KR102322782B1 - Compositions for reinforcing skin barrier and improving atopic dermatitis using an extract of wild edible greens as an active ingredient - Google Patents

Abstract

It relates to a composition for strengthening the skin barrier and improving atopic dermatitis using a wild vegetable extract as an active ingredient, and comprising at least one or more of an anchovy ( Adenocaulon himalaicum Edgew.) or Campanula takesimana Nakai extract according to an aspect as an active ingredient. The composition has the effect that it can be usefully used to strengthen the skin barrier by increasing involucrin, loricrin, and the like. In addition, by decreasing the expression level of TARC/CCL17 and increasing the expression level of filaggrin, there is an effect that can be usefully used for preventing, improving or treating atopic dermatitis.

Description

Compositions for reinforcing skin barrier and improving atopic dermatitis using an extract of wild edible greens as an active ingredient}

It relates to a composition for strengthening the skin barrier and improving atopic dermatitis using wild herb extract as an active ingredient.

The upper layer of the epidermis, the outermost layer of the skin, forms a skin barrier with keratinocytes, which is the most important first line of defense against toxic substances, microorganisms, mechanical stimuli, and UV rays. It provides an environment in which Therefore, when the skin barrier is damaged, the skin becomes dry and rough and is easily exposed to harmful substances, which can cause problematic skin such as atopic dermatitis, contact dermatitis, psoriasis, dry skin of the elderly, and the like.

Filaggrin, an important component of the skin barrier, is a substance that helps the keratinous fibers of keratinocytes to stick together, and has the function of bonding between keratinocytes and secreting intercellular lipids. Recently, interest in filaggrin is growing as natural moisturizing factors in keratinocytes are made from decomposition products of filaggrin, and as research results that found lack of filaggrin and chromosomal mutations in atopic dermatitis and dry skin have emerged. (J Allergy Clin Immunol, 2009, 122, 689-693). When filaggrin is insufficient, the bonds between keratinocytes in the stratum corneum are weakened, and external stimuli are easily transmitted to the inside of the skin.

Atopic dermatitis is a recurrent chronic skin disease, which occurs frequently in infancy, but may persist into adulthood or may develop newly in adulthood, and its prevalence is increasing recently (Kor J Pharmacogn 2012, 43, 59-65). Although the cause of atopic dermatitis is not yet clearly identified, it has been found that there are many genetic factors and it is mainly related to the immune response. .

The immune system, which is the body's defense mechanism against external invasion, is centered on the activation of T cells. Inflammation accompanying atopic dermatitis is caused by the excessive production of inflammatory cytokines and reactive oxygen species due to excessive immune cell action, which is caused by damage to surrounding tissues. It is the result. Among various cytokines, TARC/CCL17 (Thymus & activation-related chemokine/Chemokine (CC motif) ligand 17) is a representative chemokine acting on Th2 cells. TARC and MDC/CCL22 (Macrophage-derived chemokine/ Chemokine (CC motif) when TNF-α (Tumor necrosis factor-alpha) or IFN-γ (Interferon-gamma) was treated in human keratinocytes (HaCaT) in an in vitro experiment. ) ligand 22) is expressed in a large amount, suggesting that a substance that can inhibit this expression can be used as a treatment for atopic dermatitis.

Plant-derived materials have been used for a long time because of their excellent safety features.

Anchovy ( Adenocaulon himalaicum Edgew.) As a perennial herb of the Compositae family, the leaf part is specified as an edible part in the food ingredients announced by the Ministry of Food and Drug Safety. It is about 50 to 100 cm tall and grows in shaded and humid areas. It has been used as a folk remedy for trauma treatment and coughing, hemostatic and anti-inflammatory drugs.

Campanula takesimana Nakai is a species endemic to Ulleungdo in Korea in the Campanulaceae family. In the food ingredients announced by the Ministry of Food and Drug Safety, the leaf part is specified as an edible part. It grows up to 30 ~ 100cm, and there are white chrysanthemum flowers with dark spots on a white background and deep purple purpurea chrysanthemums. Since ancient times, it has been used to detoxify, treat sore throats and headaches.

However, research on a composition for strengthening the skin barrier and improving atopic dermatitis using the extract of wild plants as an active ingredient has not yet been made. Therefore, the present inventors conducted a direct study on the efficacy of these substances.

Korean Patent Laid-Open Patent 10-2010-0006735

Grainne, M., et al., Filaggrin in atopic dermatitis. J. Allergy Clin. Immunol. 2009, 122, 689-693

One aspect is to provide a cosmetic composition for strengthening the skin barrier or preventing or improving atopic dermatitis comprising at least one or more of anchovy ( Adenocaulon himalaicum Edgew.) or Seomchorong ( Campanula takesimana Nakai ) extract as an active ingredient.

Another aspect is to provide an external composition for skin external application for strengthening the skin barrier or preventing or improving atopic dermatitis, comprising at least one of anchovy ( Adenocaulon himalaicum Edgew.) or Seomcholong flower ( Campanula takesimana Nakai) extract as an active ingredient.

Another aspect is to provide a pharmaceutical composition for preventing or treating atopic dermatitis comprising at least one of anchovy ( Adenocaulon himalaicum Edgew.) or Seomchorong ( Campanula takesimana Nakai ) extract as an active ingredient.

Another aspect is to provide a health functional food composition for strengthening the skin barrier or preventing or improving atopic dermatitis comprising at least one of anchovy ( Adenocaulon himalaicum Edgew.) or Seomcholong flower ( Campanula takesimana Nakai ) extract as an active ingredient.

An aspect provides a cosmetic composition for strengthening the skin barrier or preventing or improving atopic dermatitis comprising at least one of anchovy ( Adenocaulon himalaicum Edgew.) or Seomchorong ( Campanula takesimana Nakai ) extract as an active ingredient.

The anchovy ( Adenocaulon himalaicum Edgew.) or Seomchorong flower ( Campanula takesimana Nakai) may be one or more selected from the group consisting of whole, root, stem, branch, leaf, seed or fruit.

The anchovy or cypress flower extract may be extracted by any extraction method such as hot water extraction, solvent extraction, distillation extraction, supercritical extraction, etc. conventionally used to extract natural plants, preferably purified water, organic solvent or these It can be extracted with a mixed solvent of

The anchovy or oleracea extract may be extracted using water, alcohol, for example, C1-C6 alcohol, for example, C1-C4 alcohol or a mixture thereof as a solvent. The C1-C6 alcohol may be methanol, ethanol, propanol, isopropanol, 1,3-propanediol, butanol, pentanol, hexanol, or the like. The solvent may be, for example, a mixture of water and alcohol, that is, an aqueous alcohol solution. The alcohol concentration of the aqueous alcohol solution is 1 to 99.5 (v/v)%, for example, 10 to 99.5 (v/v)%, 1 to 70 (v/v)%, 1 to 40 (v/v)%, 5 to 25 (v/v)%, 7 to 20 (v/v)%, 5 to 25 (v/v)%, or 10 to 20 (v/v)%. The aqueous alcohol solution may be an aqueous ethanol solution.

The extraction is 3 to 10 (volume/weight) times, for example, 3 to 7 (volume/weight) times, 3 to 5 (volume/weight) times, 5 to It may include adding 10 (volume/weight) times, or 4 to 10 (volume/weight) times. For example, it may include adding 3 to 10 L of the extraction solvent with respect to 1 kg of the material derived from the anchovy or S.

The extraction is performed by warmed liquid extraction, pressurized liquid extraction (PLE), microwave assisted extraction (MAE), subcritical extraction (SE), or a combination thereof. can be The subcritical extraction may be subcritical water extraction (SWE). Subcritical water extraction is also referred to as superheated water extraction or pressurized hot water extraction (PHWE). The warmed liquid extraction may be reflux extraction.

The extraction is performed at 4 to 70 °C, for example, 4 to 50 °C, 4 to 40 °C, 4 to 30 °C, 10 to 70 °C, 15 to 70 °C, 20 to 70 °C, 4 to 50 °C, 10 to 50 °C. It may be carried out at ℃, 4 to 40 ℃, 4 to 30 ℃, 10 to 40 ℃, 10 to 35 ℃, or 10 to 30 ℃. The extraction time may vary depending on the selected temperature, for example, 1 hour to 2 months, for example, 1 hour to 1 month, 1 hour to 15 days, 1 hour to 10 days, 1 hour to 5 days, 1 hour to 3 days. , 1 hour to 2 days, 1 hour to 1 day, 5 hours to 1 month, 5 hours to 15 days, 5 hours to 10 days, 5 hours to 5 days, 5 hours to 3 days, 5 hours to 2 days, 5 hours to 1 day, 10 hours to 1 month, 10 hours to 15 days, 10 hours to 10 days, 10 hours to 5 days, 10 hours to 3 days, or 10 hours to 2 days. The extraction may include mixing the whole, a part thereof, or materials derived therefrom in the solvent and leaving it for a certain period of time. The standing may include moderate agitation. The extraction may be repeated one or more times, for example, 1 to 5 times.

The extraction may be performed by separating plant residues and extracts by known methods such as filtration. The extraction may also include removing the solvent from the obtained extract by a known method such as concentration under reduced pressure. The extraction may also include preparing a dry extract by drying the obtained extract, such as freeze-drying.

The extract is 0.0001 wt% to 99.0 wt% based on the total weight of the composition, for example, 0.01 wt% to 60 wt%, 0.01 wt% to 40 wt%, 0.01 wt% to 30 wt%, 0.01 wt% to 20 wt% %, 0.01% to 10%, 0.01% to 5%, 0.05% to 60%, 0.05% to 40%, 0.05% to 30%, 0.05% to 20% by weight, 0.05% to 10% by weight, 0.05% to 5% by weight, 0.1% to 60% by weight, 0.1% to 40% by weight, 0.1% to 30% by weight, 0.1% to 20% by weight, 0.1% by weight % to 10% by weight, or 0.1% to 5% by weight.

The term "strengthening the skin barrier" refers to psoriasis, contact dermatitis, eczematous dermatitis, actinic dermatitis, seborrheic dermatitis, dermatitis herpeticus, lichen planus, lichen planus scleroderma, pyoderma gangrene, pemphigus, pemphigus, which are skin diseases caused by weakening of the skin barrier function. It can refer to any action that relieves epidermolysis vesicles, systemic sclerosis or leprosy or improves damaged skin barrier function.

The term "atopic dermatitis" is one of the allergic diseases, and is a skin disease accompanied by symptoms such as itching, dry skin, increased skin thickness, and characteristic eczema.

The term “prevention” refers to partially or completely delaying or preventing the onset or recurrence of a disease, disorder, or concomitant symptoms thereof, preventing the acquisition or reacquisition of the disease or disorder, or the risk of acquiring the disease or disorder. how to reduce For example, the prevention refers to any action of inhibiting or delaying the occurrence of skin barrier, atopic dermatitis-related diseases, disorders, or symptoms by administering the composition according to the present invention.

The term "amelioration" may refer to any action that at least reduces the severity of a condition, eg, a parameter associated with the alleviation or treatment of a condition.

In one embodiment, the anchovies or cypress flower may increase the expression of one or more selected from the group consisting of filaggrin, involucrin, loricrin and CASP14.

The anchovy value may be one that increases the expression of one or more selected from the group consisting of filaggrin, loricrin and CASP14, and the isolate flower increases the expression of one or more selected from the group consisting of filaggrin, involucrin and loricrin it could be

The filaggrin, involucrin, loricrin and CASP14 may be genes or proteins that play an important role in the formation of the stratum corneum. The increased expression of the gene or protein may mean that the skin barrier is strengthened and atopic dermatitis is alleviated.

In one embodiment, the anchovies or serrata may reduce the expression of TARC/CCL17.

The TARC/CCL17 may be a gene or protein expressed in an inflammatory response. Reduction of the expression of the gene or protein may mean that the skin barrier is strengthened and atopic dermatitis is alleviated.

The cosmetic composition consists of a softening lotion, a nourishing lotion, a nourishing cream, a moisture cream, a massage cream, an essence, an ampoule, a gel, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray, a powder, a gel, a lotion and an ointment. It may have a formulation selected from the group. The cosmetic composition may further include one or more cosmetically acceptable carriers to be formulated in general skin cosmetics, and as common ingredients, for example, oil, water, surfactant, humectant, lower alcohol, thickener, chelate Agents, dyes, preservatives, fragrances, etc. may be appropriately mixed, but the present invention is not limited thereto.

The cosmetic composition may include other additives such as excipients, carriers, etc. by adding at least one or more of anchovy ( Adenocaulon himalaicum Edgew.) or Campanula takesimana Nakai extract, and requires ordinary ingredients to be formulated in general skin cosmetics. It may be possible to apply and blend as much as possible.

In addition, in the cosmetic composition, if necessary, medicinal ingredients such as higher fatty acids and vitamins, sunscreens, antioxidants (butylhydroxyanisole, propyl gallic acid, elisorbic acid, tocopheryl acetate, butylated hydroxytoluene, etc.) ), preservatives (methylparaben, butylparaben, propylparaben, phenoxyethanol, imidazolidinylurea, chlorphenesin, etc.), colorants, pH adjusters (triethanolamine, citric acid, citric acid, sodium citrate, malic acid, sodium malate) , fumaric acid, sodium fumarate, succinic acid, sodium succinate, sodium hydroxide, sodium monohydrogen phosphate, etc.), humectants (glycerin, sorbitol, propylene glycol, butylene glycol, hexylene glycol, diglycerin, beta Phosphorus, glycereth-26, methylgluceth-20, etc.), lubricants, and the like may be further added.

In addition, the cosmetic composition further includes a material that can supplementally provide essential nutrients to the skin, and preferably may contain an auxiliary agent, including but not limited to natural fragrance, cosmetic fragrance, or herbal medicine.

Another aspect provides a skin external composition for strengthening the skin barrier or preventing or improving atopic dermatitis comprising at least one of anchovy ( Adenocaulon himalaicum Edgew.) or Seomchorong ( Campanula takesimana Nakai ) extract as an active ingredient.

The external preparation for skin may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal patch, drug-containing bandage, lotion, or a combination thereof.

The external preparation for skin is a component normally used in external preparations for skin such as cosmetics or pharmaceuticals, for example, an aqueous component, an oily component, a powder component, alcohol, a moisturizer, a thickener, an ultraviolet absorber, a whitening agent, a preservative, an antioxidant, a surfactant, a fragrance , coloring agents, and various skin nutrients can be appropriately blended as needed.

The external preparation for skin includes metal sequestering agents such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid, caffeine, tannin, belapamil, licorice extract, glablidine, and kaline. Fruit hot water extract, various herbal medicines, tocopherol acetate, glycyrrhizic acid, tranexamic acid and its derivatives or salts thereof, vitamin C, magnesium ascorbate phosphate, ascorbic acid glucoside, arbutin, kojic acid, glucose, fructose, Sugars, such as trehalose, etc. can be mix|blended suitably.

Another aspect provides a pharmaceutical composition for preventing or treating atopic dermatitis comprising at least one or more of an anchovy ( Adenocaulon himalaicum Edgew.) or Seomcholong flower ( Campanula takesimana Nakai) extract as an active ingredient.

In one embodiment, the anchovy extract or extract of Sumcholong flower may be to increase the expression of one or more selected from the group consisting of filaggrin, involucrin, loricrin and CASP14.

In one embodiment, the anchovies or extracts from samosaurus may be to reduce the expression of TARC/CCL17.

The term “pharmaceutical composition” may refer to a molecule or compound that confers some beneficial effect upon administration to a subject. Advantageous effects include enabling diagnostic decisions; amelioration of a disease, symptom, disorder or condition; reducing or preventing the onset of a disease, symptom, disorder or condition; and responding to a disease, symptom, disorder or condition in general.

The pharmaceutical composition may be administered parenterally during clinical administration and may be used in the form of general pharmaceutical formulations. Parenteral administration may refer to administration via a route other than oral administration, such as rectal, intravenous, peritoneal, muscle, arterial, transdermal, nasal, inhalation, ocular and subcutaneous. When the pharmaceutical composition of the present invention is used as a pharmaceutical, it may further contain one or more active ingredients exhibiting the same or similar function.

The types of pharmaceutically active ingredients capable of delivering the active ingredient into a subject include anticancer agents, contrast agents (dyes), hormones, antihormones, vitamins, calcium agents, inorganic agents, saccharides, organic acid preparations, protein amino acid preparations, detoxifying agents, enzymes Agents, metabolic agents, diabetic combination agents, tissue revitalization agents, chlorophyll agents, pigment agents, tumor agents, tumor agents, radiopharmaceuticals, tissue cell diagnostic agents, tissue cell therapies, antibiotic agents, antiviral agents, combined antibiotics, chemicals Therapeutic agents, vaccines, toxins, toxoids, antitoxins, leptospirin serum, blood products, biological agents, analgesics, immunogenic molecules, antihistamines, allergens, non-specific immunogenic agents, anesthetics, stimulants, psychoneurologic agents, small molecule compounds, nucleic acids, aptamers, antisense nucleic acids, oligonucleotides, peptides, siRNAs and microRNAs, and the like.

When formulating the pharmaceutical composition, it is usually prepared using a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, and a surfactant. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, Witepsol, macrogol, Tween 61, cacao butter, liulinji, glycerogelatin, etc. may be used.

The pharmaceutical composition can be used by mixing with various pharmaceutically acceptable carriers such as physiological saline or organic solvents, and carbohydrates such as glucose, sucrose or dextran, ascorbic acid (Ascorbic acid) to increase stability or absorption acid) or glutathione, antioxidants, chelating agents, low molecular weight proteins, or other stabilizers may be used as pharmaceuticals.

In addition, the pharmaceutically effective amount and effective dosage of the pharmaceutical composition may vary depending on the formulation method, administration method, administration time and/or administration route of the pharmaceutical composition. In addition, the type and degree of response to be achieved by administration of the pharmaceutical composition, the type of subject to be administered, age, weight, general health status, symptoms or severity of disease, sex, diet, excretion, simultaneous or This may vary depending on a number of factors, including the components of the drug and other compositions used together at this time, and similar factors well known in the medical field. A person of ordinary skill in the art can readily determine and prescribe an effective dosage for a desired treatment. Administration of the pharmaceutical composition according to the present invention may be administered once a day, may be administered divided into several times. Therefore, the above dosage does not limit the scope of the present invention in any way. The dosage of the pharmaceutical composition may be 1 ug/kg/day to 1,OOO mg/kg/day per day.

The subject may be a mammal, such as a human, cow, horse, pig, dog, sheep, goat, or cat. The subject may be a subject in need of treatment of atopic dermatitis.

Another aspect provides a health functional food composition for strengthening the skin barrier or preventing or improving atopic dermatitis comprising at least one of anchovy ( Adenocaulon himalaicum Edgew.) or Seomcholong flower ( Campanula takesimana Nakai) extract as an active ingredient.

In one embodiment, the health functional food has a formulation selected from the group consisting of powders, granules, tablets, capsules, pills, gels, jellies, suspensions, emulsions, syrups, tea bags, leached teas, and health drinks. can

The health food includes, in addition to the active ingredients, various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavoring agents, colorants and thickeners (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like.

Another aspect provides a cosmetic composition for strengthening the skin barrier comprising at least one or more of an anchovy ( Adenocaulon himalaicum Edgew.) or Seomcholong flower ( Campanula takesimana Nakai) extract as an active ingredient.

The terms and methods described for the above invention are equally applied between the respective inventions.

According to the composition comprising at least one or more of anchovy ( Adenocaulon himalaicum Edgew.) or Seomcholong flower ( Campanula takesimana Nakai ) extract as an active ingredient according to an aspect, the skin barrier is strengthened and useful for preventing, improving or treating atopic dermatitis There are effects that can be used.

1 is a chromatogram analyzed by high performance liquid chromatography on anchovy extract (A) and oleracea extract (B).
Figure 2 is a graph showing the increase in the expression levels of filaggrin, loricrin and CASP14 according to the concentration of anchovy extract.
3 is a graph showing the increase in the expression levels of filaggrin, involucrin and loricrin according to the concentration of the extract of Seomchorong flower.
Figure 4 is a graph showing the cell viability according to the concentration of the anchovy value and Seomchorong flower extract.
5 is a graph showing a decrease in the expression level of TARC/CCL17 and an increase in the expression level of filaggrin according to the concentration of an anchovy extract.
6 is a graph showing a decrease in the expression level of TARC/CCL17 and an increase in the expression level of filaggrin according to the concentration of a Somchoron flower extract.

Hereinafter, it will be described in more detail through examples. However, these examples are for illustrative purposes of one or more embodiments, and the scope of the present invention is not limited to these examples.

Example 1: Preparation of wild greens extract

Anchovy extract in the composition of the present invention is prepared by the following process. First of all, dried anchovy ( Adenocaulon himalaicum Edgew.) leaves 2 kg of raw material and 50 kg of 30% alcohol were placed in an extraction tank and extracted under reflux at 60 °C for 5 hours. The extracted sample was filtered through a bag filter (10 μm), concentrated under reduced pressure, and dried under reduced pressure to obtain a yellowish brown powder.

In the composition of the present invention, the extract of oleracea is prepared by the following process. First, dry leaves of Campanula takesimana Nakai 2 kg and 40 kg of purified water were placed in an extraction tank and extracted under reflux at 98 °C for 5 hours. The extracted sample was filtered through a bag filter (55 μm), concentrated under reduced pressure, and a water-soluble powder was obtained through freeze-drying.

Experimental Example 1: High-performance liquid chromatography analysis of wild vegetable extract

The anchovy extract (AHE) and chrysanthemum extract (CTE) obtained in Example 1 were analyzed by high-performance liquid chromatography (HPLC) and an ultraviolet absorbance detector (UV/Vis detector). As HPLC equipment, Waters e2695 Series system, Waters 2489 UV/Vis detector (Waters, Milford, MA, USA) was used, and all solvents used for analysis were J.T. An HPLC-grade solvent purchased from Baker (Phillipsburg, NJ, USA) was used.

(5 ㎛, 250 Х 4.6 ㎜, Waters, Milford, MA, USA) 컬럼을 사용하였으며, 컬럼의 온도는 30 ℃, 주입 용량은 20㎕, 측정 파장은 210 ㎚로 설정하였다. 이동상은 아세토니트릴(ACN)과 3차 증류수(D.W)를 사용하였으며, 0.7 ㎖/분 의 속도로 ACN -D.W (1:9 - 10:0, v/v) 혼합 용액을 50분간 분석하였다. 분석 시료는 멸가치 추출물(AHE) 분말 300 ㎎을 정밀히 칭량하여 증류수 30 ㎖을 가한 후 20분간 초음파 진탕기에 넣어 용해하여 실온에서 방냉 후 상등액을 취해 0.45 ㎛ 멤브레인 필터로 여과하여 사용하였다.Analysis of anchovy extract (AHE) obtained in Example 1 is XSelect HSS C18 100

A (5 μm, 250 Х 4.6 mm, Waters, Milford, MA, USA) column was used, and the temperature of the column was set to 30° C., the injection volume was set to 20 μl, and the measurement wavelength was set to 210 nm. Acetonitrile (ACN) and tertiary distilled water (DW) were used as the mobile phase, and a mixed solution of ACN-DW (1:9 - 10:0, v/v) was analyzed for 50 minutes at a rate of 0.7 ml/min. For the analysis sample, 300 mg of anchovy extract (AHE) powder was precisely weighed, 30 ml of distilled water was added, and dissolved in an ultrasonic shaker for 20 minutes. After cooling at room temperature, the supernatant was taken and filtered through a 0.45 μm membrane filter.

(5 μm, 250 Х 4.6 ㎜, Waters, Milford, MA, USA) 컬럼을 사용하였으며, 컬럼의 온도는 30 ℃, 주입 용량은 20㎕, 측정 파장은 210 ㎚로 설정하였다. 이동상은 아세토니트릴(ACN)과 3차 증류수(D.W)를 사용하였으며, 1 ㎖/분 의 속도로 ACN -D.W (1:9 - 10:0, v/v) 혼합 용액을 50분간 분석하였다. 분석 시료는 섬초롱꽃 추출물(CTE) 분말 300 ㎎을 정밀히 칭량하여 30% 메탄올 30 ㎖을 가한 후 20분간 초음파 진탕기에 넣어 용해하여 실온에서 방냉 후 상등액을 취해 0.45 ㎛ 멤브레인 필터로 여과하여 사용하였다.XSelect HSS C18 100 analysis of extract (CTE) obtained in Example 1

A (5 μm, 250 Х 4.6 mm, Waters, Milford, MA, USA) column was used, and the temperature of the column was set to 30° C., the injection volume was set to 20 μl, and the measurement wavelength was set to 210 nm. Acetonitrile (ACN) and tertiary distilled water (DW) were used as the mobile phase, and a mixed solution of ACN-DW (1:9 - 10:0, v/v) was analyzed for 50 minutes at a rate of 1 ml/min. For the analyte sample, 300 mg of C. oleracea extract (CTE) powder was precisely weighed, 30 ml of 30% methanol was added, and dissolved in an ultrasonic shaker for 20 minutes, allowed to cool at room temperature, and the supernatant was filtered through a 0.45 μm membrane filter and used.

As shown in FIG. 1 , it was confirmed that the anchovy extract and Seomchorong flower extract were compositions comprising a plurality of components.

Experimental Example 2: Evaluation of changes in the expression level of skin barrier-related genes of anchovy value and S.

In order to confirm the skin barrier strengthening effect of the anchovy extract (AHE) and C. oleraceae extract (CTE) obtained in Example 1, each sample was treated with each concentration in human keratinocytes (HaCaT, (ATCC, USA)), Changes in expression levels of green, involucrin, loricrin, and CASP 14 were confirmed.

Specifically, 2x10 ⁶ HaCaT cells were aliquoted in DMEM medium (Hyclone SH30243.01) supplemented with 10% FBS on a 60 mm plate and stabilized for 24 hours. After removing the existing medium and culturing for 24 hours in a state of serum starvation, the anchovy extract and Somcholong flower extract of each concentration obtained in Example 1 were treated. The control group did not receive any treatment. After culturing for 24 hours, the culture medium was removed, washed with PBS, and treated with trypsin-EDTA to recover cell pellets. Then, RNA is extracted from the cells obtained using Trizol reagent, and cDNA is synthesized from the RNA obtained using the cDNA synthesis kit (Bio-Rad), and using this as a template, quantitative real time-PCR (qRT- PCR) was performed (LightCycler 96, Roche, Switzerland). The RT-PCR reaction was performed under the conditions of 40 cycles repeated at 95 °C for 600 seconds, 95 °C for 10 seconds, 60 °C for 10 seconds, and 72 °C for 10 seconds after pre-incubation at 95 °C for 600 seconds. The expression level of the gene was finally analyzed through correction for the β-actin gene.

gene Primer direction Primer sequence (5'→ 3') SEQ ID NO: filaggrin Forward AGTGCACTCAGGGGGCTCCACA One Reverse CCGGCTTGGCCGTAATGTGT 2 Involuclein Forward TTGGTCAGTGAAGCGATGAG 3 Reverse AGATCTGTCTGCAGGGCTGT 4 Lori Clean Forward TCATAAGAAACCCCGCTGAG 5 Reverse AAGGAAGGAGAGCCTGGAAG 6 CASP 14 Forward CGCCTGGCCCTAATACTGTG 7 Reverse GGGTCTCTTTTCATGGTGCTTTTC 8 TARC/CCL17 Forward CTTTCCTGCAGCACATCC 9 Reverse AAGACCTCTCAAAGGCTTTG 10 β-actin Forward CATGTACGTTGCTATCCAGGC 11 Reverse CTCCTTAATGTCACGCACGAT 12

qRT-PCR was performed using the oligomers shown in Table 1 above as primers. The primer set is specific for filaggrin, involucrin, loricrin, and CASP 14 genes, which are skin barrier-related genes.

As shown in FIG. 2 , it was confirmed that the anchovy extract significantly increased all of the skin barrier-related genes.

As shown in FIG. 3 , it was confirmed that the extract of Sum Chorong flower increased all of the skin barrier-related genes.

Experimental Example 3: Cytotoxicity evaluation of anchovy value and extract

In order to measure the cytotoxicity of the anchovies extract (AHE) and extract (CTE) obtained in Example 1, human keratinocytes (HaCaT) cells were treated with TNF-α and IFN-γ to determine the cell viability by MTT It was measured by assay.

^{Specifically, 1x10 4} cells of human keratinocytes and HaCaT cells were dispensed into each well of a 96-well plate in DMEM medium supplemented with 10% FBS and stabilized for 24 hours. After removing the old medium, and treating with 10 nM TNF-α and 10 nM IFN-γ, an anchovy extract and extract of each concentration, MTT (3-(4,5) -dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay was used to measure the degree of cell viability. MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) solution (Sigma, USA) was applied to each cell to finally reach a concentration of 0.5 mg/ml, and then for 4 hours After incubation, the solution was completely removed and the absorbance of the plate dissolved with DMSO (dimethyl sulfoxide) was measured at 540 nm.

Figure 4 is a graph showing the cell viability according to the concentration of the anchovy value and Seomchorong flower extract. As a result, it was confirmed that the anchovies and extracts of Sesomcholong flower did not show cytotoxicity.

Experimental Example 4: Evaluation of changes in gene expression to confirm the atopic dermatitis improvement effect of anchovy value and extract

In order to confirm the improvement effect of atopic dermatitis of the atopic dermatitis of the atopic dermatitis extract (AHE) and C. oleracea extract (CTE) obtained in Example 1, each sample was treated with each concentration in human keratinocytes (HaCaT) for TARC/CCL17 and filaggrin genes. of the expression level was confirmed.

Specifically, 4x10 ⁵ HaCaT cells were aliquoted in DMEM medium supplemented with 10% FBS in a 6-well plate and stabilized for 24 hours. Remove the existing medium and treat only 10 nM TNF-α and 10 nM IFN-γ as a control group, and 10 nM TNF-α and 10 nM IFN-γ and each concentration of anchovy extract and Sumcholong flower extract treated together The experimental group was incubated for 6 hours under serum starvation. Thereafter, the culture medium was removed, washed with PBS, and treated with trypsin-EDTA to collect cell pellets. Then, RNA is extracted from the cells obtained using Trizol reagent, cDNA is synthesized from the RNA obtained using the cDNA synthesis kit (Bio-Rad), and using this as a template, quantitative real time-PCR (qRT) -PCR) was performed (LightCycler 96, Roche, Switzerland). The RT-PCR reaction was performed under the conditions of 40 cycles repeated at 95 °C for 600 seconds, 95 °C for 10 seconds, 60 °C for 10 seconds, and 72 °C for 10 seconds after pre-incubation at 95 °C for 600 seconds. The expression level of the gene was finally analyzed through correction for the β-actin gene. qRT-PCR was performed using the oligomers shown in Table 1 above as primers.

As a result, as shown in FIGS. 5 and 6 , it was confirmed that the anchovy extract and the extract of Atopic dermatitis inhibited the expression level of the TARC/CCL17 gene, which was increased when atopic dermatitis was induced, in a concentration-dependent manner. It was confirmed that the filaggrin gene, which was decreased upon induction, increased according to the concentration.

The above results mean that the anchovy and chrysanthemum extract have an effect for preventing, treating and improving atopic dermatitis by strengthening the skin barrier.

Formulation Example 1: Preparation of tablets

With respect to Example 1, according to a conventional tablet manufacturing method, the ingredients in Table 2 below were mixed and compressed to prepare tablets.

Raw material name unit weight (mg) unit weight (mg) Example 1 300.0006 - silicon dioxide 15.3000 15.3000 Magnesium Stearate 10.8000 10.8000 crystalline cellulose 509.4945 799.4945 Hydroxypropylmethylcellulose 29.0700 29.0700 Carboxymethylcellulose calcium 27.0000 27.0000 glycerin fatty acid ester 0.6930 0.6930 titanium dioxide 1.4697 1.4697 red red pigment 4.4082 4.4082 Powdered Caramel Color 1.7640 1.7640

Formulation Example 2: Preparation of capsules

With respect to Example 1, the ingredients of Table 3 below were mixed according to a conventional capsule preparation method and filled in gelatin capsules to prepare soft capsules.

Raw material name unit weight (mg) unit weight (mg) Example 1 50 - vitamin E 2.25 2.25 vitamin C 2.25 2.25 palm oil 0.5 0.5 vegetable hydrogenated oil 2 2 yellow wax One One lecithin 2.25 2.25 Soft Capsule Filling Solution 387.75 387.75

Formulation Example 3: Preparation of liquid formulation

With respect to Example 1, the ingredients in Table 4 were mixed according to the beverage preparation method suitable for taste, and a liquid was prepared by filling in a vial or pouch.

Raw material name unit weight (g) unit weight (g) Example 1 2.5050 - Xanthan Gum 0.0075 0.0075 fructooligosaccharide solution 0.7500 0.7500 Coconut Flower Extract Powder 1.0500 1.0500 Ssanghwa Concentrate 1.5000 1.5000 red ginseng flavor 0.0450 0.0450 Purified water 9.1425 9.1425

Formulation Example 4: Preparation of jelly

With respect to Example 1, the ingredients in Table 5 were mixed according to the jelly preparation method suitable for the taste, and the ingredients were filled in a three-sided cloth to prepare a jelly.

Raw material name unit weight (g) unit weight (g) Example 1 2.0000 - food gel 0.3600 0.3600 carrageenan 0.0600 0.0600 calcium lactate 0.1000 0.1000 sodium citrate 0.0600 0.0600 Complex Golden Extract 0.0200 0.0200 Enzyme-treated Stevia 0.0440 0.0440 fructooligosaccharide solution 5.0000 5.0000 Red Grape Concentrate 2.4000 2.4000 Purified water 13.9560 13.9560

Formulation Example 5: Preparation of nutritional cream

With respect to Example 1, a nourishing cream was prepared with the composition shown in Table 6 below according to a conventional method.

Raw material content (%) content (%) Example 1 1.0 - sitosterol 4.0 4.0 Polyglyceryl 2-oleate 3.0 3.0 3.0 Ceteares-4 2.0 2.0 cholesterol 3.0 3.0 dicetyl phosphate 0.4 0.4 concentrated glycerin 5.0 5.0 Sunflower Oil 22.0 22.0 Carboxyvinyl Polymer 0.5 0.5 triethanolamine 0.5 0.5 antiseptic a very small amount a very small amount Spices a very small amount a very small amount Purified water remaining amount remaining amount

Although the above composition ratio is generally formulated as a formulation example by mixing suitable components, the mixing ratio and raw materials may be arbitrarily changed as necessary.

Since the extract of the present invention is stable in all formulation examples test conditions, there was no problem in the stability of the formulation.

<110> COSMAX BIO <120> Compositions for reinforcing skin barrier and improving atopic dermatitis using an extract of wild edible greens as an active ingredient <130> PN132185 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer for filaggrin <400> 1 agtgcactca gggggctcac a 21 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for filaggrin <400> 2 ccggcttggc cgtaatgtgt 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for involucrin <400> 3 ttggtcagtg aagcgatgag 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for involucrin <400> 4 agatctgtct gcagggctgt 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for loricrin <400> 5 tcataagaaa ccccgctgag 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for loricrin <400> 6 aaggaaggag agcctggaag 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for CASP14 <400> 7 cgcctggccc taatactgtg 20 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for CASP14 <400> 8 gggtctcttt tcatggtgct ttc 23 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> forward primer for TARC/CCL17 <400> 9 cttctctgca gcacatcc 18 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for TARC/CCL17 <400> 10 aagacctctc aaggctttg 19 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer for beta-actin <400> 11 catgtacgtt gctatccagg c 21 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for beta-actin <400> 12 ctccttaatg tcacgcacga t 21

Claims (13)

Anchovy ( Adenocaulon himalaicum Edgew. ) or Seomcholong flower ( Campanula takesimana Nakai ) A cosmetic composition for strengthening the skin barrier comprising at least one of the extracts as an active ingredient. The cosmetic composition according to claim 1, wherein the anchovy extract or extracts of oleracea increases the expression of one or more selected from the group consisting of filaggrin, involucrin, loricrin, and CASP14. Anchovy ( Adenocaulon himalaicum Edgew. ) or Seomcholong flower ( Campanula takesimana Nakai ) A cosmetic composition for preventing or improving atopic dermatitis comprising at least one of extracts as an active ingredient. The cosmetic composition according to claim 3, wherein the anchovy extract or extract of oleracea reduces the expression of TARC/CCL17. Anchovy ( Adenocaulon himalaicum Edgew.) or Seomcholong flower ( Campanula takesimana Nakai ) A pharmaceutical composition for strengthening the skin barrier comprising at least one of the extracts as an active ingredient. The pharmaceutical composition according to claim 5, wherein the extract of anchovy or oleracea increases the expression of one or more selected from the group consisting of filaggrin, involucrin, loricrin, and CASP14. Anchovy ( Adenocaulon himalaicum Edgew.) or Seomcholong flower ( Campanula takesimana Nakai ) A pharmaceutical composition for preventing or treating atopic dermatitis comprising at least one of the extracts as an active ingredient. The pharmaceutical composition according to claim 7, wherein the anchovies or extracts from oleracea reduces the expression of TARC/CCL17. A health functional food composition for strengthening the skin barrier comprising at least one of anchovy ( Adenocaulon himalaicum Edgew.) or Seomcholong flower ( Campanula takesimana Nakai) extract as an active ingredient. Anchovy ( Adenocaulon himalaicum Edgew.) or Seomcholong flower ( Campanula takesimana Nakai ) A health functional food composition for preventing or improving atopic dermatitis comprising at least one of the extracts as an active ingredient. The method according to claim 9 or 10, wherein the health functional food has a formulation selected from the group consisting of powders, granules, tablets, capsules, pills, gels, jellies, suspensions, emulsions, syrups, tea bags, leached teas, and health drinks. A health functional food composition. An external application for skin composition for strengthening the skin barrier comprising at least one of anchovy ( Adenocaulon himalaicum Edgew.) or Seomcholong flower ( Campanula takesimana Nakai) extract as an active ingredient. An external application composition for preventing or improving atopic dermatitis comprising at least one of anchovy ( Adenocaulon himalaicum Edgew.) or Seomchorong ( Campanula takesimana Nakai ) extract as an active ingredient.

Images