light intensity. Usually, when the C/N ratio in a cell increases, not only the photosynthetic electron transport system is inhibited, but also organelles are damaged, reactive oxygen species are generated, NADP ⁺ in the cell is reduced to NADPH, and oxidative stress in the cell is reduced. NADPH, which is excessively reduced in cells, is consumed for the synthesis of astaxanthin and FAME. Ethanol's intracellular reactive oxygen species generation effect not only triggers the astaxanthin biosynthesis mechanism in the cell, but also produces an excessive amount of NADPH, and this effect occurs regardless of the light conditions, so at low light intensity, ethanol has excellent biomass productivity, astaxanthin. Not only does it show the effect of synthesizing tin, it is also used as a carbon source during the cultivation period.

These results are also related to the fatty acid production in FIG. 5 below. FAME (fatty ethly methyl ester) is associated with astaxanthin accumulation. FAME accumulation was highest in acetate and ethanol conditions. In particular, when ethanol was supplied, FAME accumulation was excellent even in low light conditions. Fatty acids in hematococcus are mainly C16 and C18, and although it was beneficial for lipid accumulation as the amount of light increased (up to 22%), cells consume NADPH and synthesize fatty acids even under the conditions of generating reactive oxygen species using ethanol. The lipid production was also higher than that of the acetate condition.

Experimental Example 3 Optimization of ethanol conditions through investigation of astaxanthin biosynthesis mechanism

In order to know about the mechanism of astaxanthin biosynthesis in the microalgal culture system according to the present invention, the experiment was conducted under the following conditions.

-Red stage culture using optimized carbon source conditions

1) Bicarbonate buffer composition condition in red stage: aeration for 12 hours or more with 0.1 vvm of exhaust gas in 10 mM KOH solution

2) Carbon source conditions: 1 mM of glucose, sodium acetate, and ethanol are added to each bicarbonate buffer.

3) Light condition: 130~150 μE/m ² /s (medium light), 30~50 μE/m ² /s (low light)

-rtPCR (real-time PCR) gene primer conditions shown in [Table 2]

Gene Primer sequence (5'-3') 18S Forward TGCCTAGTAAGCGCGAGTCA Reverse CCCACCGCTAAAGTCAATCC ipi-1 Forward GTGGACGAAGTCAGGTAC Reverse CGTGTTTGTCAGTGTTTAGG ipi-2 Forward CACTGACAAACACGAGGAT Reverse AATATGATGCACCATTGACTC psy Forward ATGCCATTGAGAAGAATGACTA Reverse TGACCACTTGCTGTTCTG pds Forward GCCACCTCACAAACTCAT Reverse ACCTCCTACCTGTCTTGG crtO Forward GGAGAAGGAGAAGGAGGT Reverse GAAGGTGGTGGCTTGTAG crtR-b Forward TGAAGCCAACGACTTGTT Reverse ATGCCGTATAGCGTGATG

As can be seen in FIG. 6, generation of reactive oxygen species due to ethanol induces astaxanthin biosynthesis at a certain concentration, but an excessive amount of reactive oxygen species may rather damage cells. The amount of reactive oxygen species in the cell can be quantified through DCF measurement. When the amount of biomass production and the concentration of reactive oxygen species are measured under the conditions of ethanol 1 mM, 5 mM, 10 mM, and 20 mM, respectively, as the ethanol concentration increases It can be seen that the biomass concentration decreases. It can be seen that the concentration of reactive oxygen species appears high during the first 0 to 2 days of induction, and then gradually decreases in the cell.

Accordingly, the conditions for optimizing ethanol concentration were derived to minimize cell damage and efficiently induce astaxanthin accumulation, and autotrophic conditions and conditions for adding 1 mM ethanol were compared. As shown in FIG. 7, the concentration of reactive oxygen species and lipid peroxide were measured, respectively, and the concentration of polyunsaturated fatty acid oxide MDA (malondialdehyde) due to reactive oxygen species and reactive oxygen species under ethanol addition conditions was compared with autonutrition conditions. It was confirmed that the increase was observed, and the concentration was higher in the medium light condition. Through this, it was possible to derive the fact that reactive oxygen species are produced in different degrees according to the light conditions, and that light is also involved in the oxidative stress of cells. Low light conditions are disadvantageous to the accumulation of astaxanthin because the oxidative stress applied to cells is relatively low, but the use of a chemical inducer such as ethanol can increase the degree of oxidative stress.

Referring to FIG. 8, when sesamol inhibiting oxidative stress and DCMU inhibiting photosystem II are used, the intracellular oxidative stress rapidly decreases. Sesamol is an antioxidant that inhibits oxidative stress in cells, and reduces the amount of NADPH supplied by inhibiting the malic cycle of cells. As a result, the amount of NADPH that can be consumed for astaxanthin and lipid synthesis decreases. DCMU inhibits the activity of photosystem II, resulting in the inability of cells to grow irrespective of the light conditions. Through this, it can be derived that the involvement of photosystem II during the induction phase of hematococcus cells is essential, and that irradiation with a certain amount of light is necessary for the production of astaxanthin.

9 is an observation of the activity of a gene involved in the biosynthesis of astaxanthin in hematococcus under ethanol addition conditions. Compared with autotrophic conditions, it was confirmed through rt-PCR data that the degree of transcription of genes involved in astaxanthin biosynthesis rapidly increased within the initial 12 hours after entering the induction phase. Ipi, a gene involved in the production of an enzyme (IPP isomerase) that provides a carbon source substrate for astaxanthin biosynthesis, and an enzyme involved in transforming carotenoids into astaxanthin (CRTR-B (β-carotene hydroxylase): β-carotene. The activity of crtb-O, a gene involved in the production of β-carotene ketolases/oxygenases), which converts to astaxanthin, increased 9-fold and 17.5-fold, respectively. Through this, ethanol generates reactive oxygen species and helps to increase the accumulation of astaxanthin by increasing the activity of genes involved in astaxanthin biosynthesis. Can increase production.

Claims (9)

A growth process of growing biomass by supplying a growth medium, microalgae, carbon dioxide and nitrogen sources into the first reactor; And
Astaxanthin production method comprising a production process of producing astaxanthin in the presence of sunlight by supplying an induction phase medium and a carbon source to a culture medium containing biomass supplied from the first reactor. The method of claim 1,
The growth process is a method for producing astaxanthin, characterized in that supplying a nitrogen source at a concentration of 1 mM to 10 mM. The method of claim 1,
Astaxanthin production method, characterized in that the growth process is carried out under light conditions of 10 to 80 μE/m ^{2 /s.} The method of claim 1,
Astaxanthin production method, characterized in that when the culture solution of the first reactor is depleted of nitrogen and falls below a preset concentration, a part of the culture solution is transferred to the second reactor. The method of claim 1,
When the transfer of the culture medium from the first reactor to the second reactor is completed, the growth medium is resupplied to the first reactor as much as the amount of the culture medium discharged to continuously grow microalgae. The method of claim 1,
Astaxanthin production method, characterized in that the carbon source in the production process is at least one selected from the group consisting of ethanol and acetate. The method of claim 1,
The production process is a method for producing astaxanthin, characterized in that the carbon source is supplied at a concentration of 0.5 mM to 20 mM. The method of claim 1,
Astaxanthin production method, characterized in that the growth process is carried out under light conditions of 100 to 200 μE/m ^{2 /s.} The method of claim 1,
Astaxanthin production method, characterized in that the first reactor and the second reactor are independently any one of a stirred reactor, a plate reactor, a tubular reactor, a column reactor, and a polymer film reactor.

Images