KR102347836B1 - Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration - Google Patents

Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration Download PDF

Info

Publication number
KR102347836B1
KR102347836B1 KR1020210060347A KR20210060347A KR102347836B1 KR 102347836 B1 KR102347836 B1 KR 102347836B1 KR 1020210060347 A KR1020210060347 A KR 1020210060347A KR 20210060347 A KR20210060347 A KR 20210060347A KR 102347836 B1 KR102347836 B1 KR 102347836B1
Authority
KR
South Korea
Prior art keywords
brain
blood
damage
present
lcn2
Prior art date
Application number
KR1020210060347A
Other languages
Korean (ko)
Other versions
KR20210056314A (en
Inventor
박주영
이은희
한문
최효진
Original Assignee
재단법인 대구경북첨단의료산업진흥재단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 재단법인 대구경북첨단의료산업진흥재단 filed Critical 재단법인 대구경북첨단의료산업진흥재단
Priority to KR1020210060347A priority Critical patent/KR102347836B1/en
Publication of KR20210056314A publication Critical patent/KR20210056314A/en
Application granted granted Critical
Publication of KR102347836B1 publication Critical patent/KR102347836B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
    • A01K67/027—New breeds of vertebrates
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00—Modified animals
    • A01K2207/35—Animals modified by environmental factors, e.g. temperature, O2
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/60—Complex ways of combining multiple protein biomarkers for diagnosis

Abstract

본 발명은 뇌미세혈관 손상 뇌질환 진단용 바이오 마커 조성물, 보다 상세하게는, MRI 영상 기반으로 뇌 국소영역을 정밀하게 구분하여 해당 국소 영역에서만 혈뇌장벽 변성을 유도하여, 뇌미세혈관 손상으로 인한 뇌질환 동물 모델을 제조하는 방법, 상기 동물 모델을 이용한 혈뇌장벽 변성으로 인한 뇌미세혈관 손상 뇌질환 진단용 바이오 마커를 스크리닝 하는 방법 및 혈뇌장벽 변성으로 인한 뇌미세혈관 손상 뇌질환 진단용 바이오 마커 조성물에 관한 것이다.The present invention is a biomarker composition for diagnosing brain microvascular damage brain disease, and more specifically, by precisely classifying a local brain region based on an MRI image and inducing blood-brain barrier degeneration only in the local region, brain disease caused by brain microvascular damage It relates to a method for manufacturing an animal model, a method for screening a biomarker for diagnosing brain microvascular damage caused by blood-brain barrier degeneration using the animal model, and a biomarker composition for diagnosing brain microvascular damage brain disease due to blood-brain barrier degeneration.

Description

뇌미세혈관 손상 뇌질환 진단용 바이오 마커 조성물 {Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration}Biomarker composition for diagnosis of brain diseases due to brain microvascular damage {Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration}

본 발명은 뇌미세혈관 손상 뇌질환 진단용 바이오 마커 조성물, 보다 상세하게는, MRI 영상 기반으로 뇌 국소영역을 정밀하게 구분하여 해당 국소 영역에서만 혈뇌장벽 변성을 유도하여, 뇌미세혈관 손상으로 인한 뇌질환 동물 모델을 제조하는 방법, 상기 동물 모델을 이용한 혈뇌장벽 변성으로 인한 뇌미세혈관 손상 뇌질환 진단용 바이오 마커를 스크리닝 하는 방법 및 혈뇌장벽 변성으로 인한 뇌미세혈관 손상 뇌질환 진단용 바이오 마커 조성물에 관한 것이다.The present invention is a biomarker composition for diagnosing brain microvascular damage brain disease, and more specifically, by precisely classifying a local brain region based on an MRI image and inducing blood-brain barrier degeneration only in the local region, brain disease caused by brain microvascular damage It relates to a method for manufacturing an animal model, a method for screening a biomarker for diagnosing brain microvascular damage caused by blood-brain barrier degeneration using the animal model, and a biomarker composition for diagnosing brain microvascular damage brain disease due to blood-brain barrier degeneration.

혈뇌장벽은 뇌와 혈관 사이에 존재하는 장벽으로, 뇌에 외부 물질이 들어오는 것을 막는다. 혈뇌장벽은 뇌에 외부 물질이 들어오는 것을 막고, 대사에 필요한 물질을 받아들여 뇌를 보호하는 역할을 한다. 예를 들어 뇌에서 세균 또는 바이러스로의 침입을 막고, 포도당 공급과 산소-이산화탄소 교환을 원활하게 한다. 혈액은 혈뇌장벽을 통해 여과되며, 결과적으로 뇌에 다다르는 물질은 물이나 기체 분자, 포도당, 특정 지용성 등 극소수이다. 혈뇌장벽은 혈관을 뇌의 내피세포로 감싸는 모양을 띄며, 내피세포는 서로 밀착 연접(tight junction)되어 있기에 세포 사이로 물질이 지나가는 것이 불가능하다. 이 때문에 혈뇌장벽은 진단을 위한 다양한 영상제뿐 아니라, 종양, 알츠하이머, 파킨슨병 등 뇌에 질병이 생겼을 때 약물이 통과하는 것을 막아 뇌 관련 진단 및 치료 기술 개발에 저해가 되고 있다. The blood-brain barrier is a barrier that exists between the brain and blood vessels and prevents foreign substances from entering the brain. The blood-brain barrier prevents foreign substances from entering the brain and protects the brain by receiving substances necessary for metabolism. For example, it prevents the invasion of bacteria or viruses in the brain, and facilitates glucose supply and oxygen-carbon dioxide exchange. Blood is filtered through the blood-brain barrier, and as a result, very few substances reach the brain, such as water or gas molecules, glucose, and certain fat-soluble substances. The blood-brain barrier has a shape that surrounds blood vessels with endothelial cells of the brain, and since the endothelial cells are in tight junction with each other, it is impossible for substances to pass between the cells. For this reason, the blood-brain barrier prevents the passage of drugs when a disease occurs in the brain, such as tumor, Alzheimer's, or Parkinson's, as well as various imaging agents for diagnosis, impeding the development of brain-related diagnosis and treatment technologies.

최근 연구에서, 알츠하이머 치매의 최초 신호는 혈뇌장벽의 누출이라는 결과가 나왔다. 미국 서던 캘리포니아대학 의대 신경유전자 연구소(Neurogenetic Institute) 소장 베리슬라프 즐로코비치 박사 연구팀에서는 치매는 주범으로 알려진 뇌 신경세포의 독성 단백질 베타 아밀로이드의 응집(plaque)과 타우 단백질의 엉킴(tangle)과 관계없이 혈뇌장벽 누출이 독립적인 위험요인이라는 연구결과를 발표하였다. 인지기능이 정상인 노인 161명을 대상으로 5년에 걸쳐 각종 테스트를 통해 인지기능을 평가하면서 뇌 영상 검사와 뇌 척수액 분석을 통해 혈뇌장벽의 투과성을 측정한 결과, 인지기능 저하와 혈뇌장벽 누출 사이에 밀접한 연관이 있었다. 특히 기억력이 많이 떨어지는 사람일수록 말초 혈관의 혈뇌장벽 누출이 가장 심한 것으로 나타났다. 치매뿐만 아니라 파킨슨 병 등 퇴행성 뇌질환과 혈뇌장벽 손상에 대한 연관성 연구도 많이 진행 중이다. 상기 연구를 위해 치매, 파킨슨병과 같이 퇴행성 뇌질환을 연구하기 위한, 혈뇌장벽 손상으로 인한 뇌미세혈관 손상으로 인한 뇌질환 동물모델이 필요하다. 그러나 기존에 뇌혈관장벽에 관한 모델로 널리 사용되는 동물 모델의 경우 침습적이고, 실시간 관찰이 어려우며 개별 세포요소의 기능을 구별하기 어렵고, 동물실험에 대한 윤리적인 문제가 지속적으로 제기됨에 따라 대안적인 동물 연구 모델이 필요한 실정이다. A recent study showed that the first sign of Alzheimer's dementia is leakage of the blood-brain barrier. According to Dr. Verislav Zlokovich, director of the Neurogenetic Institute, University of Southern California, U.S., the relationship between the plaque of beta-amyloid, a toxic protein in brain neurons, which is known to be the main culprit in dementia and the tangle of the tau protein. However, the study results were published that blood-brain barrier leakage is an independent risk factor. As a result of measuring the blood-brain barrier permeability through brain imaging tests and cerebrospinal fluid analysis while evaluating cognitive function through various tests over 5 years in 161 elderly people with normal cognitive function, the results showed that there was no significant difference between cognitive decline and blood-brain barrier leakage. was closely related. In particular, it was found that the blood-brain barrier leakage of peripheral blood vessels was the most severe in people with poor memory. In addition to dementia, many studies are being conducted on the association between degenerative brain diseases such as Parkinson's disease and damage to the blood-brain barrier. For the above study, an animal model of brain disease caused by damage to brain microvessels due to damage to the blood-brain barrier is needed to study degenerative brain diseases such as dementia and Parkinson's disease. However, animal models that have been widely used as models for the blood-brain barrier are invasive, difficult to observe in real time, difficult to distinguish the functions of individual cellular elements, and ethical issues regarding animal experiments are continuously raised. A research model is needed.

이에 본 발명자들은 혈뇌장벽의 손상 동물 모델을 개발하기 위해 연구를 거듭한 결과, 마우스에 초음파 에너지를 조사하여 혈뇌장벽의 변성을 유도하여 뇌미세혈관 손상으로 인한 뇌 질환 마우스 모델을 제작하였고, 상기 마우스 모델의 뇌 조직에서 분리한 단백질을 분석하여 혈뇌장벽의 변성으로 인한 뇌 미세혈관 손상 뇌질환과 관련된 바이오 마커를 스크리닝한 결과, Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2이 뇌 미세혈관 손상으로 인한 뇌질환과 관련된 바이오 마커임을 확인함으로써, 본 발명을 완성하였다.Accordingly, the present inventors repeated research to develop an animal model for damage to the blood-brain barrier. As a result, the mouse was irradiated with ultrasound energy to induce degeneration of the blood-brain barrier to produce a mouse model of brain disease caused by damage to the brain microvessels. As a result of screening for biomarkers related to brain microvascular damage brain disease caused by degeneration of the blood-brain barrier by analyzing proteins isolated from the brain tissue of the model, Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, By confirming that Scgb3a or Bst2 is a biomarker related to brain disease caused by damage to brain microvascular, the present invention was completed.

본 발명의 목적은 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자를 포함하는, 뇌 미세혈관 손상으로 인한 뇌 질환 진단용 바이오 마커 조성물을 제공하는데 있다. It is an object of the present invention to include any one or more genes selected from the group consisting of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2, for diagnosing brain diseases caused by brain microvascular damage To provide a marker composition.

본 발명의 다른 목적은 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 mRNA 발현 또는 이의 단백질 활성 수준을 측정하는 제제를 포함하는 뇌 미세혈관 손상으로 인한 뇌 질환 진단용 조성물을 제공하는 것이다. Another object of the present invention is to provide an agent for measuring the mRNA expression or protein activity level of any one or more genes selected from the group consisting of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2. It is to provide a composition for diagnosing brain diseases caused by damage to the brain microvasculature, comprising.

본 발명의 또 다른 목적은 상기 서술한 조성물을 포함하는 뇌 미세혈관 손상으로 인한 뇌 질환 진단용 키트를 제공하는 것이다. Another object of the present invention is to provide a kit for diagnosing brain diseases caused by damage to brain microvessels comprising the above-described composition.

본 발명의 또 다른 목적은 하기의 단계를 포함하는 뇌 미세혈관 손상으로 인한 뇌 질환의 예방 또는 치료용 약학적 조성물을 스크리닝 하는 방법을 제공하는데 있다. (a) 생물학적 샘플에 임의의 화합물을 처리하는 단계; (b) 상기 생물학적 샘플로부터 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자 또는 이의 단백질의 발현 수준 또는 활성 수준을 확인하는 단계; 및 (c) 상기 발현 수준을 임의의 화합물을 처리하지 않은 정상 대조군에서의 상기 유전자 또는 이의 발현 단백질의 수준과 또는 활성 수준을 비교하는 단계.Another object of the present invention is to provide a method for screening a pharmaceutical composition for the prevention or treatment of brain diseases caused by damage to brain microvasculature, comprising the following steps. (a) treating the biological sample with any compound; (b) Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2 from the biological sample any one or more genes selected from the group consisting of or the expression level or activity level of a protein thereof to confirm step; and (c) comparing the expression level with the level of or activity level of the gene or expression protein thereof in a normal control that is not treated with any compound.

본 발명의 다른 목적은 (a) 마우스에 집속 초음파를 0.25 내지 0.27 MPa로 10초 내지 230초 동안 처리는 단계를 포함하는 optimal BBB 변성 마우스 모델을 제작하는 방법을 제공하는데 있다.Another object of the present invention is to provide a method for producing an optimal BBB degeneration mouse model comprising the step of (a) treating the mouse with a focused ultrasound at 0.25 to 0.27 MPa for 10 seconds to 230 seconds.

본 발명의 다른 목적은 (a) 마우스에 집속 초음파 0.42 내지 0.44 MPa로 10초 내지 230초 동안 처리하는 단계를 포함하는 mild damaged BBB 변성 마우스 모델을 제작하는 방법을 제공하는데 있다.Another object of the present invention is to provide a method for producing a mild damaged BBB degeneration mouse model comprising the step of (a) treating the mouse with 0.42 to 0.44 MPa of focused ultrasound for 10 seconds to 230 seconds.

상기 목적을 달성하기 위해, 본 발명은 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자를 포함하는 뇌미세혈관 손상으로 인한 뇌 미세혈관 손상으로 인한 뇌 질환 진단용 바이오 마커 조성물을 제공할 수 있다. In order to achieve the above object, the present invention is Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2 due to brain microvascular damage comprising any one or more genes selected from the group consisting of It is possible to provide a biomarker composition for diagnosing brain diseases caused by damage to brain microvessels.

본 발명은 또한 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 mRNA 발현 또는 이의 단백질 활성 수준을 측정하는 제제를 포함하는 뇌 미세혈관 손상으로 인한 뇌 질환 진단용 조성물을 제공할 수 있다. The present invention also includes an agent for measuring the mRNA expression or protein activity level of any one or more genes selected from the group consisting of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2 It is possible to provide a composition for diagnosing brain diseases caused by damage to brain microvessels.

상기 제제는 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자에 특이적으로 결합하는 프라이머 또는 프로브일 수 있다. The agent may be a primer or probe that specifically binds to any one or more genes selected from the group consisting of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2.

상기 제제는 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 단백질에 특이적으로 결합하는 항체일 수 있다. The agent may be an antibody that specifically binds to a protein of any one or more genes selected from the group consisting of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2.

본 발명은 또한 상기 서술한 조성물을 포함하는 뇌 미세혈관 손상으로 인한 뇌 질환 진단용 키트를 제공할 수 있다. The present invention may also provide a kit for diagnosing brain diseases caused by damage to brain microvascular cells comprising the above-described composition.

본 발명은 또한 생물학적 시료로부터 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 mRNA 발현 또는 이의 단백질 활성 수준을 측정하는 단계;를 포함하는 뇌 미세혈관 손상으로 인한 뇌 질환 진단을 위한 정보제공방법을 제공할 수 있다. The present invention also comprises the steps of measuring the mRNA expression or protein activity level of any one or more genes selected from the group consisting of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2 from a biological sample It is possible to provide an information providing method for diagnosing brain diseases caused by damage to brain microvessels, including.

본 발명은 하기의 단계를 포함하는 뇌 미세혈관 손상으로 인한 뇌 질환의 예방 또는 치료용 약학적 조성물을 스크리닝 하는 방법을 제공할 수 있다: (a) 생물학적 샘플에 임의의 화합물을 처리하는 단계; (b) 상기 생물학적 샘플로부터 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자 또는 이의 단백질의 발현 수준 또는 활성 수준을 확인하는 단계; 및 (c) 상기 발현 수준을 임의의 화합물을 처리하지 않은 정상대조군에서의 상기 유전자 또는 이의 발현 단백질의 수준과 또는 활성 수준을 비교하는 단계.The present invention may provide a method for screening a pharmaceutical composition for preventing or treating a brain disease caused by damage to brain microvasculature, comprising the steps of: (a) treating a biological sample with an arbitrary compound; (b) Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2 from the biological sample any one or more genes selected from the group consisting of or the expression level or activity level of a protein thereof to confirm step; and (c) comparing the expression level with the level of or activity level of the gene or its expressed protein in a normal control group not treated with any compound.

본 발명은 (a) 마우스에 집속 초음파를 0.25 내지 0.27 MPa로 10초 내지 230초 동안 처리는 단계를 포함하는 optimal BBB 변성 마우스 모델을 제작하는 방법을 제공할 수 있다. The present invention can provide a method for producing an optimal BBB degeneration mouse model comprising the step of (a) treating the mouse with a focused ultrasound at 0.25 to 0.27 MPa for 10 seconds to 230 seconds.

본 발명은 (a) 마우스에 집속 초음파 0.42 내지 0.44 MPa로 10초 내지 230초 동안 처리하는 단계를 포함하는 mild damaged BBB 변성 마우스 모델을 제작하는 방법을 제공할 수 있다.The present invention may provide a method for producing a mild damaged BBB degeneration mouse model comprising the step of (a) treating the mouse with 0.42 to 0.44 MPa of focused ultrasound for 10 seconds to 230 seconds.

본 발명은 집속 초음파를 마우스에 조사하여 혈뇌장벽(blood-brain barrier; BBB)의 개통으로 인한 뇌 미세혈관 손상 뇌 질환 마우스 모델을 제작하였다. 또한 상기 집속 초음파의 세기를 조절하여 혈뇌장벽의 개통 정도를 조절 하였고, 상기 조절로 경도 손상(optimal damage) 및 중등 손상(mild damage)를 일으켜, optimal BBB 변성 마우스 모델 및 mild BBB 변성 마우스 모델을 제작 하였다. 상기 mild BBB 변성 마우스의 뇌를 가지고, 생물학적 분석 방법인 transcriptome sequencing analysis를 진행하여, BBB의 변성으로 인한 뇌질환 진단 마커를 발굴한 결과, Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2이 뇌 미세혈관 손상으로 인한 뇌 질환을 진단할 수 있다는 것을 확인하였다. 상기 시험결과를 바탕으로 optimal BBB 변성 동물 모델 및 mild BBB 변성 동물 모델의 혈액에서 Klk 6 및 Lcn2을 확인인한 결과 증가하는 것을 확인하였다. 상기의 결과를 토대로 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2을 이용하여 뇌 미세혈관 손상으로 인한 뇌 질환, 예를 들어 치매, 뇌암, 파킨슨, 뇌진탕 (TBI) 또는 뇌졸중을 진단 할 수 있는 효과가 있다.In the present invention, a mouse model of brain microvascular damage caused by the opening of the blood-brain barrier (BBB) was produced by irradiating focused ultrasound to the mouse. In addition, the degree of patency of the blood-brain barrier was controlled by controlling the intensity of the focused ultrasound, and the adjustment caused mild damage and optimal BBB degeneration mouse model and mild BBB degeneration mouse model did With the brain of the mild BBB degeneration mouse, transcriptome sequencing analysis, a biological analysis method, was performed to discover brain disease diagnostic markers due to BBB degeneration. As a result, Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, It was confirmed that clcf 1, Scgb3a or Bst2 can diagnose brain diseases caused by brain microvascular damage. Based on the test results, it was confirmed that Klk 6 and Lcn2 were increased in the blood of the optimal BBB degeneration animal model and the mild BBB degeneration animal model. Based on the above results, using Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a or Bst2, brain diseases caused by damage to brain microvessels, such as dementia, brain cancer, Parkinson's, concussion (TBI ) or has the effect of diagnosing stroke.

도 1은 집속 초음파를 이용한 BBB 개통 동물모델을 제작하는 방법의 모식도이다.
도 2는 자기공명영상장치를 이용하여 집속 초음파를 이용한 BBB 동물모델의 BBB 변성 정도를 확인한 결과이다.
도 3은 유전체 분석을 통한 BBB 변성 뇌 조직에서 유전자 발현의 변화를 확인한 결과이다.
도 4는 유전체 분석 결과를 바탕으로 혈액 바이오 마커 후보를 선정한 결과이다.
도 5는 BBB 동물모델의 혈액에서 KLK 6 및 LCN 2의 발현 정도를 확인한 결과이다. 1 is a schematic diagram of a method for producing a BBB cannulated animal model using focused ultrasound.
2 is a result of confirming the degree of BBB degeneration in a BBB animal model using focused ultrasound using a magnetic resonance imaging device.
3 is a result of confirming the change in gene expression in the BBB-denatured brain tissue through genomic analysis.
4 is a result of selecting blood biomarker candidates based on the results of genome analysis.
5 is a result confirming the expression levels of KLK 6 and LCN 2 in the blood of the BBB animal model.

이하, 본 발명을 보다 상세히 설명한다.Hereinafter, the present invention will be described in more detail.

본 발명은 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자를 포함하는 뇌 미세혈관 손상으로 인한 뇌 질환 진단용 바이오 마커 조성물을 제공할 수 있다. The present invention provides a biomarker composition for diagnosing brain diseases caused by brain microvascular damage comprising any one or more genes selected from the group consisting of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2. can provide

혈뇌장벽은 뇌와 혈관 사이에 존재하는 장벽으로, 뇌에 외부 물질이 들어오는 것을 막는다. 최근 연구에서 혈뇌장벽 누출이 독립적인 위험요인이라는 연구결과가 발표되었다. 따라서 치매, 파킨슨병과 같은 뇌 미세혈관 손상으로 인한 뇌질환을 연구하기 위해, 혈뇌장벽 손상 동물모델이 필요하다. 그러나 기존에 뇌혈관장벽에 관한 모델로 널리 사용되는 동물 모델의 경우 실시간 관찰이 어려우며 개별 세포요소의 기능을 구별하기 어렵고, 동물실험에 대한 윤리적인 문제가 지속적으로 제기됨에 따라 대안적인 동물 연구 모델이 필요한 실정이다. 이에 본 발명자들은 집속 초음파를 마우스에 조사하여 혈뇌장벽(blood-brain barrier; BBB)의 개통 모델을 제작하였다. 특정 집속 초음파의 세기를 조절하여 혈뇌장벽의 개통 정도를 조절 하였고, 상기 조절로 경도 손상(optimal damage) 및 중등 손상(mild damage)을 일으켜, optimal BBB 변성 마우스 모델 및 mild BBB 변성 마우스 모델을 제작하였다. 상기 mild BBB 변성 마우스의 뇌를 가지고, 생물학적 분석 방법인 transciptome sequencing analysis를 진행하여, 뇌 미세혈관 손상으로 인한 뇌질환 진단 마커를 발굴하였다. BBB의 손상이 중반 정도로 예상할 수 있는 mild damage BBB 조건에서 RNA sequencing 분석 결과를 통해 시간에 따른 유전자 발현 변화를 control 그룹과 비교하였을 때, 48시간 째 약 518개의 유전자가 증가되었고 174개의 유전자가 감소되는 경향을 나타내었다 (도 3). 상기의 결과를 바탕으로 mild damage BBB 조건에서의 혈액 바이오 마커 후보군을 선정하였다. 518개의 유전자중 Control 대비 3배 이상 증가되고 혈액에서 검출할 수 있는 수용성의 단백질을 코딩 하고 있는 10개(Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2)의 유전자를 후보군으로 선정하였다 (도 4). 상기 유전자 중 KLK 6 및 LCN2의 경우에는 optimal BBB 변성 마우스 모델 및 mild BBB 변성 마우스 모델의 혈액에서 확인한 결과, KlK6의 혈액에서의 발현은 optimal condition과 mild damaged condition에서 BBB 개통 후 시간이 지남에 따라 점차 증가되었고, LCN2의 혈액 내 발현은 optimal condition BBB 개통 후 12시간까지 증가되다가 다시 감소됨을 확인하였다. 이를 통해 뇌미세혈관 손상에 의한 뇌질환의 혈액 바이오 마커 발굴 가능성을 확인하였다 (도 5). The blood-brain barrier is a barrier that exists between the brain and blood vessels and prevents foreign substances from entering the brain. In a recent study, a study result was published that blood-brain barrier leakage was an independent risk factor. Therefore, in order to study brain diseases caused by damage to brain microvessels such as dementia and Parkinson's disease, animal models of blood-brain barrier damage are needed. However, in the case of animal models that have been widely used as models for the existing blood-brain barrier, it is difficult to observe in real time, it is difficult to distinguish the functions of individual cellular elements, and as ethical issues regarding animal experiments are continuously raised, alternative animal research models are not available. is in need. Accordingly, the present inventors irradiated the mouse with focused ultrasound to produce a blood-brain barrier (BBB) patency model. By controlling the intensity of a specific focused ultrasound, the degree of patency of the blood-brain barrier was controlled, and mild damage and moderate damage were caused by the adjustment, thereby producing an optimal BBB degeneration mouse model and a mild BBB degeneration mouse model. . The brain of the mild BBB degenerative mouse was subjected to transciptome sequencing analysis, a biological analysis method, to discover a marker for brain disease diagnosis due to brain microvascular damage. When the change in gene expression over time was compared with the control group through RNA sequencing analysis under mild damage BBB conditions, where BBB damage can be expected to be moderate, about 518 genes increased and 174 genes decreased at 48 hours. showed a tendency to become (FIG. 3). Based on the above results, a blood biomarker candidate group under mild damage BBB conditions was selected. Of the 518 genes, 10 (Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2) encoding a water-soluble protein that is more than 3 times higher than that of Control and can be detected in blood A gene was selected as a candidate group (FIG. 4). Among the above genes, in the case of KLK6 and LCN2, as a result of confirming in the blood of the optimal BBB degeneration mouse model and the mild BBB degeneration mouse model, the expression of KlK6 in the blood gradually increased over time after opening the BBB under optimal and mild damaged conditions. was increased, and it was confirmed that the expression of LCN2 in the blood increased up to 12 hours after opening the optimal condition BBB and then decreased again. Through this, the possibility of discovering blood biomarkers for brain diseases caused by brain microvascular damage was confirmed (FIG. 5).

본 발명에 있어서, Lcn2 (Lipocalin 2)은 리포칼린 계열에 속하는 단백질을 암호화하는 유전자로 지질, 스테로이드 호르몬 및 레티노이드와 같은 작은 소수성 분자를 운반한다. 혈액과 소변에서 상기 단백질의 존재는 급성 신장 손상의 초기 바이오 마커이다. 그러나 상기 유전자의 뇌미세혈관 손상으로 인한 뇌 질환의 상관관계에 대해서는 전혀 개시되어 있지 않다. 본 발명의 Lcn2의 정보는 예를 들어 NCBI gene ID NM 008491에 개시된 것이 바람직하나, 이에 제한되는 것은 아니다. In the present invention, Lcn2 (Lipocalin 2) is a gene encoding a protein belonging to the lipocalin family and carries small hydrophobic molecules such as lipids, steroid hormones and retinoids. The presence of these proteins in blood and urine is an early biomarker of acute kidney injury. However, the correlation between brain diseases caused by damage to the brain microvasculature of the gene is not disclosed at all. Lcn2 information of the present invention is preferably disclosed in, for example, NCBI gene ID NM 008491, but is not limited thereto.

본 발명에 있어서, SPP1(Secreted Phosphoprotein 1)은 파골 세포가 광물질화된 골기질(mineralized bone matrix)에 결합하는데 관여한다. 상기 유전자의 단백질은 또한 인터페론-γ 및 인터루킨-12의 발현을 상향 조절하는 사이토카인 (cytokine)이다. 그러나 상기 유전자의 뇌미세혈관 손상으로 인한 뇌 질환의 상관관계에 대해서는 전혀 개시되어 있지 않다. 본 발명의 SPP1의 정보는 예를 들어 NCBI gene ID NM_001204201에 개시된 것이 바람직하나, 이에 제한되는 것은 아니다. In the present invention, SPP1 (Secreted Phosphoprotein 1) is involved in the binding of osteoclasts to the mineralized bone matrix. The protein of this gene is also a cytokine that up-regulates the expression of interferon-γ and interleukin-12. However, the correlation between brain diseases caused by damage to the brain microvasculature of the gene is not disclosed at all. The information of SPP1 of the present invention is preferably disclosed in, for example, NCBI gene ID NM_001204201, but is not limited thereto.

본 발명에 있어서, Saa3 (Serum amyloid A 3)은 고밀도 지단백질과 관련된 아포질 단백질의 계열이다. 그러나 상기 유전자의 뇌미세혈관 손상으로 인한 뇌 질환의 상관관계에 대해서는 전혀 개시되어 있지 않다. 본 발명의 Saa3 의 정보는 예를 들어 NCBI IDNM_011315에 개시된 것이 바람직하나 이에 제한되는 것은 아니다. In the present invention, Saa3 (Serum amyloid A 3) is a family of apolipoproteins related to high-density lipoproteins. However, the correlation between brain diseases caused by damage to the brain microvasculature of the gene is not disclosed at all. The information of Sa3 of the present invention is preferably disclosed in, for example, NCBI IDNM_011315, but is not limited thereto.

본 발명에 있어서, Ptx3(Pentraxin 3)은 여러 중간엽과 상피 세포 유형, 특히 내피 세포 및 단핵 식세포에서 염증성 자극에 대한 반응으로 염증성 사이토카인에 의해 유도된다. 상기 유전자의 단백질은 섬유 세포 분화를 촉진하고 염증 및 보체 활성화 조절에 관여한다. 여러 염증성 질환의 바이오 마커이다. 그러나 상기 유전자의 뇌미세혈관 손상으로 인한 뇌 질환의 상관관계에 대해서는 전혀 개시되어 있지 않다. 본 발명의 Ptx3의 정보는 예를 들어 NCBI gene ID NM_008987에 개시된 것이 바람직하나, 이에 제한되는 것은 아니다. In the present invention, Ptx3 (Pentraxin 3) is induced by inflammatory cytokines in response to inflammatory stimuli in several mesenchymal and epithelial cell types, particularly endothelial cells and mononuclear phagocytes. The protein of this gene promotes fibroblast differentiation and is involved in the regulation of inflammation and complement activation. It is a biomarker of several inflammatory diseases. However, the correlation between brain diseases caused by damage to the brain microvasculature of the gene is not disclosed at all. Ptx3 information of the present invention is preferably disclosed in, for example, NCBI gene ID NM_008987, but is not limited thereto.

본 발명에 있어서, A2m(Alpha-2-Macroglobulin)은 프로테아제 억제제 및 사이토카인 트랜스 포터이다. 상기 유전자는 트립신, 트롬빈 및 콜라게나제를 포함하여 광범위한 단백질 분해 효소를 억제하기 위해 사용된다. 염증성 사이토 카인을 억제한다. 그러나 상기 유전자의 뇌미세혈관 손상으로 인한 뇌 질환의 상관관계에 대해서는 전혀 개시되어 있지 않다. 본 발명의 A2m의 정보는 예를 들어 NCBI gene ID NM_175628에 개시된 것이 바람직하나, 이에 제한되는 것은 아니다. In the present invention, A2m (Alpha-2-Macroglobulin) is a protease inhibitor and a cytokine transporter. These genes are used to inhibit a wide range of proteolytic enzymes, including trypsin, thrombin and collagenase. Inhibits inflammatory cytokines. However, the correlation between brain diseases caused by damage to the brain microvasculature of the gene is not disclosed at all. The information of A2m of the present invention is preferably disclosed in, for example, NCBI gene ID NM_175628, but is not limited thereto.

본 발명에 있어서, Lrg1 (Leucine Rich Alpha-2-Glycoprotein)은 Lrg1을 포함하는 leucine-rich repeat (LRR) family는 단백질-단백질 상호작용, 신호 전달 및 세포 부착 및 발달에 관여한다. LRG1은 수두증과 관련이 있다. 그러나 상기 유전자의 뇌미세혈관 손상으로 인한 뇌 질환의 상관관계에 대해서는 전혀 개시되어 있지 않다. 본 발명의 Lrg1의 정보는 예를 들어 NCBI gene ID NM_029796에 개시된 것이 바람직하나, 이에 제한되는 것은 아니다.In the present invention, Lrg1 (Leucine Rich Alpha-2-Glycoprotein) is a leucine-rich repeat (LRR) family including Lrg1 is involved in protein-protein interaction, signal transduction, and cell adhesion and development. LRG1 is associated with hydrocephalus. However, the correlation between brain diseases caused by damage to the brain microvasculature of the gene is not disclosed at all. Lrg1 information of the present invention is preferably disclosed in, for example, NCBI gene ID NM_029796, but is not limited thereto.

본 발명에 있어서, Klk 6(Kallikrein Related Peptidase 6)은 단백질 코딩 유전자이다. 상기 유전자와 관련된 질병에는 위 식도 선암과 시뉴클라식시 병이 있다. 일반적은 암 및 기타 질병 바이오 마커이다. 그러나 상기 유전자의 뇌미세혈관 손상으로 인한 뇌 질환의 상관관계에 대해서는 전혀 개시되어 있지 않다. 본 발명의 Klk 6의 정보는 예를 들어 NCBI gene ID NM_001164696에 개시된 것이 바람직하나, 이에 제한되는 것은 아니다.In the present invention, Klk 6 (Kallikrein Related Peptidase 6) is a protein-coding gene. Diseases related to the above gene include gastroesophageal adenocarcinoma and synuclear siphon disease. Common cancer and other disease biomarkers. However, the correlation between brain diseases caused by damage to the brain microvasculature of the gene is not disclosed at all. Information on Klk 6 of the present invention is preferably disclosed in, for example, NCBI gene ID NM_001164696, but is not limited thereto.

본 발명에 있어서, Clcf1(Cardiotrophin Like Cytokine Factor 1)은 인터루킨-6 신호전달과 면역계에서 사이토카인 신호전달과 관련되어 있다. 그러나 상기 유전자의 뇌미세혈관 손상으로 인한 뇌 질환의 상관관계에 대해서는 전혀 개시되어 있지 않다. 본 발명의 Clcf1의 정보는 예를 들어 NCBI gene ID NM_001310038에 개시된 것이 바람직하나, 이에 제한되는 것은 아니다.In the present invention, Clcf1 (Cardiotrophin Like Cytokine Factor 1) is related to interleukin-6 signaling and cytokine signaling in the immune system. However, the correlation between brain diseases caused by damage to the brain microvasculature of the gene is not disclosed at all. The Clcf1 information of the present invention is preferably disclosed in, for example, NCBI gene ID NM_001310038, but is not limited thereto.

본 발명에 있어서, SCGB3A1(Secretoglobin Family 3A Member 1)은 사이토카인 활성과 관련되어 있다. 그러나 상기 유전자의 뇌미세혈관 손상으로 인한 뇌 질환의 상관관계에 대해서는 전혀 개시되어 있지 않다. 본 발명의 SCGB3A1의 정보는 예를 들어 NCBI gene ID NM_054037에 개시된 것이 바람직하나, 이에 제한되는 것은 아니다.In the present invention, SCGB3A1 (Secretoglobin Family 3A Member 1) is associated with cytokine activity. However, the correlation between brain diseases caused by damage to the brain microvasculature of the gene is not disclosed at all. The information of SCGB3A1 of the present invention is preferably disclosed in, for example, NCBI gene ID NM_054037, but is not limited thereto.

본 발명에 있어서, Bst2 (Bone Marrow Stromal Cell Antigen 2)은 pre-2 세포 성장 및 류마티스성 관절염에 관여한다. BST2와 관련된 질병으로는 인간 면역 결핍 바이러스 1 형 및 웨스타일 뇌염이 있다. 그러나 상기 유전자의 뇌미세혈관 손상으로 인한 뇌 질환의 상관관계에 대해서는 전혀 개시되어 있지 않다. 본 발명의 Bst2 의 정보는 예를 들어 NCBI gene ID NM_198095에 개시된 것이 바람직하나, 이에 제한되는 것은 아니다. In the present invention, Bst2 (Bone Marrow Stromal Cell Antigen 2) is involved in pre-2 cell growth and rheumatoid arthritis. Diseases associated with BST2 include human immunodeficiency virus type 1 and Westile encephalitis. However, the correlation between brain diseases caused by damage to the brain microvasculature of the gene is not disclosed at all. Bst2 information of the present invention is preferably disclosed in, for example, NCBI gene ID NM_198095, but is not limited thereto.

본 발명에 있어서, ‘진단’은 병리 상태의 존재 또는 특징을 확인하는 것을 의미한다. 본 발명의 목적상, 진단이란 뇌 미세혈관의 손상으로 인한 뇌질환의 발병 여부를 확인하는 것이다. 상기 뇌미세혈관의 손상으로 인한 뇌 질환은 바람직하게는 경도인지장애 (Mild cognitive impairment), 경도의 외상성뇌질환 (MTBI, mild traumatic brain injury), 일과성 허혈성발작, 루게릭병 치매, 알츠하이머, 파킨슨 등일 수 있으나 이에 제한되지 않는다. 또한 상기 뇌미세혈관 손상은 뇌혈관장벽의 개통 또는 누출로 발생하는 것일 수 있다. In the present invention, 'diagnosis' means confirming the presence or characteristics of a pathological condition. For the purpose of the present invention, diagnosis is to determine whether a brain disease occurs due to damage to brain microvessels. The brain disease due to damage to the brain microvasculature is preferably mild cognitive impairment, mild traumatic brain injury (MTBI), transient ischemic attack, Lou Gehrig's disease dementia, Alzheimer's, Parkinson's, etc. may be However, the present invention is not limited thereto. In addition, the brain microvascular damage may be caused by opening or leakage of the blood-brain barrier.

본 발명에 있어서, ‘바이오 마커’란 뇌미세혈관 손상으로 인한 뇌 질환을 진단할 수 있는 물질, 즉 생물학적 시료에서 뇌미세혈관 손상으로 인한 뇌질환의 발생 여부를 구분하여 진단할 수 있는 물질로, 정상 개체와 뇌미세혈관 손상으로 인한 뇌질환 개체 간의 유의적인 차이를 보이는 폴리펩타이드, 핵산 (예:mRNA 등), 지질, 당지질, 당단백질, 당(단당류, 이당류, 올리고당류 등) 등과 같은 유기 생체 분자 등을 포함한다. 본 발명의 목적상 바이오 마커는 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자가 mild BBB 변성 마우스 모델에서 시간이 경과함에 따라 증가하는 바, Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 증가된 발현 정도가 뇌미세혈관 손상으로 인한 뇌 질환의 발병을 뒷받침한다. In the present invention, the term 'biomarker' refers to a substance capable of diagnosing a brain disease caused by damage to brain microvessels, that is, a substance capable of diagnosing by distinguishing whether or not a brain disease is caused by damage to brain microvascular in a biological sample, Organic organisms such as polypeptides, nucleic acids (eg mRNA, etc.), lipids, glycolipids, glycoproteins, sugars (monosaccharides, disaccharides, oligosaccharides, etc.) molecules and the like. For the purpose of the present invention, biomarkers are selected from the group consisting of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a, and Bst2 as time passes in a mild BBB degeneration mouse model. The increased expression level of any one or more genes selected from the group consisting of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2 is a brain disease caused by brain microvascular damage support the onset of

본 발명의 목적상 바이오 마커는 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자로, mild BBB 변성 동물모델에서 시간에 따라서 발현이 증가된 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 증가된 발현 정도가 뇌미세혈관의 손상으로 인한 뇌 질환의 발병을 뒷받침한다.For the purpose of the present invention, the biomarker is any one or more genes selected from the group consisting of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2, depending on the time in the mild BBB degeneration animal model. Increased expression of any one or more genes selected from the group consisting of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2 is a brain disease caused by damage to brain microvessels support the onset of

본 발명은 또한 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 mRNA 발현 또는 이의 단백질 활성 수준을 측정하는 제제를 포함하는 뇌미세혈관의 손상으로 인한 뇌 질환 진단용 조성물을 제공할 수 있다. The present invention also includes an agent for measuring the mRNA expression or protein activity level of any one or more genes selected from the group consisting of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2 It is possible to provide a composition for diagnosing brain diseases caused by damage to brain microvasculature.

본 발명의 일 실시예에 따르면, 본 발명의 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자는 건강한 정상인에 비하여 뇌미세혈관의 손상으로 인한 뇌 질환 모델에서 유의하게 증가하는 바, 이의 유전자 mRNA 발현 또는 이의 단백질 수준을 측정함으로써 퇴행성 뇌질환의 진단이 가능하다. According to an embodiment of the present invention, any one or more genes selected from the group consisting of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a, and Bst2 of the present invention are microscopically compared to healthy normal individuals. As it is significantly increased in a brain disease model due to damage to blood vessels, it is possible to diagnose degenerative brain disease by measuring its gene mRNA expression or its protein level.

본 발명에 있어서, Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 mRNA 발현 수준의 측정은 뇌미세혈관의 손상으로 인한 뇌 질환의 진단을 위하여 생물학적 시료에서 바이오 마커 유전자의 존재 여부와 발현 정도를 확인하는 과정으로, 표적 유전자부터 전사된 mRNA의 수준을 측정하는 방법에 사용되는 제제를 이용해 mRNA의 양을 측정한다. 구체적으로 본 발명에서 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 mRNA 수준을 측정하는 제제는 바람직하게는 안티센스 올리고뉴클레오티드, 프라이머 쌍 또는 프로브이며, Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 염기 서열이 유전자 은행에 등록되어 있으므로 당업자는 상기 서열을 바탕으로 이들 유전자의 특정 영역을 특이적으로 증폭하는 안티센스 올리고뉴클레오티드, 프라이머 쌍 또는 프로브를 디자인 할 수 있다. In the present invention, the measurement of the mRNA expression level of any one or more genes selected from the group consisting of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2 is measured due to damage to brain microvasculature. For the diagnosis of brain diseases, it is a process of checking the presence and expression level of a biomarker gene in a biological sample, and the amount of mRNA is measured using an agent used in a method for measuring the level of mRNA transcribed from a target gene. Specifically, in the present invention, the agent for measuring the mRNA level of any one or more genes selected from the group consisting of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2 is preferably an antisense oligonucleotide , a primer pair or a probe, and the nucleotide sequence of any one or more genes selected from the group consisting of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2 is registered in the gene bank, so those skilled in the art will Based on the above sequence, antisense oligonucleotides, primer pairs or probes that specifically amplify specific regions of these genes can be designed.

본 발명에 있어서, Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 단백질 활성 수준 측정은 뇌미세혈관의 손상으로 인한 뇌 질환의 진단을 위하여 생물학적 시료에서 바이오 마커 단백질의 존재 여부와 발현 정도를 확인하는 과정으로, 바람직하게는 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 단백질에 대하여 특이적으로 결합하는 항체를 이용해 단백질의 양을 확인할 수 있다. In the present invention, the protein activity level of any one or more genes selected from the group consisting of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2 is measured in the brain due to damage to brain microvasculature. A process of confirming the presence and expression level of a biomarker protein in a biological sample for diagnosis of a disease, preferably Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a, and Bst2 The amount of the protein can be confirmed using an antibody that specifically binds to the protein of any one or more genes selected from.

상기 항체는 당해 분야에서 공지된 용어로서 항원성 부위에 대해서 지시되는 특이적인 단백질 분자를 지칭하는 것으로, 본 발명의 목적상 항체는 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2에 특이적으로 결합하는 항체를 의미하며, 이러한 항체는 각 유전자를 통상적인 방법에 따라 발현벡터에 클로닝하여 상기 유전자에 의해 코딩되는 단백질을 얻고, 얻어진 단백질로부터 통상적인 방법에 의해 제조될 수 있다. 여기에는 상기 단백질에서 만들어 질 수 있는 부분 펩티드도 포함된다. 본 발명의 항체의 형태는 특별히 제한되지 않으며 폴리클로날 항체, 모노클로날 항체 또는 항원 결합성을 갖는 것이면 그것의 일부도 본 발명의 항체에 포함되고 모든 면역글로불린 항체가 포함된다. 나아가, 본 발명의 항체에는 인간화 항체 등의 특수항체도 포함된다. The antibody refers to a specific protein molecule directed against an antigenic site as a term known in the art. For the purposes of the present invention, the antibody is Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1 , refers to an antibody that specifically binds to Scgb3a or Bst2, and such an antibody is obtained by cloning each gene into an expression vector according to a conventional method to obtain a protein encoded by the gene, and from the obtained protein by a conventional method can be This includes partial peptides that can be made from the protein. The form of the antibody of the present invention is not particularly limited, and a part thereof is also included in the antibody of the present invention as long as it has polyclonal antibody, monoclonal antibody or antigen-binding property, and all immunoglobulin antibodies are included. Furthermore, the antibody of the present invention includes a special antibody such as a humanized antibody.

본 발명은 상기 서술한 조성물을 포함하는 뇌미세혈관의 손상으로 인한 뇌 질환 진단용 키트를 제공할 수 있다. The present invention can provide a kit for diagnosing brain diseases caused by damage to brain microvessels comprising the above-described composition.

본 발명의 키트에는 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2 유전자의 mRNA 발현 또는 이의 단백질 활성 수준을 측정하는 제제 외에, 분석방법에 적합한 한 종류 이상의 다른 구성성분 조성물, 용액 또는 장치가 포함될 수 있으며, 어떠한 형태로든 본 발명의 범위를 제한하지 않는다. Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a or Bst2 In the kit of the present invention, in addition to agents for measuring the mRNA expression or protein activity level thereof, one or more other components suitable for the analysis method Component compositions, solutions or devices may be included and are not intended to limit the scope of the present invention in any form.

구체적인 일례로서, 본 발명에서 상기 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2 유전자의 mRNA 발현 수준을 측정하기 위한 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. 상기 RT-PCR 키트는 마커 유전자에 대한 특이적인 프라이머 쌍 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액, 데옥시뉴클레오티드(우센), Taq-중합효소 및 역전사효소와 같은 효소, DNase, RNase 억제제, DEPC-물(DEPC-water), 멸균수 등을 포함할 수 있다. As a specific example, the kit for measuring the mRNA expression level of the Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a or Bst2 gene in the present invention is an essential element necessary for performing RT-PCR It may be a kit comprising a. The RT-PCR kit includes, in addition to a primer pair specific for a marker gene, a test tube or other suitable container, reaction buffer, deoxynucleotide (usen), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC- It may include water (DEPC-water), sterile water, and the like.

또한, 본 발명의 키트는 마이크로어레이 칩을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. 상기 마이크로어레이 칩 키트는, 유전자 또는 그의 단편에 해당하는 cDNA가 프로브로 부착되어 있는 기판을 포함하고 기판은 정량 대조구 유전자 또는 그의 단편에 해당하는 cDNA를 포함할 수 있으며, 본 발명의 마커를 이용 하여 당업계에서 통상적으로 사용되는 제조 방법에 의하여 용이하게 제조될 수 있다. 마이크로어레이 칩을 제작하기 위해서, 상기 탐색된 마커를 탐침 DNA 분자로 이용하여 DNA 칩의 기판상에 고정화시키기 위해 파이조일렉트릭(piezoelectric) 방식을 이용한 마이크로피펫팅(micropipetting)법 또는 핀(pin) 형태의 스폿터(spotter)를 이용한 방법 등을 사용하는 것이 바람직하나 이에 한정되는 것은 아니다. 상기 마이크로어레이 칩의 기판은 아미노-실란(amino-silane), 폴리-L-라이신(poly-Llysine) 및 알데히드(aldehyde)로 이루어진 군에서 선택되는 활성기가 코팅된 것이 바람직하나, 이에 한정되는 것은 아니다. 또한, 상기 기판은 슬라이드 글래스, 플라스틱, 금속, 실리콘, 나일론 막 및 니트로셀룰로스 막(nitrocellulose membrane)으로 이루어진 군에서 선택되는 것이 바람직하나 이에 한정되는 것은 아니다.In addition, the kit of the present invention may be a kit including essential elements necessary for performing a microarray chip. The microarray chip kit may include a substrate to which cDNA corresponding to a gene or fragment thereof is attached as a probe, and the substrate may include cDNA corresponding to a quantitative control gene or fragment thereof, using the marker of the present invention. It can be easily prepared by a manufacturing method commonly used in the art. In order to manufacture a microarray chip, a micropipetting method or a pin type using a piezoelectric method to immobilize the detected marker on a substrate of a DNA chip using the searched marker as a probe DNA molecule. It is preferable to use a method using a spotter of , but is not limited thereto. The substrate of the microarray chip is preferably coated with an active group selected from the group consisting of amino-silane, poly-L-lysine and aldehyde, but is not limited thereto. . In addition, the substrate is preferably selected from the group consisting of slide glass, plastic, metal, silicon, nylon membrane, and nitrocellulose membrane, but is not limited thereto.

또한, 본 발명에서 상기 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2 단백질 활성 수준을 측정하기 위한 키트는 항체의 면역학적 검출을 위하여 기질, 적당한 완충 용액, 발색 효소 또는 형광 물질로 표지된 2차 항체, 및 발색 기질 등을 포함할 수 있다. 상기에서 기질은 니트로셀룰로오스 막, 폴리비닐 수지로 합성된 96 웰 플레이트, 폴리스틸렌 수지로 합성된 96 웰 플레이트 및 유리로 된 슬라이드 글라스 등이 이용될 수 있고, 발색효소는 퍼옥시다아제(peroxidase), 알칼라인 포스파타아제(alkaline phosphatase) 등이 사용될 수 있고, 형광물질은 FITC, RITC등이 사용될 수 있고, 발색 기질액은 ABTS(2,2'-아지노-비스-(3-에틸벤조티아졸린-6-설폰산)) 또는 OPD(o-페닐렌디아민), TMB(테트라메틸 벤지딘)가 사용될 수 있으나, 이에 한정되는 것은 아니다.In addition, in the present invention, the kit for measuring the Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a or Bst2 protein activity level is a substrate, a suitable buffer solution, and color development for immunological detection of the antibody. It may include a secondary antibody labeled with an enzyme or a fluorescent substance, and a chromogenic substrate. In the above, as the substrate, a nitrocellulose membrane, a 96-well plate synthesized from polyvinyl resin, a 96-well plate synthesized from a polystyrene resin, and a glass slide glass may be used, and the chromogenic enzyme is peroxidase, alkaline phosphorus Alkaline phosphatase, etc. may be used, the fluorescent material may be FITC, RITC, etc., and the color-developing substrate solution is ABTS (2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonate). phonic acid)) or OPD (o-phenylenediamine), or TMB (tetramethyl benzidine), but is not limited thereto.

본 발명은 또한 생물학적 시료로부터 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자의 mRNA 발현 또는 이의 단백질 활성 수준을 측정하는 단계;를 포함하는 뇌미세혈관의 손상으로 인한 뇌 질환 진단을 위한 정보제공방법을 제공할 수 있다. The present invention also comprises the steps of measuring the mRNA expression or protein activity level of any one or more genes selected from the group consisting of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2 from a biological sample It is possible to provide an information providing method for diagnosing brain diseases caused by damage to brain microvessels, including.

본 발명의 일 실시예에 따르면, 집속초음파 조사에 따른 BBB 개통후 시간에 따른 생물학적 반응을 확인하기 위해서 시간에 따라 (1시간, 6시간, 12시간, 24시간, 48시간) mild BBB 변성 뇌조직을 획득한 후, RNA sequencing 분석 결과를 통해 시간에 따른 유전자 발현 변화를 control 그룹과 비교하였을 때, 48시간 째 약 518개의 유전자가 증가되었고 174개의 유전자가 감소되는 경향을 나태었고, 518개의 유전자중 Control 대비 3배 이상 증가되고 혈액에서 검출할 수 있는 soluble form의 단백질을 coding 하고 있는 10개(Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2)의 유전자를 선정한 바, 생물학적 시료에서 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2의 발현 비교 분석을 통해 뇌미세혈관의 손상으로 인한 뇌 질환의 진단을 위한 정보를 제공할 수 있다. According to an embodiment of the present invention, according to time (1 hour, 6 hours, 12 hours, 24 hours, 48 hours) mild BBB degeneration brain tissue to confirm the biological response according to the time after opening the BBB according to the focused ultrasound irradiation After obtaining , when comparing the change in gene expression over time with the control group through RNA sequencing analysis, at 48 hours, about 518 genes increased and 174 genes showed a tendency to decrease, and out of 518 genes, 10 genes (Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a or Bst2) that are increased more than 3 times compared to the control and are coding for proteins in soluble form that can be detected in blood were selected Bar, through comparative analysis of the expression of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a or Bst2 in a biological sample, it is possible to provide information for the diagnosis of brain diseases caused by damage to brain microvessels. have.

본 발명에 있어서, 진단을 위한 정보제공방법은 진단을 위한 예비적 단계로써 뇌미세혈관의 손상으로 인한 뇌 질환의 진단을 위하여 필요한 객관적인 기초정보를 제공하는 것이며 의사의 임상학적 판단 또는 소견은 제외된다. In the present invention, the information providing method for diagnosis provides objective basic information necessary for the diagnosis of brain diseases caused by damage to brain microvessels as a preliminary step for diagnosis, and the clinical judgment or opinion of the doctor is excluded. .

본 발명에 있어서, '생물학적 시료'란 개체로부터 분리되어 목적 유전자 또는 단백질의 발현 수준을 측정하는 직접적인 대상을 의미하고, 조직, 세포, 전혈, 혈청, 혈장, 타액 또는 뇨와 같은 시료 등을 포함한다. 예를 들어, 본 발명의 시료란 뇌미세혈관의 손상으로 인한 뇌 질환 의심 개체에서 뇌 질환의 발병 여부를 진단하기 위한 시료로서, 바람직하게는 혈액일 수 있다. In the present invention, the term 'biological sample' refers to a direct target that is separated from an individual and measures the expression level of a target gene or protein, and includes samples such as tissues, cells, whole blood, serum, plasma, saliva or urine. . For example, the sample of the present invention is a sample for diagnosing whether a brain disease occurs in an individual suspected of having a brain disease due to damage to brain microvasculature, and may preferably be blood.

본 발명에 있어서, 'mRNA 발현 수준을 측정하기 위한 분석 방법'에는 중합효소반응(PCR), 역전사 중합효소반응 (RT-PCR), 경쟁적 역전사 중합효소반응(Competitive RT-PCR), 실시간 역전사 중합효소반응(Realtime RT-PCR), RNase 보호분석법(RPA; RNase protection assay), 노던 블랏팅(northern blotting), 또는 DNA 마이크로어레이 분석법 등이 있으나, 이에 제한되지 않는다.In the present invention, 'analysis method for measuring mRNA expression level' includes polymerase reaction (PCR), reverse transcription polymerase reaction (RT-PCR), competitive reverse transcription polymerase reaction (Competitive RT-PCR), real-time reverse transcription polymerase reaction (Realtime RT-PCR), RNase protection assay (RPA), Northern blotting, or DNA microarray assay, but is not limited thereto.

본 발명에 있어서, '단백질 활성 수준을 측정하기 위한 분석 방법'에는 웨스턴 블랏팅(western blotting), ELISA(enzyme linked immunosorbent assay), 방사선면역분석법(Radioimmunoassay), 방사면역 확산법 (Radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역 확산법, 로케트(Rocket) 면역전기영동, 조직면역염색, 면역 침전분석법(immunoprecipitation assay), 보체 고정 분석법(complete fixation assay), 유세포분석법 (Fluorescence Activated Cell Sorter, FACS) 또는 단백질 칩(protein chip) 분석법 등이 있으나, 이에 제한되지 않는다. In the present invention, the 'analysis method for measuring the level of protein activity' includes western blotting, ELISA (enzyme linked immunosorbent assay), radioimmunoassay, radioimmunoassay, radioimmunodiffusion, octero Ouchterlony immunodiffusion method, Rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complete fixation assay, Fluorescence Activated Cell Sorter (FACS) or protein chip ( protein chip) analysis method, but is not limited thereto.

본 발명의 방법은 상기 측정된 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2 유전자의 mRNA 발현 또는 이의 단백질 활성 수준을 대조군에서 측정된 수준과 비교하는 단계를 포함할 수 있다. 상기 대조군은 뇌미세혈관의 손상으로 인한 뇌 질환이 발명하지 않은 건강한 사람이다. 이에 따라 본 발명의 방법은 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2 유전자의 mRNA 발현 또는 이의 단백질 활성 수준이 대조군 보다 높을 경우, 뇌미세혈관의 손상으로 인한 뇌 질환이 진행 중이거나 이미 발병하였을 것으로 판단 할 수 있다. The method of the present invention comprises the step of comparing the measured mRNA expression or protein activity level of the Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a or Bst2 gene or its protein activity level with the level measured in the control group. can do. The control group is a healthy person who does not have brain disease caused by damage to brain microvasculature. Accordingly, in the method of the present invention, when the mRNA expression of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a or Bst2 gene or its protein activity level is higher than that of the control group, It can be determined that a brain disease is in progress or has already occurred.

(a) 생물학적 샘플에 임의의 화합물을 처리하는 단계; (b) 상기 생물학적 샘플로부터 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 및 Bst2로 이루어진 군으로부터 선택되는 어느 하나 이상의 유전자 또는 이의 단백질의 발현 수준 또는 활성 수준을 확인하는 단계; 및 (c) 상기 발현 수준을 임의의 화합물을 처리하지 않은 정상대조군에서의 상기 유전자 또는 이의 발현 단백질의 수준과 또는 활성 수준을 비교하는 단계; 를 포함하는 뇌미세혈관의 손상으로 인한 뇌 질환의 예방 또는 치료용 약학적 조성물을 스크리닝 하는 방법을 제공할 수 있다. (a) treating the biological sample with any compound; (b) Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a and Bst2 from the biological sample any one or more genes selected from the group consisting of or the expression level or activity level of a protein thereof to confirm step; and (c) comparing the expression level with the level of or activity level of the gene or expression protein thereof in a normal control group not treated with any compound; It is possible to provide a method of screening a pharmaceutical composition for preventing or treating brain diseases caused by damage to brain microvessels comprising a.

본 발명에 있어서, 스크리닝은 뇌미세혈관의 손상으로 인한 뇌 질환의 치료 효과를 가지는 물질을 선별하는 조작에 관한 것이다. In the present invention, screening relates to an operation for selecting a substance having a therapeutic effect on a brain disease caused by damage to brain microvasculature.

본 발명에 있어서, 상기 (a) 단계의 후보물질은 뇌 질환의 치료 활성을 테스트할 물질을 의미하며, 예컨대 추출물, 단백질, 올리고펩티드, 소형 유기 분자, 다당류, 폴리뉴클레오티드 및 광범위한 화합물 들의 임의 분자를 포함할 수 있다. 이러한 후보 물질은 천연물질뿐 아니라, 합성 물질도 포함한다. In the present invention, the candidate substance in step (a) refers to a substance to be tested for therapeutic activity of a brain disease, for example, extracts, proteins, oligopeptides, small organic molecules, polysaccharides, polynucleotides, and arbitrary molecules of a wide range of compounds. may include Such candidate substances include not only natural substances, but also synthetic substances.

본 발명에 있어서, 상기 (b) 단계의 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2 유전자의 mRNA 발현 또는 이의 단백질 활성 수준을 측정하는 단계는 시료에서 후보물질 처리에 의한 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2을 암호화하는 핵산 또는 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2 단백질의 존재 여부와 발현 정도를 확인하는 과정이다. In the present invention, the step of measuring the mRNA expression or protein activity level of the Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a or Bst2 gene in step (b) or its protein activity level is a candidate substance in the sample Nucleic acids encoding Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a or Bst2 by treatment or Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a or Bst2 It is the process of confirming the existence and expression level of a protein.

본 발명의 스크리닝 방법은 (c) 상기 (b) 단계에서 측정한 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2 유전자의 mRNA 또는 이의 단백질의 활성이 상기 후보물질을 처리하지 않은 대조군의 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2 유전자의 mRNA 발현 또는 이의 단백질의 활성보다 낮은 경우, 후보물질을 뇌 질환의 치료제로 판단하는 단계를 추가로 더 포함할 수 있다. 다시 말해, 후보물질의 처리에 의해 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2 유전자의 mRNA 발현 또는 이의 단백질의 활성이 후보물질 비처리군의 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2의 mRNA 발현 또는 이의 단백질의 활성보다 낮아지는 경우 상기 후보물질을 뇌 질환 치료제로 판단할 수 있고, 그와 반대로 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2 유전자의 mRNA 발현 또는 이의 단백질의 활성이 후보물질 비처리군의 Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a 또는 Bst2 유전자의 mRNA 발현 또는 이의 단백질 활성량과 비슷하거나 보다 높아지는 경우 뇌미세혈관의 손상으로 인한 뇌 질환 치료제로 사용할 수 없다 판단 할 수 있다. The screening method of the present invention (c) the Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a or Bst2 gene mRNA or protein activity measured in step (b) is the candidate substance Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a, or Bst2 gene mRNA expression or protein activity of the control untreated. It may further include a step further. In other words, the mRNA expression of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a or Bst2 genes or the protein activity of the Lcn2, SPP1, Saa3, Ptx3, A2m, Lcn2, SPP1, Lcn2, SPP1, When the mRNA expression of Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a or Bst2 or the protein activity thereof is lower than that of Saa3, Ptx3, A2m, Lrg1, SPP1, Saa3 , Ptx3, A2m, Lrg1, Klk 6, clcf 1, Scgb3a or Bst2 gene mRNA expression or protein activity of Lcn2, SPP1, Saa3, Ptx3, A2m, Lrg1, Klk 6, clcf 1, If the mRNA expression of Scgb3a or Bst2 gene or its protein activity level is similar to or higher than that of its protein, it can be determined that it cannot be used as a treatment for brain diseases caused by damage to brain microvessels.

(a) 마우스에 집속 초음파를 0.25 내지 0.27 MPa로 10초 내지 230초 동안 처리는 단계를 포함하는 optimal BBB 변성 마우스 모델을 제작하는 방법을 제공할 수 있다. (a) It can provide a method for producing an optimal BBB degeneration mouse model comprising the step of treating a mouse with focused ultrasound at 0.25 to 0.27 MPa for 10 seconds to 230 seconds.

본 발명은 (a) 마우스에 집속 초음파 0.42 내지 0.44 MPa로 10초 내지 230초 동안 처리하는 단계를 포함하는 mild BBB 변성 마우스 모델을 제작하는 방법을 제공할 수 있다. The present invention can provide a method for producing a mild BBB degeneration mouse model comprising the step of (a) treating the mouse with 0.42 to 0.44 MPa of focused ultrasound for 10 seconds to 230 seconds.

중복되는 내용은 본 명세서의 복잡성을 고려하여 생락하며, 본 명세서에서 달리 정의되지 않은 용어들은 본 발명이 속하는 분야에서 통상적으로 사용되는 의미를 갖는 것이다.Redundant content is omitted in consideration of the complexity of the present specification, and terms not defined otherwise in the present specification have the meanings commonly used in the field to which the present invention belongs.

이하, 실시예를 통하여 본 발명을 보다 상세하게 설명한다. 그러나 하기 실시 예는 본 발명의 내용을 구체화하기 위한 것일 뿐 이에 의해 본 발명이 한정되는 것은 아니다. Hereinafter, the present invention will be described in more detail through examples. However, the following examples are only intended to embody the contents of the present invention, and the present invention is not limited thereto.

[실시예 1][Example 1]

BBB변성 모델의 제작 Production of the BBB degeneration model

만성 퇴행성 뇌질환은 대부분의 경우 BBB의 손상으로 인해 그 결합이 느슨해져 있다. 이에 본 연구진들은 집속 초음파를 이용하여 BBB의 개통 유도하였다. 뇌질환의 BBB 변성 정도를 조절하여, 퇴행성 뇌질환 모델의 초기 BBB 손상 정도의 동물 모델과 퇴행성 뇌질환 모델의 중기 BBB 손상 정도의 동물 모델을 제작하였다. 8주령의 ICR mice를 이용하여 집속 초음파 유도 BBB 개통 동물 모델을 제작하였다. MRgFUS 기기를 이용한 초음파 처리는 FUS 기기(RK-100)를 사용하였으며, 도 1에 기기 구성의 개략도가 나타나 있다. MR 영상유도 집중초음파 시스템은 도1에 개략도가 나타나 있다. 시스템은 초음파 컨트롤 시스템과 초음파 조사 시스템 (MR 환경 호환)으로 이루어져 있다. 구체적으로 초음파 컨트롤 시스템은 초음파 변환기에 RF 파워를 전달할 수 있는 fuction generator와 RF amplifier로 이루어져 있으며 초음파 변환기에 전달되는 power를 실시간으로 측정할 수 있는 power meter로 구성되어 있다. 초음파 조사 시스템은 초음파 변환기, 초음파 변환기를 3차원으로 정밀 제어 할 수 있는 3축 제어부, water tank로 구성되어 MRI 장비 환경 내에서도 구동가능하게 설계되어 있다. MR 영상유도 집중초음파 시스템은 Bruker 9.4T MRI (BioSpec 94/20 USR - 9.4T, Bruker, MA, USA) 시스템과 연동되어 있다. 구체적인 실험 프로토콜은 초음파 영상 진단용 조영제인 미소기포(DEFINITY®를 생리식염수에 1:50의 비율로 희석하여 0.012ml/s의 속도로 동물의 정맥에 주입한다. 희석된 미소기포를 주입하는 동안 1s에 10ms의 burst length를 가지는 집속 초음파를 MR영상 기반으로 원하는 뇌 지역에 2분간 조사하였다. MR 영상을 통해 MR 조영제 주입 전과 주입 후 영상을 비교하여 BBB 개폐를 확인할 수 있다. 뇌질환의 BBB 변성 정도에 따른 바이오 마커를 발굴하기 위해 optimal damage (0.25~0.27 MPa) 조건과 mild damage BBBD (0.42-0.44 MPa)조건의 초음파 에너지를 ICR mice의 뇌의 thalmus 부위에 조사하여 BBB 변성을 유도하였다. 초음파 조사조건은 중심주파수 1.1 MHz를 이용하여 RFP는 1Hz, 120초동안 조사하였다 (도 1). optimal damage (0.25~0.27 MPa) 조건과 mild damage BBBD (0.42-0.44 MPa)조건의 마우스의 MR영상을 확인하였다 (도 2). MR image는 BBB 개통후 조영제를 투여하고, 시간에 따른 enhancement 정도를 확인하였으며, 관상면(coronal), 축상면(axial) 그리고 시상면 (sagittal) 방향으로 이미지를 획득하였다. MR 조영제 투과정도에 따른 intensity 측정을 통해 optimal(~50%) 및 mild (~100%) BBB 조건으로 실험을 진행하였다. 집속초음파 조사에 따른 BBB 개통후 시간에 따른 생물학적 반응을 확인하기 위해서 시간에 따라 (1시간, 6시간, 12시간, 24시간, 48시간) BBB 변성 뇌조직을 획득하였으며, 각 그룹의 mouse에서 혈액을 약 1ml 채취하여 혈청을 분리하였다. In chronic degenerative brain disease, in most cases, the binding is loose due to damage to the BBB. Therefore, we induced the opening of the BBB using focused ultrasound. By controlling the degree of BBB degeneration of brain disease, an animal model of the initial BBB damage level of the degenerative brain disease model and an animal model of the intermediate BBB damage level of the degenerative brain disease model were prepared. A focused ultrasound-guided BBB patency animal model was prepared using 8-week-old ICR mice. Ultrasonic treatment using an MRgFUS device was performed using a FUS device (RK-100), and a schematic diagram of the device configuration is shown in FIG. 1 . A schematic diagram of the MR image-guided focused ultrasound system is shown in FIG. 1 . The system consists of an ultrasonic control system and an ultrasonic irradiation system (MR environment compatible). Specifically, the ultrasonic control system consists of a fuction generator and RF amplifier that can deliver RF power to the ultrasonic transducer, and a power meter that can measure the power delivered to the ultrasonic transducer in real time. The ultrasonic irradiation system consists of an ultrasonic transducer, a three-axis control unit that can precisely control the ultrasonic transducer in three dimensions, and a water tank, and is designed to be driven in an MRI equipment environment. The MR image-guided focused ultrasound system is linked with the Bruker 9.4T MRI (BioSpec 94/20 USR - 9.4T, Bruker, MA, USA) system. The specific experimental protocol is to dilute DEFINITY®, a contrast medium for ultrasound imaging, in physiological saline at a ratio of 1:50 and inject it into the vein of the animal at a rate of 0.012ml/s. Focused ultrasound with a burst length of 10 ms was irradiated to the desired brain region based on MR image for 2 minutes.BBB opening and closing can be confirmed by comparing images before and after injection of MR contrast medium. In order to discover biomarkers according to the following conditions, BBB degeneration was induced by irradiating ultrasound energy under optimal damage (0.25~0.27 MPa) and mild damage BBBD (0.42-0.44 MPa) conditions to the thalmus of the brain of ICR mice. RFP was irradiated for 120 seconds at 1 Hz using a center frequency of 1.1 MHz (Fig. 1). MR images of mice under optimal damage (0.25-0.27 MPa) and mild damage BBBD (0.42-0.44 MPa) conditions were confirmed. (Fig. 2).For the MR image, the contrast medium was administered after opening the BBB, the degree of enhancement was confirmed over time, and images were acquired in the coronal, axial, and sagittal directions. Experiments were conducted under optimal (~50%) and mild (~100%) BBB conditions through intensity measurement according to the degree of penetration of the contrast medium. (1 hour, 6 hours, 12 hours, 24 hours, 48 hours) BBB-denatured brain tissue was obtained, and about 1 ml of blood was collected from mice of each group to separate the serum.

[실시예 2][Example 2]

Transcriptome analysis (전사체 분석)Transcriptome analysis

실시예 1의 방법으로 제작된 optimal damage BBB 동물 모델 및 mild damage BBB 동물모델에 집속 초음파를 조사한 뇌 부분의 조직을 액체 질소에 급속 냉동시킨 후, RNA isolation kit (Qiagen)를 이용하여 RNA를 분리하였다. 총 RNA를 Dnase를 처리하여 DNA 오염을 방지하고, library 제작을 위해 random fragmentation을 제작하였다. RNA fragment를 역전사 효소로 반응시켜 cDNA를 제작하고 만들어 cDNA 양쪽 끝에 adpator를 붙여 sequencing을 수행하였다. sequencing을 통해 얻어진 raw data의 quality를 분석하고 각 샘플의 transcript quantification을 통해 발현량을 FPKM(Fragments per kilobase of transcript per milion mapped reads)값으로 추출하였다 (도 3). 퇴행성 뇌질환의 초기단계로 예상할 수 있는 optimal BBBD 조건에서 RNA sequencing 분석을 통해 시간에 따른 유전자의 발현 변화를 control과 비교하였을 때, 약 20,000개의 유전자중 BBBD에 의해 증가 또는 감소되는 유전자의 발현차이가 약 30개에서 70개 정도로 control과 크게 차이가 없음을 확인 하였다. BBB의 손상이 중반 정도로 예상할 수 있는 mild damage BBBD 조건에서 RNA sequencing 분석 결과를 통해 시간에 따른 유전자 발현 변화를 control 그룹과 비교하였을 때, 48시간 째 약 518개의 유전자가 증가되었고 174개의 유전자가 감소되는 경향을 나타내었다 (도 3). 상기의 결과를 바탕으로 mild damage BBBD 조건에서의 혈액이나 뇌 조직 바이오 마커 후보군을 선정하였다. 518개의 유전자중 Control 대비 3배 이상 증가되고 혈액에서 검출할 수 있는 soluble form의 단백질을 coding 하고 있는 10개의 유전자를 선정하여 후보군으로 선정하였다 (도 4). After rapidly freezing the tissue of the brain part irradiated with focused ultrasound in the optimal damage BBB animal model and mild damage BBB animal model prepared by the method of Example 1 in liquid nitrogen, RNA was isolated using an RNA isolation kit (Qiagen). . Total RNA was treated with Dnase to prevent DNA contamination, and random fragmentation was prepared for library production. The RNA fragment was reacted with reverse transcriptase to produce cDNA, and adpators were attached to both ends of the cDNA to perform sequencing. The quality of raw data obtained through sequencing was analyzed, and the expression level of each sample was extracted as FPKM (Fragments per kilobase of transcript per milion mapped reads) value through transcript quantification of each sample (FIG. 3). When comparing the time-dependent gene expression change with control through RNA sequencing analysis under optimal BBBD conditions, which can be expected as an early stage of degenerative brain disease, the difference in expression of genes increased or decreased by BBBD among about 20,000 genes It was confirmed that there was no significant difference from the control with about 30 to 70 numbers. When the change in gene expression over time was compared with the control group through RNA sequencing analysis under mild damage BBBD condition, where damage to the BBB can be expected to be moderate, about 518 genes increased and 174 genes decreased at 48 hours. showed a tendency to become (FIG. 3). Based on the above results, blood or brain tissue biomarker candidates in mild damage BBBD conditions were selected. Among the 518 genes, 10 genes encoding a protein in a soluble form that is increased more than 3 times compared to Control and that can be detected in blood were selected and selected as a candidate group (FIG. 4).

[실시예 3][Example 3]

유전체 분석 결과와 유전자 발현량의 상관관계 검증Verification of correlation between genome analysis results and gene expression levels

상기 실시예３의 후보 유전자의 sequencing 결과가 유의한지 확인하기 위해 real time PCR실험기법으로 후보군유전자 발현을 확인하여 상관관계를 확인하였다. 실시예 1의 방법으로 제작된 optimal damage BBB 동물 모델 및 mild damage BBB 동물모델에 집속 초음파를 조사한 뇌 부분의 조직을 액체 질소에 급속 냉동시킨 후, Quiagne RNA isolation kit (Quiagen)를 이용하여 RNA를 분리하였다. 총 RNA를 Dnase를 처리하여 DNA 오염을 방지하고, library 제작을 위해 random fragmentation을 제작하였다. RNA fragment를 역전사 효소로 반응시켜 cDNA를 제작하였다. SYBR®그린 마스터 PCR 믹스 10 μL, 포워드 및 리버스 프라이머 각 5 pmol, 희석된 cDNA 주형 1 μL 및 적절한 양의 멸균 증류수를 함유한 20 μL 반응물 부피에서 SYBR®그린 리얼-타임 PCR 키트를 사용하여 qRT-PCR을 수행했다. 유전자 증폭 조건은 다음과 같았다. 3 분 간 95 ℃에서 초기 변성; 15 초간 95 ℃에서 변성, 60 초간 60 ℃에서 아닐링 및 60 초간 72 ℃에서 신장 40 사이클; 및 5 분간 72 ℃에서 마지막 신장하였다. ABI 스텝 원 플러스 리얼-타임 PCR 시스템에서 qRT-PCR을 수행했다. 모든 정량은 내부 표준으로 U6과 함께 수행되었다. PCR 프라이머 서열은 하기 표 1과 같다. 그 결과 시간에 따른 유전자의 sequencing결과와 qRT-PCR결과가 유사하다는 것을 확인하였다 (도 4). In order to confirm that the sequencing result of the candidate gene of Example 3 is significant, the expression of the candidate group gene was confirmed by real-time PCR experimental technique to confirm the correlation. After rapidly freezing the tissue of the brain part irradiated with focused ultrasound in the optimal damage BBB animal model and mild damage BBB animal model prepared by the method of Example 1 in liquid nitrogen, RNA is isolated using the Quiagne RNA isolation kit (Quiagen) did Total RNA was treated with Dnase to prevent DNA contamination, and random fragmentation was prepared for library production. RNA fragment was reacted with reverse transcriptase to prepare cDNA. qRT- using SYBR® Green Real-Time PCR Kit in a 20 µL reaction volume containing 10 µL of SYBR® Green Master PCR Mix, 5 pmol each of forward and reverse primers, 1 µL of diluted cDNA template, and an appropriate amount of sterile distilled water. PCR was performed. Gene amplification conditions were as follows. Initial denaturation at 95 °C for 3 min; 40 cycles of denaturation at 95 °C for 15 sec, annealing at 60 °C for 60 sec and elongation at 72 °C for 60 sec; and final extension at 72° C. for 5 minutes. qRT-PCR was performed on the ABI Step One Plus real-time PCR system. All quantifications were performed with U6 as an internal standard. PCR primer sequences are shown in Table 1 below. As a result, it was confirmed that the gene sequencing results and qRT-PCR results according to time were similar (FIG. 4).

GeneGene Sequcne sequence Sequence number sequence number LCN2LCN2 tggaagaaccaaggagctgttggaagaaccaaggagctgt 서열번호 1SEQ ID NO: 1 cacactcaccacccattcagcacactcaccacccattcag 서열번호 2 SEQ ID NO: 2 SPP1SPP1 tctgatgagaccgtcactgctctgatgagaccgtcactgc 서열번호 3SEQ ID NO: 3 cctcagtccataagccaagccctcagtccataagccaagc 서열번호 4SEQ ID NO: 4 Cfcl1Cfcl1 aacttggaagtgtggcgaagaacttggaagtgtggcgaag 서열번호 5SEQ ID NO: 5 tacgtcggagttcagctgtgtacgtcggagttcagctgtg 서열번호 6SEQ ID NO: 6 Scgb3a1Scgb3a1 tctgtgtggctctgctcagt tctgtgtggctctgctcagt 서열번호 7SEQ ID NO: 7 ggccaagtggcttaatggtaggccaagtggcttaatggta 서열번호 8SEQ ID NO: 8 Klk6Klk6 tgtgctgatgtccatctggttgtgctgatgtccatctggt 서열번호 9SEQ ID NO: 9 gacctccagaatcaccctgagacctccagaatcaccctga 서열번호 10SEQ ID NO: 10 Ptx3ptx3 atttgggtcaaagccacagaatttgggtcaaagccacaga 서열번호 11SEQ ID NO: 11 cagccagcttgttctcctttcagccagcttgttctccttt 서열번호 12SEQ ID NO: 12

[실시예 4][Example 4]

ELISAELISA

집속초음파를 이용한 BBB 개통을 유도한 동물모델을 시간에 따라 sacrifice하고, 하대정맥에서 혈액을 약 1ml 정도 취하여, 상온에서 약 30분 혈액을 응고시킨 후, 6000rpm에서 30분간 원심 분리하여 상층액만을 분리하여 serum을 획득하였다. LCN2 ELISA kit (BosterBio社)와 KLK6 (LS bio社)를 이용하여 실험을 수행하기 위해서 serum을 50배와 10배로 blocking buffer에 희석 한 후에 ELISA plate에 100 ul씩 분주하였다. 상온에서 2시간동안 incubation후에 wash buffer로 5분씩 세 번 세척하였다. Biotin이 labelling되어 있는 antibody solution을 100ul씩 분주하고 37 ℃, 1시간동안 incubation하고, wash buffer로 5분씩 3번 세척하였다. ABC solution을 100ul씩 분주하고 37 ℃에서 30분 동안 incubation하고 wash buffer로 세척 후에 TMB substrate solution 90ul를 첨가하여 37 ℃에서 30분 동안 incubation후에 100ul의 stop solution을 첨가하고 plate reader (Tecan 社)를 이용하여 450nm 파장에서 흡광도를 측정하여 결과를 분석하였다. KlK6의 혈액에서의 발현은 optimal condition과 mild damaged condition에서 BBB 개통후 시간이 지남에 따라 점차 증가됨을 확인할 수 있었다. 또한 LCN2의 혈액내 발현이 optimal condition BBB 개통 후 12시간까지 증가되다가 다시 감소됨을 확인하였다. 이를 통해 뇌미세혈관 손상에 의한 혈액 바이오 마커 발굴 가능성을 확인하였다.The animal model inducing BBB patency using focused ultrasound was sacrificed over time, about 1 ml of blood was taken from the inferior vena cava, and the blood was coagulated for about 30 minutes at room temperature, and then centrifuged at 6000 rpm for 30 minutes to separate only the supernatant. Thus, serum was obtained. To carry out the experiment using the LCN2 ELISA kit (BosterBio) and KLK6 (LS bio), serum was diluted 50-fold and 10-fold in blocking buffer, and then 100 μl each was dispensed into an ELISA plate. After incubation at room temperature for 2 hours, they were washed three times for 5 minutes each with wash buffer. 100ul of biotin-labeled antibody solution was dispensed, incubated at 37°C for 1 hour, and washed 3 times for 5 minutes each with wash buffer. Dispense 100ul of ABC solution, incubate at 37℃ for 30 minutes, wash with wash buffer, add 90ul of TMB substrate solution, incubate at 37℃ for 30 minutes, add 100ul of stop solution, and use a plate reader (Tecan) The absorbance was measured at a wavelength of 450 nm and the results were analyzed. It was confirmed that the expression of KlK6 in blood gradually increased with time after opening of the BBB under optimal and mild damaged conditions. In addition, it was confirmed that the blood expression of LCN2 increased up to 12 hours after opening the optimal condition BBB and then decreased again. Through this, the possibility of discovering blood biomarkers due to brain microvascular damage was confirmed.

<110> Daegu-Gyeongbuk Medical Innovation Foundation <120> Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration <130> 1069203 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LCN2_forward <400> 1 tggaagaacc aaggagctgt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LCN2_reverse <400> 2 cacactcacc acccattcag 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SPP1_forward <400> 3 tctgatgaga ccgtcactgc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SPP1_reverse <400> 4 cctcagtcca taagccaagc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cfcl1-forward <400> 5 aacttggaag tgtggcgaag 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cfcl1_reverse <400> 6 tacgtcggag ttcagctgtg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Scgb3a1_forward <400> 7 tctgtgtggc tctgctcagt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Scgb3a1_reverse <400> 8 ggccaagtgg cttaatggta 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Klk6_forward <400> 9 tgtgctgatg tccatctggt 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Klk6_reverse <400> 10 gacctccaga atcaccctga 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ptx3_forward <400> 11 atttgggtca aagccacaga 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ptx3_reverse <400> 12 cagccagctt gttctccttt 20 <110> Daegu-Gyeongbuk Medical Innovation Foundation <120> Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration <130> 1069203 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LCN2_forward <400> 1 tggaagaacc aaggagctgt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LCN2_reverse <400> 2 cacactcacc acccattcag 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SPP1_forward <400> 3 tctgatgaga ccgtcactgc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SPP1_reverse <400> 4 cctcagtcca taagccaagc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cfcl1-forward <400> 5 aacttggaag tgtggcgaag 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cfcl1_reverse <400> 6 tacgtcggag ttcagctgtg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Scgb3a1_forward <400> 7 tctgtgtggc tctgctcagt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Scgb3a1_reverse <400> 8 ggccaagtgg cttaatggta 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Klk6_forward <400> 9 tgtgctgatg tccatctggt 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Klk6_reverse <400> 10 gacctccaga atcaccctga 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ptx3_forward <400> 11 atttgggtca aagccacaga 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ptx3_reverse <400> 12 cagccagctt gttctccttt 20

Claims (4)

혈액 내 Lcn2 (Lipocalin 2) 유전자의 mRNA 발현 또는 이의 단백질 활성 수준을 측정하는 제제를 포함하는, 혈뇌장벽의 변성으로 인한 경도외상성뇌질환의 진단을 위한 바이오 마커 검출용 조성물.A composition for detecting biomarkers for diagnosing mild traumatic brain disease due to degeneration of the blood-brain barrier, comprising an agent for measuring mRNA expression or protein activity level of Lcn2 (Lipocalin 2) gene in blood. 제 1항에 있어서, 상기 제제는 Lcn2 (Lipocalin 2) 유전자에 특이적으로 결합하는 프라이머 또는 프로브인, 바이오 마커 검출용 조성물.The composition for detecting biomarkers according to claim 1, wherein the agent is a primer or probe that specifically binds to the Lcn2 (Lipocalin 2) gene. 제 1항에 있어서, 상기 제제는 Lcn2 (Lipocalin 2) 유전자의 단백질에 특이적으로 결합하는 항체인, 바이오 마커 검출용 조성물.The composition for detecting biomarkers according to claim 1, wherein the agent is an antibody that specifically binds to a protein of the Lcn2 (Lipocalin 2) gene. 제 1항 내지 제 3항 중 어느 한 항의 조성물을 포함하는, 혈뇌장벽의 변성으로 인한 경도외상성뇌질환의 진단용 키트.A kit for diagnosis of mild traumatic brain disease due to degeneration of the blood-brain barrier, comprising the composition of any one of claims 1 to 3.
KR1020210060347A 2019-12-16 2021-05-10 Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration KR102347836B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020210060347A KR102347836B1 (en) 2019-12-16 2021-05-10 Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020190168272A KR20210000253A (en) 2019-12-16 2019-12-16 Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration
KR1020210060347A KR102347836B1 (en) 2019-12-16 2021-05-10 Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
KR1020190168272A Division KR20210000253A (en) 2019-06-24 2019-12-16 Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration

Publications (2)

Publication Number Publication Date
KR20210056314A KR20210056314A (en) 2021-05-18
KR102347836B1 true KR102347836B1 (en) 2022-01-05

Family

ID=74130467

Family Applications (2)

Application Number Title Priority Date Filing Date
KR1020190168272A KR20210000253A (en) 2019-06-24 2019-12-16 Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration
KR1020210060347A KR102347836B1 (en) 2019-12-16 2021-05-10 Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration

Family Applications Before (1)

Application Number Title Priority Date Filing Date
KR1020190168272A KR20210000253A (en) 2019-06-24 2019-12-16 Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration

Country Status (1)

Country Link
KR (2) KR20210000253A (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2002541770A (en) 1999-02-02 2002-12-10 ザ ゼネラル ホスピタル コーポレーション Alpha-2-macroglobulin therapy and drug screening method for Alzheimer's disease
JP2006517181A (en) 2002-09-11 2006-07-20 フランクゲン・ビオテクノロギー・アーゲー Method for identifying BBB-specific proteins and fragments thereof
JP2007531494A (en) 2003-07-03 2007-11-08 ジェントロン リミテッド ライアビリティー カンパニー Methods and systems for diagnosing non-central nervous system (CNS) disease in CNS samples
JP2009020049A (en) 2007-07-13 2009-01-29 Univ Of Tokyo Method for diagnosing cerebrovascular disease
JP4667372B2 (en) 2004-02-25 2011-04-13 株式会社ペルセウスプロテオミクス Method for determining the degree of vascular injury

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102034311B1 (en) * 2017-09-15 2019-10-18 경북대학교 산학협력단 Method for diagnosing vascular dementia using lipocalin-2

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2002541770A (en) 1999-02-02 2002-12-10 ザ ゼネラル ホスピタル コーポレーション Alpha-2-macroglobulin therapy and drug screening method for Alzheimer's disease
JP2006517181A (en) 2002-09-11 2006-07-20 フランクゲン・ビオテクノロギー・アーゲー Method for identifying BBB-specific proteins and fragments thereof
US20060172300A1 (en) 2002-09-11 2006-08-03 Frankgen Biotechnologie Ag Method for identifying bhs-specific proteins and fragments thereof
JP2007531494A (en) 2003-07-03 2007-11-08 ジェントロン リミテッド ライアビリティー カンパニー Methods and systems for diagnosing non-central nervous system (CNS) disease in CNS samples
JP4667372B2 (en) 2004-02-25 2011-04-13 株式会社ペルセウスプロテオミクス Method for determining the degree of vascular injury
JP2009020049A (en) 2007-07-13 2009-01-29 Univ Of Tokyo Method for diagnosing cerebrovascular disease

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
Biomedical Engineering Letters (2017) 7(2):115-120
Current Pharmaceutical Biotechnology (2012) 13(7):1332-1345
Molecular & Cellular Proteomics (2003) 2:234-241
Scientific Reports (2016) 6:33264
Scientific Reports (2017) 7:45657*
장진우, "집속초음파를 이용한 뇌질환 치료의 현재와 미래", 융합연구리뷰 (2019.02.11.) 5(2):3-36

Also Published As

Publication number Publication date
KR20210056314A (en) 2021-05-18
KR20210000253A (en) 2021-01-04

Similar Documents

Publication Publication Date Title
KR102100588B1 (en) Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration
KR20210056313A (en) Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration
US9587239B2 (en) Methods of identifying and treating glioblastoma
KR20210057716A (en) Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration
KR102347836B1 (en) Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration
KR102347835B1 (en) Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration
KR102108176B1 (en) Peptide biomarker for the diagnosis of Alzheimer’s Dementia
KR102207698B1 (en) Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration
KR102207696B1 (en) Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration
KR102207697B1 (en) Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration
KR102207699B1 (en) Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration
KR102651118B1 (en) Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration
KR102635834B1 (en) Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration
KR102635835B1 (en) Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration
KR102651116B1 (en) Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration
KR20210000257A (en) Biomarker composition for diagnosis of brain diseases due to blood-brain barrier degeneration
WO2020262937A1 (en) Bio-marker composition for diagnosis of brain disease caused by brain microvascular damage
WO2020262935A1 (en) Bio-marker composition for diagnosis of brain disease caused by brain microvascular damage
WO2020262939A1 (en) Biomarker composition for diagnosing brain disease due to brain microvascular damage
WO2023287269A1 (en) Bio-marker composition for diagnosing brain disease due to brain microvascular damage
US20150030609A1 (en) Diagnosis and treatment of traumatic brain injury
KR102260585B1 (en) Analytical method for diagnosing urolithiasis and kit therefor
US20220090198A1 (en) Analysis method and kit for diagnosis of urolithiasis
KR102533728B1 (en) Markers specific for brain derived ectosome and non-invasive method for diagnosing dementia
KR102108171B1 (en) Peptide biomarker for the diagnosis of Alzheimer’s Dementia

Legal Events

Date Code Title Description
A107 Divisional application of patent
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant