KR102291402B1 - DNA polymerase for detecting JAK2 mutation and kit comprising the same - Google Patents

Abstract

The present invention relates to a DNA polymerase for detecting JAK2 mutation and a kit comprising the same, and more particularly, a DNA polymerase, primer set, probe, and kit capable of detecting a somatic mutation at codon 617 of the JAK2 gene with high sensitivity. And it relates to a JAK2 gene mutation detection method using the kit.

Description

DNA polymerase for detecting JAK2 mutation and kit comprising same {DNA polymerase for detecting JAK2 mutation and kit comprising the same}

The present invention relates to a DNA polymerase for detecting JAK2 mutation and a kit comprising the same, and more particularly, a DNA polymerase, primer set, probe, and kit capable of detecting a somatic mutation at codon 617 of the JAK2 gene with high sensitivity. And it relates to a JAK2 gene mutation detection method using the kit.

Cancer refers to a group of abnormal cells generated by continuous division and proliferation by disrupting the balance between cell division and death due to various causes, and is also referred to as a tumor or neoplasia. In general, it develops in more than 100 different parts of the body, including organs, white blood cells, bones, lymph nodes, etc., and develops into serious symptoms through infiltration into surrounding tissues and metastasis to other organs.

Until now, most cancer screening methods are physical. Examples of gastrointestinal X-ray imaging include double imaging, compression imaging, or mucosal imaging. By using an endoscope to visually inspect internal organs, it is possible to detect even very small lesions that do not appear in X-ray examinations, as well as to detect cancer. It is also possible to directly conduct a biopsy at this suspicious location, increasing the diagnosis rate. However, this method has disadvantages in terms of hygiene and patient suffering during the examination.

In addition, most cancer treatments up to now are excision of the lesion through surgery, and in particular, surgical resection is the only method for a cure. In such surgical resection, it is a principle to include as wide a range as possible in an operation aimed at a complete cure, but the resection range is sometimes determined in consideration of the sequelae caused by extensive resection after surgery. However, even in this case, if the cancer has metastasized to other organs, curative surgery is not possible. Therefore, in this case, other methods such as administration of anticancer drugs are chosen. There is only a temporary effect of extending the period, there is a limit to the treatment of the underlying cancer, and the side effects and economic burden caused by the administration of anticancer drugs may cause double pain to the patient.

Therefore, in order to treat cancer, it is most important to develop a cancer diagnosis method with high sensitivity and specificity in the stage prior to treatment, and such diagnosis should be used for early detection of cancer.

On the other hand, myeloproliferative neoplasms (MPNs) are rare blood cancers derived from bone marrow stem cells, and increase the risk of thrombosis and secondary leukemic transformation. The three major diseases constituting MPN are polycythemia vera (PV), essential thrombocythemia (ET), and primary myelofibrosis (PMF), characterized by inherent somatic mutations. do.

Recognizing the specific diagnostic challenges presented by these diseases, WHO-sponsored pathologists and clinicians have created the MPN category, which provides a less restrictive view of myeloid disorders, which in some cases clearly overlaps. WHO has proposed that a new MPN category contemplates more intensive clinical and laboratory investigations into myeloid hyperplasia, abnormal hyperplasia, and dysplasia.

JAK2 (Janus kinase 2) is a member of the cytoplasmic tyrosine kinase group and is involved in signal transduction from growth factor receptors. JAK2 plays a key role in the JAK2-STAT (signal transducer and activator of transcription) pathway. In autophosphorylation after activation via ligand binding, JAK2 recruits STATs to be phosphorylated and translocated to the nucleus to act as a transcription factor. This mutation interferes with the self-repression of JAK2, JH2, resulting in constitutive activity of JAK2, resulting in uncontrolled proliferation.

Somatic gain-of-function mutations in the JAK2 kinase gene on chromosome 9 have been identified in more than 50% of people with MPN. This mutation is the constant G to T conversion of exon 14 that results in the substitution of phenylalanine for valine in codon 617 (JAK V617F). The JAK2 V617F mutation (G1849T) is present in a number of myeloproliferative neoplasms, such as PV (~95%), ET (~60%), and PMF (~50%).

Although the incidence of the V617F mutation in patients with bcr-abl-myeloproliferative disease varies, defining the presence or absence of this mutation is currently part of the clinical diagnostic algorithm. JAK inhibitors that can treat diseases caused by mutations in JAK2 V617F have been evaluated for efficacy and safety in several clinical trials. It has entered the clinical stage and has been recognized for its excellent efficacy and safety.

Jakafi (Ruxolitinib Phosphate) is treated with hydroxyurea for myelofibrosis (primary myelofibrosis, post-polycythemia vera myelofibrosis), post-essential thrombocythemia myelofibrosis and hydroxyurea in adults. It is approved for use in the treatment of patients who are unable to or whose symptoms do not improve.

However, the understanding of an individual patient's cancer is often limited by tumor accessibility due to the high risk and invasive nature of current tissue biopsy procedures. “Liquid biopsy” provides a new source of cancer-derived material that can better reflect the state of the disease and contribute to more individualized treatment. In addition, it is important to develop more sensitive techniques for mutation detection.

Meanwhile, Korean Patent Application Laid-Open No. 10-2009-0090263 relates to a probe for detecting a mutation in the JAK2 gene and its use, and discloses a probe for detecting a mutation in the JAK2 gene, but polymerization for detecting a mutation in the JAK2 gene Nothing is known about the enzyme and the reaction buffer for increasing its activity.

Accordingly, the present inventors developed a kit including a DNA polymerase capable of detecting a mutation in exon 14 of the JAK2 gene with high sensitivity and a reaction buffer for increasing its activity, and completed the present invention.

It is an object of the present invention to provide a DNA polymerase for detecting JAK2 gene mutation.

Another object of the present invention is to provide a primer set for detecting JAK2 gene mutation.

Another object of the present invention is to provide a probe for detecting JAK2 gene mutation.

Another object of the present invention is to provide a kit for detecting JAK2 gene mutation, comprising the above-described DNA polymerase and/or primer set.

Another object of the present invention is to provide a method for detecting a JAK2 gene mutation using the aforementioned kit.

In order to solve the above problems, in the present invention, in the amino acid sequence of SEQ ID NO: 1, glutamic acid (E), the 507th amino acid residue, is substituted with lysine (K), and the 536th amino acid residue, arginine (R), is lysine (K) To provide a DNA polymerase for detecting JAK2 gene mutation, which has a Taq polymerase in which arginine (R), which is the 660th amino acid residue, is substituted with valine (V).

The present invention also provides a primer set for detecting JAK2 gene mutation comprising any one or more primers selected from the group consisting of SEQ ID NOs: 3 to 6.

The present invention also provides a probe for detecting JAK2 gene mutation comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 7 and 8.

According to a preferred embodiment of the present invention, one type of fluorescent substance selected from the group consisting of FAM, Quasar 670 and CY5 may be labeled at the 5'-end of each of the nucleotide sequences of SEQ ID NOs: 7 and 8, 3 One kind of quenching material selected from the group consisting of BHQ-1 and BHQ-2 may be labeled at the '-terminus.

The present invention also provides a kit for detecting JAK2 gene mutation, comprising the above-described DNA polymerase and/or primer set.

According to a preferred embodiment of the present invention, the kit may further include a probe comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 7 and 8.

According to another preferred embodiment of the present invention, the nucleotide sequences of SEQ ID NOs: 7 and 8 are each labeled with one type of fluorophore selected from the group consisting of FAM, Quasar 670 and CY5 at the 5'-end. and one type of quencher selected from the group consisting of BHQ-1 and BHQ-2 may be labeled at the 3'-end.

According to another preferred embodiment of the present invention, the kit comprises 25 to 100 mM KCl; and 1 to 7 mM (NH ₄ ) ₂ SO ₄ ; and may further include a PCR buffer composition having a final pH of 8.0 to 9.5.

According to another preferred embodiment of the present invention, the kit comprises 40 to 90 mM KCl; 1-5 mM (NH ₄ ) ₂ SO ₄ ; and 5 to 80 mM of TMAC (Tetra methyl ammonium chloride), and may further include a PCR buffer composition having a final pH of 8.0 to 9.5.

The present invention also provides a method for detecting a JAK2 gene mutation comprising the steps of:

(a) extracting nucleic acids from the isolated biological sample;

(b) performing PCR (polymerase chain reaction) by treating the above-described kit on the extracted nucleic acid; and

(c) confirming the result of the PCR amplification with fluorescence.

According to a preferred embodiment of the present invention, the PCR may be allele-specific PCR or real-time PCR.

According to another preferred embodiment of the present invention, (d) may further include the step of confirming the result of the PCR amplification by measuring a Ct (cycle threshold) value.

According to a preferred embodiment of the present invention, the JAK2 gene mutation may include one or more selected from the group consisting of deletion, substitution, and insertional mutations at codon 617 of exon 14 of the JAK2 gene.

According to another preferred embodiment of the present invention, the JAK2 gene mutation may include a substitution of valine, an amino acid at codon 617 of exon 14 of the JAK2 gene.

According to another preferred embodiment of the present invention, the JAK2 gene mutation detection method can be applied to diagnose myeloproliferative neoplasms.

According to another preferred embodiment of the present invention, the myeloproliferative neoplasm may be one or more selected from the group consisting of polycythemia vera, essential thrombocythemia, and primary myelofibrosis (PMF).

According to another preferred embodiment of the present invention, the nucleic acid of step (a) may be extracted from a bone marrow tissue biopsy or a liquid biopsy.

The kit of the present invention exhibits high detection sensitivity (up to 0.01%, 3 mutant copies in 30,000 wild-type copies), high specificity and reproducibility, and is applicable to both liquid biopsies and tissue biopsies. In addition, myeloproliferative neoplasm can be accurately diagnosed by detecting the amino acid substitution of codon 617 in exon 14 of the JAK2 gene.

1 shows the production process of Taq DNA polymerase containing R536K, R660V and R536K / R660V mutations, respectively, (a) is a schematic representation of fragment PCR and overlap PCR, (b) is amplified in fragment PCR It shows the result of confirming the product by electrophoresis, and (c) shows the result of confirming the amplified product by electrophoresis by amplifying the full length by overlap PCR.
2 is a result of electrophoresis confirming the overlap PCR product of FIG. 1(c) purified with the pUC19 vector treated with SAP after digestion with restriction enzymes EcoRI/XbaI for gel extraction.
Figure 3 schematically shows fragment PCR and overlap PCR during the production process of Taq DNA polymerase containing E507K, E507K / R536K, E507K / R660V and E507K / R536K / R660V mutations, respectively.
4 is a result of electrophoresis confirming the overlap PCR product of FIG. 3 purified with the pUC19 vector treated with SAP after digestion with restriction enzymes EcoRI/XbaI for gel extraction.
5 shows the results of detecting mutations by AS-qPCR in the V617F mutant plasmid (30,000, 3,000, 300, 30, 3 and 0 copies) template.

As described above, the presence of a JAK2 mutation acts as a predictor for the diagnosis of myeloproliferative neoplasms, and therefore, an effective and rapid detection method for JAK2 mutations is required for early diagnosis of myeloproliferative neoplasms. Accordingly, the present inventors sought a solution to the above problem by providing a kit comprising a DNA polymerase capable of detecting V617F with high sensitivity in exon 14 of the JAK2 gene and a reaction buffer for increasing its activity. The kit of the present invention exhibits high detection sensitivity, high specificity and reproducibility, and is applicable to both liquid biopsy and tissue biopsy. In addition, FAM/CY5 channels enable analysis in all qPCR instruments.

Hereinafter, the terms used herein will be described.

“Amino acid” refers to any monomeric unit that can be incorporated into a peptide, polypeptide, or protein. As used herein, the term “amino acid” includes the following 20 natural or genetically encoded alpha-amino acids: alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspart acid (Asp or D), cysteine (Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan ( Trp or W), tyrosine (Tyr or Y), and valine (Val or V).

Amino acids are typically organic acids, which include substituted or unsubstituted amino groups, substituted or unsubstituted carboxy groups, and one or more side chains or groups, or any analogs of these groups. Exemplary side chains are, for example, thiol, seleno, sulfonyl, alkyl, aryl, acyl, keto, azido, hydroxyl, hydrazine, cyano, halo, hydrazide, alkenyl, alkynyl, ether, borate, boronate, phospho, phosphono, fosifine, heterocyclic, enone, imine, aldehyde, ester, thioacid, hydroxylamine, or any combination of these groups.

In the DNA polymerases of the present invention, the term "mutant" refers to a recombinant polypeptide comprising one or more amino acid substitutions relative to the corresponding naturally occurring or unmodified DNA polymerase.

The term "thermostable polymerase" (referring to an enzyme that is heat stable) is heat resistant, retains sufficient activity to achieve a subsequent polynucleotide extension reaction, and is subjected to elevated temperature for a period of time required to achieve denaturation of double-stranded nucleic acids. It is not irreversibly denatured (inactivated) when As used herein, it is suitable for use at a temperature cycling reaction such as PCR. Irreversible denaturation herein refers to permanent and complete loss of enzyme activity. For thermostable polymerases, enzymatic activity refers to catalyzing the combination of nucleotides in an appropriate manner to form a polynucleotide extension product complementary to the template nucleic acid strand. Thermostable DNA polymerases from thermophilic bacteria include, for example: Thermotoga maritima, Thermus aquaticus, Thermus thermophilus, Thermus flabus, Thermophylliformis, Thermus sp. DNA polymerases from Sps17, Thermos sp. Z05, Thermos caldophilus, Bacillus caldotenax, Thermotoga neopolitana, and Thermocypo africanus.

The term “thermoactive” refers to an enzyme that retains its catalytic properties at temperatures commonly used for reverse transcription or annealing/extension steps in RT-PCR and/or PCR reactions (ie, 45-80° C.). Thermostable enzymes are those that are irreversibly inactivated or not denatured when subjected to the elevated temperatures required for nucleic acid denaturation. A thermoactive enzyme may or may not be thermostable. The thermoactive DNA polymerase may be DNA or RNA dependent from a thermophilic or mesophilic species, including but not limited to:

The term “nucleotide” is a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) that exists in single- or double-stranded form, unless specifically stated otherwise. It may contain analogs of natural nucleotides as long as they are not.

The term “nucleic acid” or “polynucleotide” refers to a polymer that may correspond to a DNA or RNA polymer, or an analog thereof. Nucleic acids are, for example, chromosomes or chromosomal segments, vectors (eg, expression vectors), expression cassettes, naked DNA or RNA polymers, products of polymerase chain reaction (PCR), oligonucleotides, probes, and primers. may or may include. A nucleic acid may be, for example, single-stranded, double-stranded, or triple-stranded, but is not limited to any particular length. Unless otherwise stated, a particular nucleic acid sequence comprises or encodes a complementary sequence in addition to any sequence specified.

The term “primer” refers to a polynucleotide capable of serving as an initiation point for nucleic acid synthesis in the template-direction when subjected to the conditions in which polynucleotide extension is initiated. Primers can also be used in a variety of other oligonucleotide-mediated synthetic processes, including as initiators of de novo RNA synthesis and in vitro transcription-related processes. Primers are typically single-stranded oligonucleotides (eg, oligodeoxyribonucleotides). The appropriate length of the primer depends on the intended use, typically in the range of 6 to 40 nucleotides, more typically in the range of 15 to 35 nucleotides. Short primer molecules generally require lower temperatures to form sufficiently stable hybridization complexes with the template. Primers are not required to reflect the exact sequence of the template, but must be sufficiently complementary to hybridize with the template to be extended. In certain embodiments, the term "primer pair" includes 5'-sense primers that hybridize complementary to the 5'-end of the nucleic acid sequence being amplified, and 3'-antisense primers that hybridize to the 3'-end of the sequence to be amplified. It means a set of primers comprising Primers can be labeled, if desired, by incorporating a label that can be detected by spectroscopic, photochemical, biochemical, immunochemical or chemical means. For example, useful labels include: ³² P, fluorescent dyes, electron-dense reagents, enzymes (commonly used in ELISA assays), biotin, or haptens and proteins for which antisera or monoclonal antibodies can be used. .

The term "5'-nuclease probe" refers to an oligonucleotide comprising one or more luminescent label moieties used in a 5'-nuclease reaction to target nucleic acid detection. In some embodiments, for example, a 5'-nuclease probe comprises only a single luminescent moiety (eg, a fluorescent dye, etc.). In certain embodiments, a 5'-nuclease probe comprises a self-complementary region such that the probe can form a hairpin structure under selective conditions. In some embodiments, the 5'-nuclease probe comprises two or more label moieties and is released with increased radiation intensity after one of the two labels is separated from or degraded from the oligonucleotide. In certain embodiments, a 5'-nuclease probe is labeled with two different fluorescent dyes, eg, a 5'-terminal reporter dye and a 3'-terminal quencher dye or moiety. In some embodiments, the 5'-nuclease probe is labeled in addition to, or at one or more positions other than the terminal position. When the probe is intact, energy transfer typically occurs between the two fluorophores such that the fluorescence emission from the reporter dye is at least partially quenched. During the elongation step of the polymerase chain reaction, for example, a 5'-nuclease probe bound to the template nucleic acid has an activity such that the fluorescence emission of the reporter dye is no longer quenched, e.g. Taq polymerase or other It is degraded by the 5' to 3'-nuclease activity of the polymerase. In some embodiments, a 5'-nuclease probe may be labeled with two or more different reporter dyes and a 3'-terminal quencher dye or moiety.

The term “FRET” or “fluorescence resonance energy transfer” or “Forester resonance energy transfer” refers to the transfer of energy between two or more chromophores, a donor chromophore and an acceptor chromophore (referred to as a quencher). A donor typically transfers energy to an acceptor when the donor is excited by radiation of a suitable wavelength. The receptor re-radiates the displaced energy, typically in the form of light emitted at different wavelengths. When the receptor is a "cancer" quencher, it dissipates the energy transferred to a form other than light. Whether a particular fluorophore acts as a donor or acceptor depends on the properties of the other members of the FRET pair. A commonly used donor-acceptor pair includes the FAM-TAMRA pair. Commonly used matting agents are DABCYL and TAMRA. Commonly used cancer quenchers include: BlackHole Quenchers™ (BHQ), (Biosearch Technologies, Inc., Novato, Cal.), Iowa Black™ (Integrated DNA Tech., Inc., Coralville, Iowa), and BlackBerry™ Quencher 650 (BBQ-650) (Berry & Assoc., Dexter, Mich.).

The term "conventional" or "native" when referring to a nucleic acid base, nucleoside triphosphate, or nucleotide refers to that which occurs naturally in the polynucleotide being described (i.e., for DNA they are dATP, dGTP, dCTP and dTTP). In addition, dITP, and 7-deaza-dGTP are frequently used instead of dGTP and can be used instead of dATP in in vitro DNA synthesis reactions such as sequencing.

The term "unconventional" or "modified" when referring to a nucleic acid base, nucleoside, or nucleotide refers to a modification, derivative or include analogs. Certain unusual nucleotides are modified at the 2' position of the ribose sugar compared to conventional dNTPs. Thus, for RNA, although a naturally occurring nucleotide is a ribonucleotide (i.e., ATP, GTP, CTP, UTP, collective rNTP), since the nucleotide has a hydroxyl group at the 2' position of the sugar, it is comparatively free of dNTPs, As used herein, ribonucleotides are unconventional nucleotides as substrates for DNA polymerases. As used herein, unconventional nucleotides include, but are not limited to, compounds used as terminators for nucleic acid sequencing. Exemplary terminator compounds include, but are not limited to, compounds having a 2',3'-dideoxy structure, which are referred to as dideoxynucleoside triphosphates. Dideoxynucleoside triphosphates ddATP, ddTTP, ddCTP and ddGTP are collectively referred to as ddNTP. Further examples of terminator compounds include _{2'-PO 4 analogs of ribonucleotides.} Other uncommon nucleotides are phosphorothioate dNTPs ([[α]-S]dNTPs), 5′-[α]-borano-dNTPs, [α]-methyl-phosphonate dNTPs, and ribonucleosides. triphosphate (rNTP). Unconventional bases include radioactive isotopes such as ³² P, ³³ P, or ³⁵ S; fluorescent label; labeling of chemiluminescence; markers of bioluminescence; hapten labels such as biotin; or with an enzymatic label such as streptavidin or avidin. The fluorescent label may comprise a negatively charged dye, such as a dye of the fluorescein family, or a neutrally charged dye, such as a dye of the rhodamine family, or a positively charged dye, such as a dye of the cyanine family. Dyes of the Fluoxane family include, for example, FAM, HEX, TET, JOE, NAN and ZOE. Dyes of the rhodamine family include Texas Red, ROX, R110, R6G, and TAMRA. Various dyes or nucleotides labeled FAM, HEX, TET, JOE, NAN, ZOE, ROX, R110, R6G, Texas Red and TAMRA were obtained from Perkin-Elmer (Boston, MA), Applied Biosystems (Foster City, CA), or Invitrogen /Molecular Probes (Eugene, OR). Dyes of the cyanine family include Cy2, Cy3, Cy5, and Cy7 and are marketed by GE Healthcare UK Limited (Amersham Place, Little Chalfont, Buckinghamshire, England).

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

Hereinafter, the present invention will be described in more detail.

In the present invention, in the amino acid sequence of SEQ ID NO: 1, the 507th amino acid residue, glutamic acid (E), is substituted with lysine (K), the 536th amino acid residue, arginine (R) is substituted with lysine (K), and the 660th amino acid residue Provided is a DNA polymerase for detecting a JAK2 gene mutation, comprising a Taq polymerase in which phosphorus arginine (R) is substituted with valine (V).

The "Taq polymerase" is a thermostable DNA polymerase named after the thermophilic bacterium Thermos aquaticus and was first isolated from the bacterium. Thermos aquaticus is a bacterium that inhabits hot springs and hydrothermal vents, and Taq polymerase has been identified as an enzyme that can withstand the protein denaturation conditions (high temperature) required in the PCR process. The optimal activation temperature of Taq polymerase is 75-80 °C, and has a half-life of at least 2 hours at 92.5 °C, 40 minutes at 95 °C, and 9 minutes at 97.5 °C, and is capable of replicating 1000 base pairs of DNA within 10 seconds at 72 °C. can It lacks 3'→5' exonuclease-correcting activity, and the error rate is measured at about 1 out of 9,000 nucleotides. For example, using heat-resistant Taq, PCR can be performed at high temperatures (over 60 °C). The amino acid sequence shown in SEQ ID NO: 1 for Taq polymerase is used as a reference sequence.

In the present invention, in the amino acid sequence of SEQ ID NO: 1, the 507th amino acid residue is substituted from glutamic acid (E) to lysine (K), the 536th amino acid residue is substituted from arginine (R) to lysine (K), and the 660th amino acid is substituted. The Taq polymerase in which the residue was substituted from arginine (R) to valine (V) was named "E507K/R536K/R660V", and its amino acid sequence and nucleotide sequence are shown in SEQ ID NO: 2 and SEQ ID NO: 17, respectively.

The present invention also provides a primer set for detecting JAK2 gene mutation comprising one or more primers selected from the group consisting of SEQ ID NOs: 3 to 6.

The primer set for detecting JAK2 gene mutations of the present invention may be, for example, those described in Table 16 of Example 3, but is not limited thereto.

Preferably, the polymerase according to the present invention has excellent sensitivity for detecting JAK2 mutations, especially when used together with the primer sequences shown in Table 16.

The present invention also provides a probe for detecting JAK2 gene mutation comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 7 and 8.

In the nucleotide sequences of SEQ ID NOs: 7 and 8, a fluorophore may be labeled at the 5'-end, and a quencher may be labeled at the 3'-end.

For example, the nucleotide sequences of SEQ ID NOs: 7 and 8 are labeled with one fluorescent substance selected from the group consisting of FAM, Quasar 670 and CY5 at the 5'-end, respectively, and BHQ-1 and BHQ at the 3'-end. One kind of quenching material selected from the group consisting of -2 may be labeled.

The present invention also provides a kit for detecting JAK2 gene mutation, comprising the above-described DNA polymerase and/or primer set.

The kit of the present invention can be used for research (Research Use Only, RUO) or in vitro diagnostic (In-Vitro Diagnostic, IVD).

The kit of the present invention may be a PCR kit, and may include any reagent or other element recognized by a person skilled in the art to be used in the primer extension process.

For example, the PCR kit of the present invention comprises (a) nucleoside triphosphate; (b) reagents for quantification of binding to double-stranded DNA; (c) a polymerase blocking antibody; (d) one or more control values or control sequences; And (e) one or more templates; may further include one or more selected from the group consisting of.

According to a preferred embodiment of the present invention, the kit comprises 25 to 100 mM KCl; and 1 to 7 mM (NH ₄ ) ₂ SO ₄ ; and may further include a PCR buffer composition having a final pH of 8.0 to 9.5.

More preferably, the kit comprises 40 to 90 mM KCl; and 1 to 5 mM (NH ₄ ) ₂ SO ₄ ; and may further include a PCR buffer composition having a final pH of 8.0 to 9.0.

According to another preferred embodiment of the present invention, the kit comprises 25 to 100 mM KCl; 1-7 mM (NH ₄ ) ₂ SO ₄ ; and 5 to 50 mM of TMAC (Tetra methyl ammonium chloride), and may further include a PCR buffer composition having a final pH of 8.0 to 9.5.

More preferably, the kit comprises 40 to 90 mM KCl; 1-5 mM (NH ₄ ) ₂ SO ₄ ; and 10 to 40 mM of TMAC (Tetra methyl ammonium chloride), and may further include a PCR buffer composition having a final pH of 8.0 to 9.0.

The kit according to the present invention may further include Tris·Cl (pH 8.0 to 9.5), MaCl ₂ , Tween 20, and BSA (Bovine serum albumin) in _{addition to KCl, (NH 4} ) ₂ SO _{4 , and TMAC, and these} Concentrations of the components can be used by those skilled in the art by adjusting them within an appropriate range.

The PCR buffer composition as described above enables reliable gene mutation-specific amplification by significantly improving the activity of the DNA polymerase of the present invention.

According to a preferred embodiment of the present invention, the PCR kit can be applied to general PCR (1st generation PCR), real-time PCR (2nd generation PCR), digital PCR (3rd generation PCR) or mass array (MassARRAY).

In the PCR kit of the present invention, the digital PCR may be cast PCR (Competitive allele-specific TaqMan PCR) or Droplet digital PCR (ddPCR), and more specifically, allele-specific cast PCR or allele It may be a specific droplet digital PCR, but is not limited thereto.

The “cast PCR” is a method of detecting and quantifying rare mutations in samples containing large amounts of normal wild-type gDNA, and allele-specific TaqMan ^® qPCR is allele-specific to suppress non-specific amplification from wild-type alleles. It can be combined with gene-specific MGB blockers to produce specificity that is superior to traditional allele-specific PCR.

The “Droplet Digital PCR” is a system that divides 20 μl of PCR reaction into 20,000 droplets and amplifies them, then counts the target DNA. Depending on whether the target DNA is amplified in the droplet, the positive droplet (1) and negative droplet (0) as a digital signal, counting, calculating the target DNA copy number through Poisson distribution, and finally confirming the result in the number of copies per μl of sample It can be used for amplification and simultaneous confirmation of mutation types.

The “mass array” is a multiplexing analysis method applicable to various genome studies such as genotyping using MALDI-TOF mass spectrometer, and quickly analyzes a large number of samples and targets at a low cost It can be used in the case of wanting to perform a customized analysis for only a specific target or the like.

The kit for detecting JAK2 gene mutation of the present invention may further include a probe, a fluorophore and/or a quencher. The fluorophore may be VIC, HEX, JOE, FAM, CAL Flour Orange 560, Quasar 670, CY5 EverGreen dye, and the like, but is not limited thereto. The types of the probe sequence, the fluorophore, and the quencher may be, for example, as shown in Table 21 of Example 5, but are not limited thereto.

The kit of the present invention employs AS-PCR (Allele-specific PCR) and real-time PCR techniques, and includes a specific primer and a fluorescent probe for detecting the JAK2 V617F mutation in a peripheral blood or whole blood sample. During nucleic acid amplification, the targeted mutant DNA is matched with a base at the 3' end of the primer, amplified selectively and efficiently, and then the mutant amplicon is detected by a fluorescent probe labeled with FAM. Wild-type DNA cannot be matched with a specific primer and no amplification occurs. The kit of the present invention may consist of JAK2 V617F Master Mixture, ADPS ^TM smart DNA polymerase, JAK2 V617F positive control and distilled water without nuclease.

The kit for detecting JAK2 gene mutations of the present invention, for example, may be configured as shown in Table 1, but is not limited thereto.

Configuration main ingredient sheep JAK2 V617F Master Mixture Buffer containing dNTPs, primers/probes for JAK2 V617F and IC 240 μL/tube Х1 ADPS ^TM Smart DNA Polymerase ADPS ^TM Smart DNA Polymerase 20 μL/tube Х1 JAK2 V617F positive control Recombinant plasmid (JAK2 V617F) 60 μL/tube Х1 Nuclease-free distilled water PCR grade distilled water (for control without template, NTC) 1000 μL/tube Х1

An exemplary configuration of each JAK2 Master Mixture of Table 1 is shown in Table 2.

final concentration JAK2 V617F Master Mixture 5X ADPS PCR Buffer Tris Cl (pH 8.8) 50 mM MgCl ₂ 2.5 mM KCl 60 mM (NH ₄ ) ₂ SO ₄ 2.5 mM TMAC 25 mM Tween 20 0.1% BSA 0.01% dNTP 0.25 mM each Primer/Probe specific concentration ROX standard dye 0.125X

Table 3 shows the detection information of JAK2 V617F Master Mixture.

reagent detection mutation fluorescence signal FAM Quasar 670 ^** JAK2 V617F Master Mixture V617F V617F IC ^*

*IC: Internal control for PCR **Replaceable dye: Quasar 670 (CY5) The present invention also provides a method for detecting a JAK2 gene mutation comprising the steps of:

(a) extracting nucleic acids from the isolated biological sample;

(b) performing a polymerase chain reaction by treating the extracted nucleic acid with the kit of the present invention; and

(c) confirming the result of the PCR amplification with fluorescence.

According to a preferred embodiment of the present invention, the PCR may be allele-specific PCR or real-time PCR.

The JAK2 gene mutation detection method of the present invention may further include (d) confirming the PCR amplification result by measuring a cycle threshold (Ct) value.

The cycle threshold (Ct) value means the number of cycles in which fluorescence generated in the reaction exceeds a threshold, which is inversely proportional to the logarithm of the initial copy number. Therefore, the Ct value assigned to a particular well reflects the number of cycles in which a sufficient number of amplicons in the reaction have accumulated. The Ct value is the cycle in which an increase in ΔRn was first detected. Rn denotes the magnitude of the fluorescence signal generated during PCR at each time point, and ΔRn denotes the fluorescence emission intensity of the reporter dye (normalized reporter signal) divided by the fluorescence emission intensity of the reference dye. The Ct value is also called Cp (crossing point) in LightCycler. The Ct value represents the point at which the system begins to detect an increase in fluorescence signal associated with exponential growth of the PCR product in the log-linear phase. This period provides the most useful information about the reaction. The slope of the log-linear step represents the amplification efficiency (Eff) (http://www.appliedbiosystems.co.kr/).

On the other hand, TaqMan probes typically contain a primer (e.g., 20-) comprising a fluorophore at the 5'-end and a quencher (e.g., TAMRA or non-fluorescence quencher (NFQ)) at the 3'-end. oligonucleotides longer than 30 nucleotides). The excited fluorescent material transfers energy to a nearby quenching material rather than fluorescing it (FRET = Frster or fluorescence resonance energy transfer; Chen, X., et al., Proc Natl Acad Sci USA, 94(20): 10756- 61 (1997)). Therefore, when the probe is normal, no fluorescence is generated. TaqMan probes are designed to anneal to the internal sites of PCR products.

The TaqMan probe specifically hybridizes to the template DNA during the annealing step, but fluorescence is suppressed by the quencher on the probe. During the extension reaction, the TaqMan probe hybridized to the template is decomposed by the 5' to 3' nuclease activity of Taq DNA polymerase, and the fluorescent dye is released from the probe, the inhibition by the quencher is released, and fluorescence is displayed. In this case, the 5'-end of the TaqMan probe should be located downstream of the 3'-end of the extension primer. That is, when the 3'-terminus of the extension primer is extended by a template-dependent nucleic acid polymerase, the 5'-end of the TaqMan probe is cleaved by the 5' to 3' nuclease activity of this polymerase to form a reporter molecule. A fluorescence signal is generated.

The reporter molecule and quencher molecule bound to the TaqMan probe include a fluorescent material and a non-fluorescent material. Fluorescent reporter molecules and quencher molecules that can be used in the present invention can be any known in the art, examples of which are as follows (numbers in parentheses are the maximum emission wavelength in nanometers): Cy2 ^TM (506), YOPRO ^TM -1 (509), YOYO ^TM -1 (509), Calcein (517), FITC (518), FluorX ^TM (519), Alexa ^TM (520), Rhodamine 110 (520), 5-FAM (522), Oregon Green ^TM 500 (522), Oregon Green ^TM 488 (524), RiboGreen ^TM (525), Rhodamine Green ^TM (527), Rhodamine 123 (529), Magnesium Green ^TM (531), Calcium Green ^TM (533), TO-PRO ^TM -1 (533), TOTO1 (533), JOE (548), BODIPY530/550 (550), Dil (565), BODIPY TMR (568), BODIPY558/568 (568) , BODIPY564/570 (570), Cy3 ^™ (570), Alexa ^™ 546 (570), TRITC (572), Magnesium Orange ^™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange ^™ (576) ), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red ^™ (590), Cy3.5 ^™ (596), ROX (608), Calcium Crimson ^™ (615), Alexa ^™ 594 ( 615), Texas Red (615), Nile Red (628), YO-PRO ^TM -3 (631), YOYO ^TM -3 (631), R-phycocyanin (642), CPhycocyanin (648), TO-PRO ^TM - 3 (660), TOTO3 (660), DiD DilC (5) (665), Cy5 ^TM (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), VIC (546), BHQ-1 ( 534), BHQ-2 (579), BHQ-3 (672), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705) and Quasar 705 (610). The number in parentheses is the maximum emission wavelength expressed in nanometers.

Suitable reporter-quencher pairs are disclosed in many literatures: Pesce et al., editors, FLUORESCENCE SPECTROSCOPY (Marcel Dekker, New York, 1971); White et al., FLUORESCENCE ANALYSIS: A PRACTICAL APPROACH (Marcel Dekker, New York, 1970); Berlman, HANDBOOK OF FLUORESCENCE SPECTRA OF AROMATIC MOLECULES, 2 ^nd EDITION (Academic Press, New York, 1971); Griffiths, COLOR AND CONSTITUTION OF ORGANIC MOLECULES (Academic Press, New York, 1976); Bishop, editor, INDICATORS (Pergamon Press, Oxford, 1972); Haugland, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS (Molecular Probes, Eugene, 1992); Pringsheim, FLUORESCENCE AND PHOSPHORESCENCE (Interscience Publishers, New York, 1949); Haugland, RP, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS, Sixth Edition, Molecular Probes, Eugene, Oreg., 1996; US Pat. Nos. 3,996,345 and 4,351,760.

In addition, the non-fluorescent material used for the reporter molecule and the quencher molecule bound to the TaqMan probe may include a minor groove binding (MGB) moiety. As used herein, the term "TaqMan MGB-conjugate probe" refers to a TaqMan probe conjugated with MGB at the 3'-end of the probe.

MGB is a substance that binds to the minor groove of DNA with high affinity. olivomycin, anthramycin, sibiromycin, pentamidine, stilbamidine, berenil, CC-1065, Hoechst 33258, DAPI (4-6 diamidino-2-phenylindole), dimers, trimers, tetramers and pentamers of CDPI, N-methylpyrrole-4-carbox-2-amide (MPC) and dimers, trimers, tetramers and pentamers thereof. it's not going to be

Conjugation of the probe and MGB significantly increases the stability of the hybrid formed between the probe and its target. More specifically, increased stability (ie, increased degree of hybridization) results in an increased melting temperature (Tm) of the hybrid duplex formed by the MGB-conjugated probe compared to the normal probe. Therefore, MGB stabilizes the van der Waals force to increase the melting temperature (Tm) of the MGB-conjugated probe without increasing the probe length, resulting in shorter probes (e.g., 21 nucleotides or less) in Taqman real-time PCR under more stringent conditions. makes the use of

In addition, the MGB-conjugated probe removes the background fluorescence more efficiently. Accordingly, the probe of the present invention may be in the form of a TaqMan MGB-conjugate, wherein the length of the probe includes, but is not limited to, 15-21 nucleotides.

According to a preferred embodiment of the present invention, the JAK2 gene mutation may include one or more selected from the group consisting of deletion, substitution, and insertional mutation of codon 617 in exon 14 of the JAK2 gene.

Specifically, the JAK2 gene mutation may include a substitution of valine, an amino acid at codon 617 of exon 14 of the JAK2 gene.

For example, the JAK2 gene mutation detection method of the present invention can detect the V617F mutation shown in Table 4 at codon 617 of the JAK2 gene.

exons mutation JAK2 nucleic acid sequence COSMIC ID exon 14 V617F 1849G>T 12600

In the JAK2 gene mutation detection method of the present invention, the target sequence may be present in the sample of step (a), and includes DNA, cDNA or RNA, preferably genomic DNA. The test sample may be contained in an animal, preferably a vertebrate, more preferably a human subject. For example, the biological sample of step (a) may be sputum, blood, saliva or urine, and the nucleic acid of step (a) may be extracted from bone marrow tissue biopsy or liquid biopsy. Detection of JAK2 gene mutation of the present invention Methods may include melting temperature analysis using double stranded specific dyes.

Melting temperature curve analysis can be performed on a real-time PCR instrument such as an ABI 5700/7000 (96 well format) or ABI 7900 (384 well format) instrument with onboard software (SDS 2.1). Alternatively, melting temperature curve analysis can be performed as an endpoint analysis.

"Dye that binds to double-stranded DNA" or "double-strand-specific dye" can be used when it has higher fluorescence when bound to double-stranded DNA than in an unbound state. Examples of such dyes include SOYTO-9, SOYTO-13, SOYTO-16, SOYTO-60, SOYTO-64, SYTO-82, ethidium bromide (EtBr), SYTOX Orange, TO-PRO-1, SYBR Green I, TO-PRO-3 or EvaGreen. Except for EtBr and EvaGreen (Quiagen), these dyes have been tested for real-time applications.

The JAK2 gene mutation detection method of the present invention is real-time PCR (Real-time PCR) or quantitative PCR (qPCR), analysis on an agarose gel after standard PCR, gene mutation-specific amplification or allele-specific amplification through real-time PCR , tetra-primer amplification-refractory mutation system PCR or isothermal amplification.

The "standard PCR" is a technique for amplifying single or several copies of DNA or cDNA known to those skilled in the art. Almost all PCR uses a thermostable DNA polymerase such as Taq polymerase or Klen Taq. DNA polymerase uses single-stranded DNA as a template and enzymatically assembles new DNA strands from nucleotides by using oligonucleotides (primers). Amplicons generated by PCR can be analyzed, for example, on an agarose gel.

The "real-time PCR" can monitor the process in real time when performing PCR. Thus, data is collected throughout the PCR process, not at the end of the PCR. In real-time PCR, the reaction is characterized by the time point during the cycle when amplification is first detected rather than the amount of target accumulated after a fixed number of cycles. Two methods are mainly used to perform quantitative PCR: dye-based detection and probe-based detection.

The "Allele Specific Amplification (ASA)" is an amplification technique in which PCR primers are designed to discriminate between templates having different single nucleotide residues.

The "gene mutation-specific amplification or allele-specific amplification through real-time PCR" detects a gene mutation or SNP in a very efficient way. Unlike most other methods for detecting genetic mutations or SNPs, preliminary amplification of the target genetic material is not required. ASA combines amplification and detection in a single reaction based on discrimination of matched and mismatched primer/target sequence complexes. The increase in amplified DNA during the reaction can be monitored in real time as an increase in the fluorescence signal caused by dyes such as SYBR Green I, which emit light upon binding to double-stranded DNA. Gene mutation-specific amplification or allele-specific amplification via real-time PCR shows a delay or absence of a fluorescence signal for mismatched cases. In the detection of genetic mutations or SNPs, this provides information on the presence or absence of genetic mutations or SNPs.

The "tetra-primer amplification-refractory mutation system PCR" amplifies both wild-type and mutant alleles together with control fragments in a single tube PCR reaction. A non-allele specific control amplicon is amplified by two common (outer) primers flanking the mutant region. The two allele-specific (inside) primers are designed in opposite directions to the common primer, and together with the common primer, both wild-type and mutant amplicons can be amplified simultaneously. Consequently, the two allele-specific amplicons have different lengths because the mutations are located asymmetrically with respect to the common (outer) primer and can be easily separated by standard gel electrophoresis. This control amplicon provides an internal control for false negatives as well as amplification failures and at least one of the two allele-specific amplicons is always present in the tetra-primer amplification-refractory mutation system PCR.

The above "isothermal amplification" means that the amplification of a nucleic acid is performed at a lower temperature, without relying on a thermocycler, and preferably without having to change the temperature during amplification. The temperature used in the isothermal amplification may be between room temperature (22-24 °C) and about 65 °C, or between about 60-65 °C, 45-50 °C, 37-42 °C, or 22-24 °C. The product of the isothermal amplification result is gel electrophoresis, ELISA, ELOSA (Enzyme linked oligosorbent assay), real-time PCR, ECL (enhanced chemiluminescence), RNA, DNA, and a chip-based capillary electrophoresis device that analyzes proteins or turbidity. It can be detected with a bioanalyzer.

When the JAK2 gene mutation detection method of the present invention is performed by qPCR, for example, it may be performed under the conditions of Tables 19 to 22.

The DNA polymerase, primer set, probe and/or kit for detecting JAK2 gene mutation of the present invention can be used for diagnosing myeloproliferative neoplasms.

Accordingly, the present invention may provide a DNA polymerase, primer set, probe and/or kit for detecting a JAK2 gene mutation for the diagnosis of myeloproliferative neoplasm.

The present invention may also provide an information providing method for the diagnosis of myeloproliferative neoplasm using the aforementioned DNA polymerase, primer set, probe and/or kit.

According to a preferred embodiment of the present invention, the myeloproliferative neoplasm may be one or more selected from the group consisting of polycythemia vera, essential thrombocythemia, and primary myelofibrosis (PMF).

The JAK2 gene mutation detection method of the present invention provides information for diagnosing myeloproliferative neoplasm at an early stage by detecting the JAK2 V617F mutation and establishing a treatment strategy for each patient, thereby contributing to more effective treatment of patients do.

The DNA polymerase, primer set, probe and/or kit for detecting JAK2 gene mutation of the present invention can be used for diagnosis, prognosis, and drug reactivity prediction method for all applicable diseases by detecting JAK2 V617F mutation.

In the present invention, the term “prognosis” refers to an act of predicting the course and outcome of a disease in advance. More specifically, prognosis prediction means that the course of disease after treatment may vary depending on the physiological or environmental condition of the patient, and it is interpreted to mean any act of predicting the course of the disease after treatment by comprehensively considering the condition of the patient. can be

The prognosis prediction may be interpreted as an act of predicting disease-free survival or survival rate of a patient by predicting in advance whether the disease will progress and be cured after treatment of a specific disease. For example, predicting “good prognosis” indicates that the patient has a high level of disease-free survival or survival rate after treatment of the disease, meaning that the patient is more likely to be cured, and predicting “poor prognosis” indicates that the disease has a high level of survival. The disease-free survival rate or survival rate of the patient after treatment of the drug shows a low level, which means that the disease is highly likely to recur or to die due to the disease.

As used herein, the term “disease-free survival rate” refers to the possibility that a patient can survive without recurrence of a disease after treatment for a specific disease.

As used herein, the term "survival rate" refers to the possibility that a patient can survive regardless of whether the disease recurs after treatment of a specific disease.

Hereinafter, the present invention will be described in more detail by way of Examples. These examples are merely for illustrating the present invention in more detail, and thereby it will be apparent to those skilled in the art that the technical scope of the present invention is not limited to these examples.

Mutagenesis of Taq Polymerase

1-1. fragment PCR

In this example, Taq DNA polymerase in which the 536th amino acid residue in the amino acid sequence of SEQ ID NO: 1 is substituted from arginine to lysine (hereinafter referred to as "R536K"), Taq DNA polymerase in which the 660th amino acid residue is substituted from arginine to valine (hereinafter referred to as "R660V") and Taq DNA polymerase in which the 536th amino acid residue was substituted from arginine to lysine and the 660th amino acid residue was substituted from arginine to valine (hereinafter referred to as "R536K/R660V") was prepared as follows did.

First, Taq DNA polymerase fragments (F1 to F5) were amplified by PCR using the mutation-specific primers shown in Table 5 as shown in (a) of FIG. 1 . Reaction conditions are shown in Table 6.

primer sequence (5'→3') SEQ ID NO: Eco-F GG GGTACC TCA TCA CCC CGG 9 R536K-R CTT GGT GAG CTC CTT GTA CTG CAG GAT 10 R536K-F ATC CTG CAG TAC AAG GAG CTC ACC AAG 11 R660V-R GAT GGT CTT GGC CGC CAC GCG CAT CAG GGG 12 R660V-F CCC CTG ATG CGC GTG GCG GCC AAG ACC ATC 13 Xba-R GC TCTAGA CTA TCA CTC CTT GGC GGA GAG CCA 14

10xpfu buffer (Solgent) 2.5 μl dNTPs (10 mM each) 1 μl F primer 1 μl R primer 1 μl Distilled water 18 μl pUC19-Taq (10 ng/μl) 1 μl Pfu polymerase 0.5 μl 30 cycles (Ta=60℃) 25 μl

As a result of confirming the PCR product on electrophoresis, as shown in FIG.

1-2. overlap PCR

Using each of the fragments amplified in 1-1 as a template, the full length was amplified using primers (Eco-F and Xba-R primers) at both ends. Reaction conditions are shown in Tables 7 and 8.

R660V or R536K 10xpfu buffer (Solgent) 5 μl 5x Enhancer (Solgent) 10 μl dNTPs (10 mM each) 1 μl Eco-F primer (10 pmol/μl) 2 μl Xba-R primer (10 pmol/μl) 2 μl Distilled water 27 μl Fragment 1 (or Fragment 3) 1 μl Fragment 2 (or Fragment 4) 1 μl Pfu polymerase 1 μl 40 cycles (Ta=62℃) 50 μl

R536K/R660V 10xpfu buffer (Solgent) 5 μl 5x Enhancer (Solgent) 10 μl dNTPs (10 mM each) 1 μl Eco-F primer (10 pmol/μl) 2 μl Xba-R primer (10 pmol/μl) 2 μl Distilled water 26 μl Fragment 2 1 μl Fragment 3 1 μl Fragment 5 1 μl Pfu polymerase 1 μl 40 cycles (Ta=62℃) 50 μl

As a result, it was confirmed that the Taq polymerase of "R536K", "R660V" and "R536K/R660V" was amplified as shown in FIG.

1-3. ligation

pUC19 was digested with restriction enzymes EcoRI/XbaI at 37°C for 4 hours under the conditions of Table 9 below, and then the DNA was purified and the purified DNA was treated with SAP at 37°C for 1 hour under the conditions of Table 10 to prepare a vector. .

10xCutSmart Buffer (NEB) 2.5 μl pUC19 (500 ng/μl) 21.5 μl EcoRI-HF (NEB) 0.5 μl XbaI (NEB) 0.5 μl 25 μl

10xSAP buffer (Roche) 2 μl purified DNA 17 μl SAP (Roche) 1 μl 20 μl

In the case of insert, the overlap PCR product of Example 1-2 was purified, digested with restriction enzymes EcoRI/XbaI for 3 hours at 37°C under the conditions of Table 11, and then gel-extracted with the prepared vector (FIG. 2). ).

10xCutSmart Buffer (NEB) 2 μl Purified PCR product 17 μl EcoRI-HF (NEB) 0.5 μl XbaI (NEB) 0.5 μl 20 μl

After ligation at room temperature (RT) for 2 hours under the conditions shown in Table 12, E. coli DH5α was transformed and selected in a medium containing ampicillin. The plasmids prepared from the obtained colonies were sequenced to obtain Taq DNA polymerase mutants ("R536K", "R660V" and "R536K/R660V") into which the desired mutation was introduced.

vector sole vector+insert 10x ligase buffer (Solgent) 1 μl 1 μl vector 1 μl 1 μl insert - 3 μl Distilled water 7 μl 4 μl T4 DNA ligase (Solgent) 1 μl 1 μl 10 μl 10 μl

Introduction of E507K mutation

2-1. fragment PCR

As a result of testing the Taq polymerase activity of "R536K", "R660V" and "R536K / R660V" prepared in Example 1, it was confirmed that the activity was lowered (data not shown), R536K, R660V, R536K / R660V, respectively In addition to the E507K mutation (substitution of the 507th amino acid residue in the amino acid sequence of SEQ ID NO: 1 from glutamic acid to lysine) was introduced, and E507K mutation was also introduced in wild-type Taq DNA polymerase (WT) for use as a control. The preparation method of Taq DNA polymerase into which E507K mutation is introduced is the same as in Example 1.

Taq DNA polymerase fragments (F6 to F7) were amplified by PCR as shown in FIG. 3 using the mutation-specific primers shown in Table 13. Reaction conditions are shown in Table 14.

primer sequence (5'→3') SEQ ID NO: Eco-F GG GGTACC TCA TCA CCC CGG 9 E507K-R CTT GCC GGT CTT TTT CGT CTT GCC GAT 15 E507K-F ATC GGC AAG ACG AAA AAG ACC GGC AAG 16 Xba-R GC TCTAGA CTA TCA CTC CTT GGC GGA GAG CCA 14

10xpfu buffer (Solgent) 2.5 μl dNTPs (10 mM each) 1 μl F primer (10 pmol/μl) 1 μl R primer (10 pmol/μl) 1 μl Distilled water 18 μl Template plasmid (10 ng/μl) 1 μl Pfu polymerase 0.5 μl 30 cycles (Ta=60℃) 25 μl

*Template plasmid: pUC19-Taq (WT)

pUC19-Taq (R536K)

pUC19-Taq (R660V)

pUC19-Taq (R536K/R660V)

2-2. overlap PCR

Using each of the fragments amplified in 2-1 above as a template, the full length was amplified using primers at both ends (Eco-F and Xba-R primers). Reaction conditions are shown in Table 15.

10xpfu buffer (Solgent) 5 μl 5x Enhancer (Solgent) 10 μl dNTPs (10 mM each) 1 μl Eco-F primer (10 pmol/μl) 2 μl Xba-R primer (10 pmol/μl) 2 μl Distilled water 27 μl Fragment 6 1 μl Fragment 7 1 μl Pfu polymerase 1 μl 40 cycles (Ta=62℃) 50 μl

2-3. Ligation pUC19 was digested with restriction enzymes EcoRI/XbaI for 4 hours at 37°C under the conditions of Table 9, and then the DNA was purified, and the purified DNA was treated with SAP at 37°C for 1 hour under the conditions of Table 10 to obtain a vector. prepared.

In the case of insert, the overlap PCR product of Example 2-2 was purified, digested with restriction enzymes EcoRI/XbaI for 3 hours at 37°C under the conditions of Table 11, and then gel-extracted with the prepared vector (FIG. 4). ).

After ligation at room temperature (RT) for 2 hours under the conditions shown in Table 12, E. coli DH5α or DH10β was transformed and selected in a medium containing ampicillin. The plasmids prepared from the obtained colonies were sequenced to obtain Taq DNA polymerase mutants into which E507K mutations were introduced ("E507K/R536K", "E507K/R660V" and "E507K/R536K/R660V").

Preparation of primer sets

Primer size using the OligoAnalyzer Tool (https://sg.idtdna.com/calc/analyzer ) program to design primers that generate PCR products for the mutation of the JAK2 gene (V617F) but not the wild-type JAK2 gene. , Tm value, primer GC content, and whether or not there is a self-complementary sequence in the primer to exclude the possibility of forming a secondary structure. designed.

mutant group primer sequence (5'-3') SEQ ID NO: Tm (Bionics) GC
(%) Oligo length
(mer) final concentration (nM) JAK2 V617F V617F SF3 CAA GTA TGA TGA GCA AGC TTT CTC 3 54.4 41.7 24 200 V617F Rmt21(-3T) CTT ACT CTC GTC TCC ACT GAA 4 54.1 47.6 21 600 JAK2 IC JAK2 Ex4 IC_F GAT CCA GTT CTT CAG GTG TAT CTT 5 54.5 41.7 24 50 JAK2 Ex4 IC_R CCC AGA TGG AAA GGT CAG ATA AT 6 54.7 43.5 23 50

Sample preparation

Mutant plasmid preparation

Using the gDNA of the HEK293T cell line, which is the wild-type DNA of JAK2, a primer set capable of amplifying the surrounding region of the target mutation in Table 4 was applied to prepare a wild-type clone of codon 617. By using the prepared wild-type DNA, mutagenesis was performed on the V617F mutation, and the E.Coli DH5α cells were transformed to obtain a mutant clone. Identification of wild-type clones and mutant clones was confirmed by direct sequencing. The wild-type DNA and mutant DNA of codon 617 extracted through the clone were used as standards for evaluating the performance of the JAK2 V617F mutation detection kit.

As shown in Table 17, samples were prepared by adding 30,000, 3,000, 300, 30, or 3 copies of V617F mutant plasmid per 30,000 copies of HEK293T cell genomic DNA, and the WT group to which the mutant plasmid was not added was used as a control.

group sample WT 30,000 copies of HEK293T cell genomic DNA WT+Mut 3 X 10 ⁴ 30,000 copies of HEK293T cell genomic DNA + 30,000 copies of V617F mutant plasmid WT+Mut 3 X 10 ³ 30,000 copies of HEK293T cell genomic DNA + 3,000 copies of V617F mutant plasmid WT+Mut 3 X 10 ² 30,000 copies of HEK293T cell genomic DNA + 300 copies of V617F mutant plasmid WT+Mut 3 X 10 ¹ 30,000 copies of HEK293T cell genomic DNA + 30 copies of V617F mutant plasmid WT+Mut 3 X 10 ⁰ 30,000 copies of HEK293T cell genomic DNA + 3 copies of V617F mutant plasmid

JAK2 mutation detection

JAK2 V617F mutations were detected from each group in Table 17 by using the Taq polymerase (SEQ ID NO: 2) each containing the "E507K/R536K/R660V" mutation obtained in Example 2 and the primer set of Example 3. Table 18 shows mutation information targeted by JAK2 V617F Master Mixture.

MMX Neon mutant group exons JAK2 nucleic acid sequence (COSMIC ID) JAK2 V617F Master Mixture FAM V617F exon 14 G1849T (12600)

Specific qPCR (Applied Biosystems 7500 Fast) experimental conditions are shown in Tables 19 to 22 below, and the probes were double-labeled as shown in Table 21.

2X JAK2 V617F Master Mixture 10.0 μl ADPS Smart DNA Polymerase (1 U/ul) 0.5 μl Sample (mutant plasmid DNA) 5.0 μl *WT gDNA (HEK293T, 3×10 ⁴ copies) 2.0 μl Nuclease-free distilled water 2.5 μl gun 20.0 μl

2X JAK2 V617F Master Mixture 10.0 μl ADPS Smart DNA Polymerase (1 U/ul) 0.5 μl *WT gDNA or **NTC 2.0 μl Nuclease-free distilled water 5.5 μl gun 20.0 μl

*WT gDNA: HEK239T

**NTC: no template control (distilled water without nuclease)

mutant group probe sequence (5'-3') SEQ ID NO: 5' fluorophore 3' matting material Final concentration (nM) JAK2 V617F V617F FAM_R(nova) ACATACTCC-Nova-ATAATTTTAAAACCAAATGCTTG 7 FAM BHQ1 400 JAK2 IC JAK2 Ex4 IC_QS670 CCATTCCCTTGGGAAATCTGAGGCA 8 Quasar 670 BHQ2 200

step cycle Temperature hour data collection One One 95℃ 5 minutes -
2

45
　 95℃ 10 seconds - 58℃ 30 seconds FAM /
Quasar670 (CY5) 72℃ 10 seconds -

Sufficient JAK2 reaction mixtures containing the ADPS smart DNA polymerases listed in Tables 19 and 20, JAK2 Master Mixture, were prepared in separate sterile centrifuge tubes, respectively, and the reaction Master Mixture was vortexed for 3 seconds to mix thoroughly and centrifuged briefly. . Two PCR tubes were prepared for each sample as follows: 10.0 µL of JAK2 V617F reaction mixture was divided for each PCR tube, 5.0 µL of each sample DNA was added to each sample tube, and then the PCR tube was capped. . One PCR tube was prepared for the positive control as follows: 10.0 μL of the JAK2 V617F reaction mixture was divided for the PCR tube, 5.0 μL of the positive control was added to the sample tube, and then the PCR tube was capped. Nuclease-free distilled water was added up to 20.0 μL to all PCR tubes, and PCR strips were briefly centrifuged to collect all liquid at the bottom of each PCR tube. A PCR strip tube was placed in a real-time PCR (real-time PCR) machine, and a PCR protocol was set using the cycling parameters in Table 22, and then PCR was performed. After completion of PCR, the FAM/Quasar 670 ΔCt values of each sample were recorded for data analysis, and the Ct values per well were calculated as follows:

ΔCt value = sample Ct value (FAM) - positive control Ct value (FAM)

ΔCt cutoff value: ΔCt < 19.5

The results for each tube were interpreted according to the cutoff ΔCt values in Table 23. If the ΔCt value is < the cutoff ΔCt value, the sample is judged positive, if there is no FAM signal and the sample has a Ct value of 44 < Ct, the sample is judged negative, and if the ΔCt value is ≥ ΔCt cutoff value, the sample is negative or detectable It is judged to be below the limit (LoD).

determine the outcome JAK2 V617 Master Mixture decision FAM Quasar670 (Cy5) Positive control Ct value Ct < 24.5, Ct > 28 - invalidity Internal Control Ct Values - Ct < 23.5, Ct > 27.5 invalidity Sample Ct value Ct < 24.0 invalidity 24.0 ≤Ct < 45.0 positivity 45 ≤ Ct voice no signal voice ΔCt cutoff value ΔCt < 19.5 positivity

As a result of analyzing the data as described above, as shown in FIG. 5 , no fluorescence signal was detected in the WT group, but a fluorescence signal was detected in the sample containing the JAK2 V617F mutation, and as shown in Table 24, up to 0.01% (30,000 It was confirmed that it was possible to detect the JAK2 V617F mutation with high sensitivity of 3 mutant copies in the wild-type copy).

codon mutation base change COSMIC ID LoD (copy) Detection sensitivity (%) 617 V617F G1849T 12600 3 0.01

SEQUENCE LISTING <110> GeneCast Co., Ltd. <120> DNA polymerase for detecting JAK2 mutation and kit comprising the same <130> 1066883 <150> KR 10-2019-0004221 <151> 2019-01-11 <160> 17 <170> PatentIn version 3.2 <210> 1 <211> 832 <212> PRT <213> <220> <223> Thermus aquaticus DNA polymerase (Taq) <400> 1 Met Arg Gly Met Leu Pro Leu Phe Glu Pro Lys Gly Arg Val Leu Leu 1 5 10 15 Val Asp Gly His His Leu Ala Tyr Arg Thr Phe His Ala Leu Lys Gly 20 25 30 Leu Thr Thr Ser Arg Gly Glu Pro Val Gln Ala Val Tyr Gly Phe Ala 35 40 45 Lys Ser Leu Leu Lys Ala Leu Lys Glu Asp Gly Asp Ala Val Ile Val 50 55 60 Val Phe Asp Ala Lys Ala Pro Ser Phe Arg His Glu Ala Tyr Gly Gly 65 70 75 80 Tyr Lys Ala Gly Arg Ala Pro Thr Pro Glu Asp Phe Pro Arg Gln Leu 85 90 95 Ala Leu Ile Lys Glu Leu Val Asp Leu Leu Gly Leu Ala Arg Leu Glu 100 105 110 Val Pro Gly Tyr Glu Ala Asp Asp Val Leu Ala Ser Leu Ala Lys Lys 115 120 125 Ala Glu Lys Glu Gly Tyr Glu Val Arg Ile Leu Thr Ala Asp Lys Asp 130 135 140 Leu Tyr Gln Leu Leu Ser Asp Arg Ile His Val Leu His Pro Glu Gly 145 150 155 160 Tyr Leu Ile Thr Pro Ala Trp Leu Trp Glu Lys Tyr Gly Leu Arg Pro 165 170 175 Asp Gln Trp Ala Asp Tyr Arg Ala Leu Thr Gly Asp Glu Ser Asp Asn 180 185 190 Leu Pro Gly Val Lys Gly Ile Gly Glu Lys Thr Ala Arg Lys Leu Leu 195 200 205 Glu Glu Trp Gly Ser Leu Glu Ala Leu Leu Lys Asn Leu Asp Arg Leu 210 215 220 Lys Pro Ala Ile Arg Glu Lys Ile Leu Ala His Met Asp Asp Leu Lys 225 230 235 240 Leu Ser Trp Asp Leu Ala Lys Val Arg Thr Asp Leu Pro Leu Glu Val 245 250 255 Asp Phe Ala Lys Arg Arg Glu Pro Asp Arg Glu Arg Leu Arg Ala Phe 260 265 270 Leu Glu Arg Leu Glu Phe Gly Ser Leu Leu His Glu Phe Gly Leu Leu 275 280 285 Glu Ser Pro Lys Ala Leu Glu Glu Ala Pro Trp Pro Pro Glu Gly 290 295 300 Ala Phe Val Gly Phe Val Leu Ser Arg Lys Glu Pro Met Trp Ala Asp 305 310 315 320 Leu Leu Ala Leu Ala Ala Ala Arg Gly Gly Arg Val His Arg Ala Pro 325 330 335 Glu Pro Tyr Lys Ala Leu Arg Asp Leu Lys Glu Ala Arg Gly Leu Leu 340 345 350 Ala Lys Asp Leu Ser Val Leu Ala Leu Arg Glu Gly Leu Gly Leu Pro 355 360 365 Pro Gly Asp Asp Pro Met Leu Leu Ala Tyr Leu Leu Asp Pro Ser Asn 370 375 380 Thr Thr Pro Glu Gly Val Ala Arg Arg Tyr Gly Gly Glu Trp Thr Glu 385 390 395 400 Glu Ala Gly Glu Arg Ala Ala Leu Ser Glu Arg Leu Phe Ala Asn Leu 405 410 415 Trp Gly Arg Leu Glu Gly Glu Glu Arg Leu Leu Trp Leu Tyr Arg Glu 420 425 430 Val Glu Arg Pro Leu Ser Ala Val Leu Ala His Met Glu Ala Thr Gly 435 440 445 Val Arg Leu Asp Val Ala Tyr Leu Arg Ala Leu Ser Leu Glu Val Ala 450 455 460 Glu Glu Ile Ala Arg Leu Glu Ala Glu Val Phe Arg Leu Ala Gly His 465 470 475 480 Pro Phe Asn Leu Asn Ser Arg Asp Gln Leu Glu Arg Val Leu Phe Asp 485 490 495 Glu Leu Gly Leu Pro Ala Ile Gly Lys Thr Glu Lys Thr Gly Lys Arg 500 505 510 Ser Thr Ser Ala Ala Val Leu Glu Ala Leu Arg Glu Ala His Pro Ile 515 520 525 Val Glu Lys Ile Leu Gln Tyr Arg Glu Leu Thr Lys Leu Lys Ser Thr 530 535 540 Tyr Ile Asp Pro Leu Pro Asp Leu Ile His Pro Arg Thr Gly Arg Leu 545 550 555 560 His Thr Arg Phe Asn Gln Thr Ala Thr Ala Thr Gly Arg Leu Ser Ser 565 570 575 Ser Asp Pro Asn Leu Gln Asn Ile Pro Val Arg Thr Pro Leu Gly Gln 580 585 590 Arg Ile Arg Arg Ala Phe Ile Ala Glu Glu Gly Trp Leu Leu Val Ala 595 600 605 Leu Asp Tyr Ser Gln Ile Glu Leu Arg Val Leu Ala His Leu Ser Gly 610 615 620 Asp Glu Asn Leu Ile Arg Val Phe Gin Glu Gly Arg Asp Ile His Thr 625 630 635 640 Glu Thr Ala Ser Trp Met Phe Gly Val Pro Arg Glu Ala Val Asp Pro 645 650 655 Leu Met Arg Arg Ala Ala Lys Thr Ile Asn Phe Gly Val Leu Tyr Gly 660 665 670 Met Ser Ala His Arg Leu Ser Gln Glu Leu Ala Ile Pro Tyr Glu Glu 675 680 685 Ala Gln Ala Phe Ile Glu Arg Tyr Phe Gln Ser Phe Pro Lys Val Arg 690 695 700 Ala Trp Ile Glu Lys Thr Leu Glu Glu Gly Arg Arg Arg Gly Tyr Val 705 710 715 720 Glu Thr Leu Phe Gly Arg Arg Arg Tyr Val Pro Asp Leu Glu Ala Arg 725 730 735 Val Lys Ser Val Arg Glu Ala Ala Glu Arg Met Ala Phe Asn Met Pro 740 745 750 Val Gln Gly Thr Ala Ala Asp Leu Met Lys Leu Ala Met Val Lys Leu 755 760 765 Phe Pro Arg Leu Glu Glu Met Gly Ala Arg Met Leu Leu Gln Val His 770 775 780 Asp Glu Leu Val Leu Glu Ala Pro Lys Glu Arg Ala Glu Ala Val Ala 785 790 795 800 Arg Leu Ala Lys Glu Val Met Glu Gly Val Tyr Pro Leu Ala Val Pro 805 810 815 Leu Glu Val Glu Val Gly Ile Gly Glu Asp Trp Leu Ser Ala Lys Glu 820 825 830 <210> 2 <211> 832 <212> PRT <213> <220> <223> Taq E507K/R536K/R660V <400> 2 Met Arg Gly Met Leu Pro Leu Phe Glu Pro Lys Gly Arg Val Leu Leu 1 5 10 15 Val Asp Gly His His Leu Ala Tyr Arg Thr Phe His Ala Leu Lys Gly 20 25 30 Leu Thr Thr Ser Arg Gly Glu Pro Val Gln Ala Val Tyr Gly Phe Ala 35 40 45 Lys Ser Leu Leu Lys Ala Leu Lys Glu Asp Gly Asp Ala Val Ile Val 50 55 60 Val Phe Asp Ala Lys Ala Pro Ser Phe Arg His Glu Ala Tyr Gly Gly 65 70 75 80 Tyr Lys Ala Gly Arg Ala Pro Thr Pro Glu Asp Phe Pro Arg Gln Leu 85 90 95 Ala Leu Ile Lys Glu Leu Val Asp Leu Leu Gly Leu Ala Arg Leu Glu 100 105 110 Val Pro Gly Tyr Glu Ala Asp Asp Val Leu Ala Ser Leu Ala Lys Lys 115 120 125 Ala Glu Lys Glu Gly Tyr Glu Val Arg Ile Leu Thr Ala Asp Lys Asp 130 135 140 Leu Tyr Gln Leu Leu Ser Asp Arg Ile His Val Leu His Pro Glu Gly 145 150 155 160 Tyr Leu Ile Thr Pro Ala Trp Leu Trp Glu Lys Tyr Gly Leu Arg Pro 165 170 175 Asp Gln Trp Ala Asp Tyr Arg Ala Leu Thr Gly Asp Glu Ser Asp Asn 180 185 190 Leu Pro Gly Val Lys Gly Ile Gly Glu Lys Thr Ala Arg Lys Leu Leu 195 200 205 Glu Glu Trp Gly Ser Leu Glu Ala Leu Leu Lys Asn Leu Asp Arg Leu 210 215 220 Lys Pro Ala Ile Arg Glu Lys Ile Leu Ala His Met Asp Asp Leu Lys 225 230 235 240 Leu Ser Trp Asp Leu Ala Lys Val Arg Thr Asp Leu Pro Leu Glu Val 245 250 255 Asp Phe Ala Lys Arg Arg Glu Pro Asp Arg Glu Arg Leu Arg Ala Phe 260 265 270 Leu Glu Arg Leu Glu Phe Gly Ser Leu Leu His Glu Phe Gly Leu Leu 275 280 285 Glu Ser Pro Lys Ala Leu Glu Glu Ala Pro Trp Pro Pro Glu Gly 290 295 300 Ala Phe Val Gly Phe Val Leu Ser Arg Lys Glu Pro Met Trp Ala Asp 305 310 315 320 Leu Leu Ala Leu Ala Ala Ala Arg Gly Gly Arg Val His Arg Ala Pro 325 330 335 Glu Pro Tyr Lys Ala Leu Arg Asp Leu Lys Glu Ala Arg Gly Leu Leu 340 345 350 Ala Lys Asp Leu Ser Val Leu Ala Leu Arg Glu Gly Leu Gly Leu Pro 355 360 365 Pro Gly Asp Asp Pro Met Leu Leu Ala Tyr Leu Leu Asp Pro Ser Asn 370 375 380 Thr Thr Pro Glu Gly Val Ala Arg Arg Tyr Gly Gly Glu Trp Thr Glu 385 390 395 400 Glu Ala Gly Glu Arg Ala Ala Leu Ser Glu Arg Leu Phe Ala Asn Leu 405 410 415 Trp Gly Arg Leu Glu Gly Glu Glu Arg Leu Leu Trp Leu Tyr Arg Glu 420 425 430 Val Glu Arg Pro Leu Ser Ala Val Leu Ala His Met Glu Ala Thr Gly 435 440 445 Val Arg Leu Asp Val Ala Tyr Leu Arg Ala Leu Ser Leu Glu Val Ala 450 455 460 Glu Glu Ile Ala Arg Leu Glu Ala Glu Val Phe Arg Leu Ala Gly His 465 470 475 480 Pro Phe Asn Leu Asn Ser Arg Asp Gln Leu Glu Arg Val Leu Phe Asp 485 490 495 Glu Leu Gly Leu Pro Ala Ile Gly Lys Thr Lys Lys Thr Gly Lys Arg 500 505 510 Ser Thr Ser Ala Ala Val Leu Glu Ala Leu Arg Glu Ala His Pro Ile 515 520 525 Val Glu Lys Ile Leu Gln Tyr Lys Glu Leu Thr Lys Leu Lys Ser Thr 530 535 540 Tyr Ile Asp Pro Leu Pro Asp Leu Ile His Pro Arg Thr Gly Arg Leu 545 550 555 560 His Thr Arg Phe Asn Gln Thr Ala Thr Ala Thr Gly Arg Leu Ser Ser 565 570 575 Ser Asp Pro Asn Leu Gln Asn Ile Pro Val Arg Thr Pro Leu Gly Gln 580 585 590 Arg Ile Arg Arg Ala Phe Ile Ala Glu Glu Gly Trp Leu Leu Val Ala 595 600 605 Leu Asp Tyr Ser Gln Ile Glu Leu Arg Val Leu Ala His Leu Ser Gly 610 615 620 Asp Glu Asn Leu Ile Arg Val Phe Gin Glu Gly Arg Asp Ile His Thr 625 630 635 640 Glu Thr Ala Ser Trp Met Phe Gly Val Pro Arg Glu Ala Val Asp Pro 645 650 655 Leu Met Arg Val Ala Ala Lys Thr Ile Asn Phe Gly Val Leu Tyr Gly 660 665 670 Met Ser Ala His Arg Leu Ser Gln Glu Leu Ala Ile Pro Tyr Glu Glu 675 680 685 Ala Gln Ala Phe Ile Glu Arg Tyr Phe Gln Ser Phe Pro Lys Val Arg 690 695 700 Ala Trp Ile Glu Lys Thr Leu Glu Glu Gly Arg Arg Arg Gly Tyr Val 705 710 715 720 Glu Thr Leu Phe Gly Arg Arg Arg Tyr Val Pro Asp Leu Glu Ala Arg 725 730 735 Val Lys Ser Val Arg Glu Ala Ala Glu Arg Met Ala Phe Asn Met Pro 740 745 750 Val Gln Gly Thr Ala Ala Asp Leu Met Lys Leu Ala Met Val Lys Leu 755 760 765 Phe Pro Arg Leu Glu Glu Met Gly Ala Arg Met Leu Leu Gln Val His 770 775 780 Asp Glu Leu Val Leu Glu Ala Pro Lys Glu Arg Ala Glu Ala Val Ala 785 790 795 800 Arg Leu Ala Lys Glu Val Met Glu Gly Val Tyr Pro Leu Ala Val Pro 805 810 815 Leu Glu Val Glu Val Gly Ile Gly Glu Asp Trp Leu Ser Ala Lys Glu 820 825 830 <210> 3 <211> 24 <212> DNA <213> <220> <223> V617F SF3 <400> 3 caagtatgat gagcaagctt tctc 24 <210> 4 <211> 21 <212> DNA <213> <220> <223> V617F Rmt21(-3T) <400> 4 cttactctcg tctccactga a 21 <210> 5 <211> 24 <212> DNA <213> <220> <223> JAK2 Ex4 IC_F <400> 5 gatccagttc ttcaggtgta tctt 24 <210> 6 <211> 23 <212> DNA <213> <220> <223> JAK2 Ex4 IC_R <400> 6 cccagatgga aaggtcagat aat 23 <210> 7 <211> 32 <212> DNA <213> <220> <223> V617F FAM_R(nova) <220> <221> misc_feature <222> (10)..(10) <223> n is nova. <400> 7 acatactccn ataatttaaa accaaatgct tg 32 <210> 8 <211> 25 <212> DNA <213> <220> <223> JAK2 Ex4 IC_QS670 <400> 8 ccattccctt gggaaatctg aggca 25 <210> 9 <211> 20 <212> DNA <213> <220> <223> Eco-F <400> 9 ggggtacctc atcaccccgg 20 <210> 10 <211> 27 <212> DNA <213> <220> <223> R536K-R <400> 10 cttggtgagc tccttgtact gcaggat 27 <210> 11 <211> 27 <212> DNA <213> <220> <223> R536K-F <400> 11 atcctgcagt acaaggagct caccaag 27 <210> 12 <211> 30 <212> DNA <213> <220> <223> R660V-R <400> 12 gatggtcttg gccgccacgc gcatcagggg 30 <210> 13 <211> 30 <212> DNA <213> <220> <223> R660V-F <400> 13 cccctgatgc gcgtggcggc caagaccatc 30 <210> 14 <211> 32 <212> DNA <213> <220> <223> Xba-R <400> 14 gctctagact atcactcctt ggcggagagc ca 32 <210> 15 <211> 27 <212> DNA <213> <220> <223> E507K-R <400> 15 cttgccggtc tttttcgtct tgccgat 27 <210> 16 <211> 27 <212> DNA <213> <220> <223> E507K-F <400> 16 atcggcaaga cgaaaaagac cggcaag 27 <210> 17 <211> 2499 <212> DNA <213> <220> <223> Taq E507K/R536K/R660V <400> 17 atgaggggga tgctgcccct ctttgagccc aagggccggg tcctcctggt ggacggccac 60 cacctggcct accgcacctt ccacgccctg aagggcctca ccaccagccg gggggagccg 120 gtgcaggcgg tctacggctt cgccaagagc ctcctcaagg ccctcaagga ggacggggac 180 gcggtgatcg tggtctttga cgccaaggcc ccctccttcc gccacgaggc ctacgggggg 240 tacaaggcgg gccgggcccc cacgccggag gactttcccc ggcaactcgc cctcatcaag 300 gagctggtgg acctcctggg gctggcgcgc ctcgaggtcc cgggctacga ggcggacgac 360 gtcctggcca gcctggccaa gaaggcggaa aaggagggct acgaggtccg catcctcacc 420 gccgacaaag acctttacca gctcctttcc gaccgcatcc acgtcctcca ccccgagggg 480 tacctcatca ccccggcctg gctttgggaa aagtacggcc tgaggcccga ccagtgggcc 540 gactaccggg ccctgaccgg ggacgagtcc gacaaccttc ccggggtcaa gggcatcggg 600 gagaagacgg cgaggaagct tctggaggag tgggggagcc tggaagccct cctcaagaac 660 ctggaccggc tgaagcccgc catccgggag aagatcctgg cccacatgga cgatctgaag 720 ctctcctggg acctggccaa ggtgcgcacc gacctgcccc tggaggtgga cttcgccaaa 780 aggcgggagc ccgaccggga gaggcttagg gcctttctgg agaggcttga gtttggcagc 840 ctcctccacg agttcggcct tctggaaagc cccaaggccc tggaggaggc cccctggccc 900 ccgccggaag gggccttcgt gggctttgtg ctttcccgca aggagcccat gtgggccgat 960 cttctggccc tggccgccgc cagggggggc cgggtccacc gggcccccga gccttataaa 1020 gccctcaggg acctgaagga ggcgcggggg cttctcgcca aagacctgag cgttctggcc 1080 ctgagggaag gccttggcct cccgcccggc gacgacccca tgctcctcgc ctacctcctg 1140 gacccttcca acaccacccc cgagggggtg gcccggcgct acggcgggga gtggacggag 1200 gaggcggggg agcgggccgc cctttccgag aggctcttcg ccaacctgtg ggggaggctt 1260 gagggggagg agaggctcct ttggctttac cgggaggtgg agaggcccct ttccgctgtc 1320 ctggcccaca tggaggccac gggggtgcgc ctggacgtgg cctatctcag ggccttgtcc 1380 ctggaggtgg ccgaggagat cgcccgcctc gaggccgagg tcttccgcct ggccggccac 1440 cccttcaacc tcaactcccg ggaccagctg gaaagggtcc tctttgacga gctagggctt 1500 cccgccatcg gcaagacgaa aaagaccggc aagcgctcca ccagcgccgc cgtcctggag 1560 gccctccgcg aggcccaccc catcgtggag aagatcctgc agtacaagga gctcaccaag 1620 ctgaagagca cctacattga ccccttgccg gacctcatcc accccaggac gggccgcctc 1680 cacacccgct tcaaccagac ggccacggcc acgggcaggc taagtagctc cgatcccaac 1740 ctccagaaca tccccgtccg caccccgctt gggcagagga tccgccgggc cttcatcgcc 1800 gaggaggggt ggctattggt ggccctggac tatagccaga tagagctcag ggtgctggcc 1860 cacctctccg gcgacgagaa cctgatccgg gtcttccagg aggggcggga catccacacg 1920 gagaccgcca gctggatgtt cggcgtcccc cgggaggccg tggaccccct gatgcgcgtg 1980 gcggccaaga ccatcaactt cggggtcctc tacggcatgt cggcccaccg cctctcccag 2040 gagctagcca tcccttacga ggaggcccag gccttcattg agcgctactt tcagagcttc 2100 cccaaggtgc gggcctggat tgagaagacc ctggaggagg gcaggaggcg ggggtacgtg 2160 gagaccctct tcggccgccg ccgctacgtg ccagacctag aggcccgggt gaagagcgtg 2220 cgggaggcgg ccgagcgcat ggccttcaac atgcccgtcc agggcaccgc cgccgacctc 2280 atgaagctgg ctatggtgaa gctcttcccc aggctggagg aaatgggggc caggatgctc 2340 cttcaggtcc acgacgagct ggtcctcgag gccccaaaag agagggcgga ggccgtggcc 2400 cggctggcca aggaggtcat ggagggggtg tatcccctgg ccgtgcccct ggaggtggag 2460 gtggggatag gggaggactg gctctccgcc aaggagtga 2499

Claims (17)

delete delete delete delete In the amino acid sequence of SEQ ID NO: 1, the 507th amino acid residue, glutamic acid (E), is substituted with lysine (K), the 536th amino acid residue, arginine (R) is substituted with lysine (K), and the 660th amino acid residue, arginine ( R) Taq polymerase in which valine (V) is substituted; and
a primer set comprising a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4;
A kit for detecting JAK2 gene mutations, including. The kit for detecting JAK2 gene mutation according to claim 5, further comprising a primer set comprising a forward primer of SEQ ID NO: 5 and a reverse primer of SEQ ID NO: 6 for an internal control. 7. The method of claim 5 or 6, further comprising one or more probes selected from the group consisting of a probe of SEQ ID NO: 7 and a probe of SEQ ID NO: 8, wherein the nucleotide sequences of SEQ ID NO: 7 and 8 are each 5' - At the end, one type of fluorophore selected from the group consisting of FAM, Quasar 670 and CY5 is labeled, and at the 3'-end, one type of quencher selected from the group consisting of BHQ-1 and BHQ-2 This labeled, JAK2 gene mutation detection kit. 6. The method of claim 5,
25-100 mM KCl; and
1-7 mM (NH ₄ ) ₂ SO ₄ ;
A kit for detecting JAK2 gene mutations, further comprising a PCR buffer composition having a final pH of 8.0 to 9.5. 6. The method of claim 5,
25-100 mM KCl;
1-7 mM (NH ₄ ) ₂ SO ₄ ; and
5 to 50 mM of TMAC (Tetra methyl ammonium chloride), and further comprising a PCR buffer composition having a final pH of 8.0 to 9.5, a kit for detecting JAK2 gene mutations. A method for detecting a JAK2 gene mutation comprising the steps of:
(a) extracting nucleic acids from the isolated biological sample;
(b) performing PCR (polymerase chain reaction) by treating the kit of claim 5 or claim 6 on the extracted nucleic acid; and
(c) confirming the result of the PCR amplification with fluorescence. The method of claim 10, wherein the PCR is allele-specific PCR or real-time PCR. 11. The method of claim 10, (d) further comprising the step of confirming the amplification result by PCR by measuring a Ct (cycle threshold) value, JAK2 gene mutation detection method. The method of claim 10 , wherein the JAK2 gene mutation comprises at least one selected from the group consisting of deletion, substitution and insertion mutations at codon 617 of the JAK2 gene. The method according to claim 13, wherein the JAK2 gene mutation comprises a substitution of valine, which is an amino acid at codon 617 of JAK2. 11. The method of claim 10, wherein the JAK2 gene mutation detection method is applied to the diagnosis of myeloproliferative neoplasm, JAK2 gene mutation detection method. The method according to claim 15, wherein the myeloproliferative neoplasm is at least one selected from the group consisting of polycythemia vera, essential thrombocythemia, and primary myelofibrosis (PMF). The method of claim 10, wherein the nucleic acid of step (a) is extracted from bone marrow or liquid biopsy of tissue biopsy, JAK2 gene mutation detection method.

Images