KR102281658B1 - SNP marker for predicting resistant to viral hemorrhagic septicemia virus of Paralichthys olivaceus and use thereof - Google Patents

Abstract

The present invention relates to an SNP marker composition for predicting viral hemorrhagic septicemia virus (VHSV) resistance of Paralichthys olivaceus and a method for predicting VHSV resistance of Paralichthys olivaceus using the same. The present invention can be utilized for genomic selection related to VHSV resistance of Paralichthys olivaceus in the future, induces the development and continuous production of VHSV-resistant varieties, and can be used for the analysis of genetic information on main target traits (disease resistance, water temperature tolerance, growth, etc.) by utilizing a large-capacity SNP chip.

Description

SNP marker for predicting resistant to viral hemorrhagic septicemia virus of Paralichthys olivaceus and use thereof

The present invention relates to a SNP marker composition for predicting viral hemorrhagic septicemia virus (VHSV) resistance of halibut and a method for predicting viral hemorrhagic septicemia virus resistance of halibut using the same.

Korea's halibut (float) aquaculture industry has developed rapidly with the establishment of production technology and the development of land-based aquaculture methods in the early 1980s. As of 2017, the production of halibut was 41,204 tons, and by region, Jeju 25,092 tons (60.8%), Jeonnam 13,867 tons (33.6%), Gyeongnam 892 tons (2.1%), and other 1,353 tons (3.2%) The main production regions are Jeonnam and Jeju, which account for 95.4% of the total production.

However, mortality due to diseases of aquatic organisms occurring in domestic aquaculture sites is repeated every year, and mortality due to infectious diseases is caused by scuticasis (average cumulative mortality rate from 2015 to 2017: 56.7%) and viral hemorrhagic sepsis infection ( estimated) (average cumulative mortality rate in 2015-2017: 8.9%) was found to be high.

Viral hemorrhagic septicemia (VHS) was known as a viral disease that caused major damage to rainbow trout and several freshwater fish species in Europe until the early 1980s. found in salmon. Fish species confirmed to be infected include halibut, rainbow trout, Atlantic salmon, brown trout, silver salmon, king salmon, cod, halibut, turbot, sardine, and pollock. VHSV is being isolated. In Korea, cases of viral hemorrhagic sepsis have been reported in academia during the low water temperature of winter and spring in the East Sea and South Sea waters every year since 2001. It has been reported in wild-caught saltwater fish species and farmed halibut.

Due to this situation, even at the halibut farming site in Jeju Island, due to diseases or problems in supply and demand of seedlings including defective seedlings (eg, feral fish, negligence in quarantine management at hatcheries, etc.), deterioration of the water quality environment, deterioration of feed quality, insufficient management of the aquaculture farm, etc. It is increasing, which is making it difficult to manage aquaculture, and to overcome problems such as stagnant production, insufficient seedling production, mass mortality due to disease or environment, and consumption stagnation, it is necessary to develop new halibut species through selective breeding or research on breed improvement. .

Therefore, the present inventors conducted a single nucleotide that can predict VHSV resistance through genotyping and genome-wide association study (GWAS) using a 70K SNP chip for individuals selected in a viral hemorrhagic sepsis infection experiment. Polymorphism (SNP) was confirmed, and the present invention was completed by providing a selective breeding method including the selection of the flounder genome with resistance to VHSV based on genetic information on disease resistance between parents and children by analyzing paternity and pedigree structure. did.

Korean Patent Registration No. 10-1677012

An object of the present invention is to provide a SNP marker composition for predicting VHSV resistance of halibut, a composition comprising an agent capable of detecting or amplifying the same, a kit for predicting VHSV resistance of halibut comprising the composition, and a method of predicting VHSV resistance of halibut will be.

In order to achieve the above object, the present invention provides a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is G or A, or nucleotides complementary thereto; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:2 is G or A; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:3 is C or A; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:4 is A or G; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is T or G; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:6 is G or T; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, in which the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is C or T; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:8 is T or C; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is C or T; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:10 is A or C; And the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11 is A or G, and the polynucleotide consisting of 10 to 50 consecutive bases including the 36th base or a nucleotide complementary thereto; It provides a single nucleotide polymorphism (SNP) marker composition for predicting resistance to viral hemorrhagic septicemia virus (VHSV) resistance of halibut, including at least one selected.

When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is A; When the 36th nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is G; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is C; When the 36th nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is A; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is T; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 is T; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is T; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 is C; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is C; When the 36th nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10 is A; Alternatively, when the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11 is A, it can be predicted that the flounder is VHSV-resistant.

In addition, the present invention is a composition for predicting VHSV resistance of halibut, comprising an agent capable of detecting or amplifying a SNP (Single Nucleotide Polymorphism) marker for predicting viral hemorrhagic septicemia virus (VHSV) resistance of halibut. , the SNP marker is,

a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is G or A; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:2 is G or A; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:3 is C or A; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:4 is A or G; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is T or G; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:6 is G or T; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, in which the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is C or T; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:8 is T or C; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is C or T; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:10 is A or C; And the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11 is A or G, and the polynucleotide consisting of 10 to 50 consecutive bases including the 36th base or a nucleotide complementary thereto; It provides a composition for predicting VHSV resistance of flatfish, comprising at least one selected.

The agent may be a primer or probe capable of detecting or amplifying the SNP marker.

The primer set may be composed of the nucleotide sequences of SEQ ID NOs: 12 and 13.

In addition, the present invention provides a kit for predicting viral hemorrhagic septicemia virus (VHSV) resistance of halibut, comprising the composition for predicting VHSV resistance of halibut.

In addition, the present invention provides (a) the steps of amplifying or detecting a polymorphic site of a SNP marker for prediction of viral hemorrhagic septicemia virus (VHSV) resistance of halibut from the DNA of a sample isolated from halibut, and (b) the above and determining the base of the polymorphic site amplified or detected in step (a), wherein the SNP marker in step (a) comprises:

a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is G or A; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:2 is G or A; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:3 is C or A; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:4 is A or G; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is T or G; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:6 is G or T; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, in which the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is C or T; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:8 is T or C; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is C or T; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:10 is A or C; And the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11 is A or G, and the polynucleotide consisting of 10 to 50 consecutive bases including the 36th base or a nucleotide complementary thereto; It provides a method for predicting VHSV resistance of flatfish, including one or more selected.

When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is A; When the 36th nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is G; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is C; When the 36th nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is A; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is T; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 is T; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is T; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 is C; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is C; When the 36th nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10 is A; Alternatively, when the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11 is A, it can be predicted that the flounder is VHSV-resistant.

The present invention can be used for genomic selection related to VHSV resistance of flounder in the future, induces the development and continuous production of VHSV-resistant varieties, and utilizes a large-capacity SNP chip for main target traits (disease resistance, water temperature tolerance, growth, etc.) It can be used for the analysis of genetic information for

In addition, the present invention can be used for tracking whole genome level genetic information and environmental factors for a target trait, and for breeding, pedigree identification, inbreeding control technology development, and continuous next-generation production and breed improvement programs.

1 shows a summary of whole genome re-sequencing results for 100 halibut.
2 shows the final selection of markers for SNP chips according to priorities and criteria.
3 shows the design of the VHSV infection experiment.
Figure 4 shows the selection of oF0-VHSV samples to be used for VHSV resistance genotyping by lineage.
5 shows a schematic diagram of a microarray for VHSV resistance comparison.
6 shows the pedigree structure according to the survival language and the pesa language.
7 shows the average value and standard error value for each genotype associated with VHSV resistance.

The present invention is a single nucleotide polymorphism that can predict VHSV resistance through genotyping and genome-wide association study (GWAS) using a 70K SNP chip for individuals selected in a viral hemorrhagic sepsis infection experiment (SNP) was confirmed.

In one aspect, the present invention relates to a single nucleotide polymorphism (SNP) marker composition for predicting flounder viral hemorrhagic septicemia virus (VHSV) resistance.

Specifically, the present invention relates to a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is G or A, and ; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:2 is G or A; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:3 is C or A; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:4 is A or G; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is T or G; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:6 is G or T; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, in which the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is C or T; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:8 is T or C; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is C or T; a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:10 is A or C; And the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11 is A or G, and the polynucleotide consisting of 10 to 50 consecutive bases including the 36th base or a nucleotide complementary thereto; It provides a single nucleotide polymorphism (SNP) marker composition for predicting resistance to viral hemorrhagic septicemia virus (VHSV) resistance of halibut, including at least one selected.

As used herein, the term “resistance” refers to a property to withstand external stress, and specifically refers to a property that has resistance to infection such as disease, or withstands damage such as pests.

As used herein, the term "SNP marker" refers to a single base polymorphic allele base pair on a DNA sequence used to identify an individual or species. Since SNPs are relatively high in frequency and stable and distributed throughout the genome, thereby generating genetic diversity of individuals, SNP markers can serve as indicators of genetic proximity between individuals. SNP markers usually include phenotypic changes that accompany single nucleotide polymorphisms, but in some cases this may not. In the case of the SNP marker of the present invention, it may indicate a difference in the phenotype of an individual, such as a mutation in the amino acid sequence or resistance to flounder VHSV.

As used herein, the term "individual" refers to halibut (flounder), which is a target for confirming VHSV resistance, and by analyzing the genotype of the SNP marker using a sample obtained from the halibut (float), the VHSV resistant halibut (float) can be judged.

According to an embodiment of the present invention, in order to select the VHSV resistance prediction SNP, the mother genome SNP was searched by whole genome re-sequencing of the mother generation, and then a 70K SNP chip was manufactured. Then, as a result of narrowing the scope to SNPs related to VHSV resistance through the SNP chip analysis for individuals selected in the VHSV infection experiment, effective SNPs were found on chromosomes 21 and 24. 11 SNP information was confirmed by analyzing the mean and standard error values for each genotype of the SNPs, and the reliability and accuracy of the SNP markers of the present invention were confirmed to predict the VHSV resistance of halibut.

Therefore, it is suggested that halibut having a nucleotide sequence comprising the polynucleotide of the present invention may exhibit VHSV resistance, and this nucleotide sequence was first identified by the present inventors.

Preferably, when the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is A; When the 36th nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is G; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is C; When the 36th nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is A; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is T; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 is T; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is T; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 is C; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is C; When the 36th nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10 is A; Alternatively, when the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11 is A, it can be predicted that the flounder is VHSV-resistant.

In another aspect, the present invention relates to a composition for predicting VHSV resistance of halibut, comprising an agent capable of detecting or amplifying the SNP marker for predicting VHSV resistance of halibut.

As used herein, the term "agent capable of detecting or amplifying a SNP marker" refers to a composition capable of predicting VHSV-resistant flounder by detecting or amplifying the polymorphic site of the gene as described above, preferably the SNP. It refers to a primer set or probe capable of specifically detecting or amplifying a polynucleotide of a marker.

The primers used for the amplification of the SNP marker are prepared under appropriate conditions (e.g., 4 different nucleoside triphosphates and a polymerizing agent such as DNA, RNA polymerase or reverse transcriptase) in an appropriate buffer and template-directing DNA under appropriate temperature It may be a single-stranded oligonucleotide that can serve as a starting point for synthesis, and the appropriate length of the primer may vary depending on the intended use, but is usually 15 to 30 nucleotides. Short primer molecules generally require lower temperatures to form stable hybrids with the template. The primer sequence does not need to be completely complementary to the SNP marker, but must be sufficiently complementary to hybridize with the SNP marker, and may preferably include the polynucleotide sequence consisting of SEQ ID NOs: 12 and 13, but in particular Not limited.

As used herein, the term "primer" refers to a base sequence having a short free 3' hydroxyl group, which can form a base pair with a complementary template and is a start for template strand copying. It refers to a short sequence that functions as a point, and is mainly used in the form of a primer set to amplify a specific section. Primers are capable of initiating DNA synthesis in the presence of reagents for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in appropriate buffers and temperatures. In this case, PCR conditions, the length of the sense and antisense primers can be modified based on those known in the art.

The primer set used in the present invention may be composed of the nucleotide sequences of SEQ ID NOs: 12 and 13.

As used herein, the term "probe" is a DNA or RNA nucleotide sequence of various lengths, which is labeled through radiolabeling or fluorescent labeling, and is composed of a single-stranded nucleotide sequence and is specific for single-stranded DNA or RNA having a complementary sequence. It is characterized in that it binds positively and hybridizes, and the target can be detected by detecting the label signal of the hybridized probe.

The primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, encapsulation, substitution with one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkages such as methyl phosphonates, phosphotriesters, phosphoros. amidates, carbamates, etc.) or charged linkages (eg phosphorothioates, phosphorodithioates, etc.).

In another aspect, the present invention relates to a kit for predicting VHSV resistance of flatfish, comprising the composition for predicting VHSV resistance of flatfish.

The kit of the present invention may be a DNA chip kit, but is not limited thereto.

The DNA chip kit specifically hybridizes and binds to a target DNA using a chip to which an oligonucleotide comprising a nucleotide sequence complementary to a sequence of a polynucleotide including a SNP marker, which is a marker for predicting VHSV resistance of halibut, is attached. VHSV-resistant halibut can be predicted by using the change in the hybridization level according to the base mutation of the SNP. Specifically, the DNA chip kit for prediction of VHSV resistance of halibut provided in the present invention includes any one or more polynucleotides selected from the group consisting of polynucleotides consisting of the nucleotide sequences of SEQ ID NOs: 1 to 11 or the 36th base thereof. VHSV resistance prediction of halibut, which is a kit that attaches a polynucleotide sequence consisting of 10 to 50 bases and a complementary oligonucleotide with a marker to the chip and reacts the target DNA to the chip to determine the genotype through the level of hybridization It may be a kit for

In another aspect, the present invention provides a method comprising: (a) amplifying or detecting the 36th base, which is the polymorphic site of the SNP marker for predicting VHSV resistance of claim 1, from the DNA of the halibut sample; And (b) provides a method for predicting VHSV resistance of halibut, comprising the step of determining the base of the polymorphic site amplified or detected in step (a).

For the step of amplifying the polynucleotide from the DNA sample of step (a), any method known to those skilled in the art may be used. For example, it can be obtained by amplifying a target nucleic acid through PCR and purifying it. In addition, ligase chain reaction (LCR), transcription amplification and self-maintaining sequence replication and nucleic acid-based sequence amplification (NASBA) may be used.

Among the methods, the methods for determining the base of the amplified SNP marker site in step (b) include sequencing analysis, hybridization by microarray, allele specific PCR, and dynamic allele hybridization technique (dynamic). allele-specific hybridization, DASH), PCR extension assay, PCR-SSCP, PCR-RFLP assay, HRM assay or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g. Sequenom's MassARRAY system), mini-sequencing (mini-sequencing) methods, Bio-Plex systems (BioRad), CEQ and SNPstream systems (Beckman), Molecular Inversion Probe array technologies (eg, Affymetrix GeneChip), and BeadArray Technologies (eg, Illumina GoldenGate and Infinium assays) ) and the like, but is not particularly limited thereto. One or more alleles in the SNP marker may be identified by the above methods or other methods available to those skilled in the art.

Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

The present invention provides a SNP marker for predicting VHSV resistance of halibut, including the following steps

1) Selecting 103 oP generations from halibut broodstock and selecting high-quality SNPs from the selected 103 through whole genome re-sequencing to prepare SNP chips:

2) Selecting 1,049 experimental fish oF0-VHSV to be analyzed with the SNP chip by conducting a VHSV artificial infection experiment on about 2,000 oF0 generations produced from the oP generation in step 1):

3) genotype analysis of 1,049 oF0-VHSV and 103 oP generation mice through the SNP array using the SNP chip prepared in step 1) to confirm paternity; and

4) Selecting SNPs capable of predicting VHSV resistance by analyzing the association between the genotype obtained in step 3) and VHSV resistance through GWAS (whole genome association analysis).

Example 1: Fabrication of a high-density SNP 70K chip

1-1. Selection of dams for analysis and securing of high-density SNPs

Based on the allele and association analysis results of 11 microsatellite markers (microsatellite, MS) loci from the prepared halibut group of 1,291, the individuals selected based on the QC results for genomic DNA and the group, crossbreeding, In consideration of sex, etc., 100 fish were finally selected from the halibut group for whole genome re-sequencing analysis.

Genetic analysis of 103 selected halibut was performed by llumina NovaSeq, and the whole length genome sequence of halibut published in China was used as a reference sequence. As shown in FIG. 1, through steps such as trimming, read mapping, and sorting, about 36.69 Gb of sequencing data was constructed for each sample, and single nucleotide polymorphism (SNP) of about 80% of the large-scale mutation information for each individual was confirmed. For hyper-variable sequences based on mutation information, high-quality SNPs were selected through four filtering methods, and candidate SNPs for manufacturing SNP chips were re-selected.

1-2. Final SNP screening and SNP chip fabrication

AxiomTM my DesignTM SNP chip (50~90K) platform was selected to fabricate a high-density SNP chip. As shown in FIG. 2 , the secured high-quality SNPs are classified according to their importance, and 1) genotype rate for 100 animals, 2) LD block, 3) repeat, 4) 154,964 SNPs after grading according to the range of MAF got When the group structure of 103 halibut was analyzed based on the selected 155K SNP, a pattern similar to the result of the analysis with the 11 MS markers used earlier was shown, indicating that the collected flatfish group was determined according to the collection area (group). It is assumed that the specificity is strong, and the genetic fixation within the population is considered to be high. After removing the homopolymer region and the allele A/T or C/G SNPs from the 155K SNP, 70,000 SNPs are finally selected among the 88,065 classified by recommendation considering the SNP chip (50~90K) platform. became The selected SNPs were evenly distributed on the 24 chromosomes, and the distance between SNPs was also 70% within 5,000 bp, and most were confirmed to be less than 10,000 bp. A 70K SNP chip for halibut in the form of a total of 384 wells/plate was manufactured by planting 70,000 SNPs on one chip.

Example 2: Microarray for VHSV Resistance Comparison

2-1. VHSV infection experiment

go. VHSV culture

VHSV isolated from viral hemorrhagic sepsis-infected fish was infected with FHM cell line and cultured at a maximum concentration of 1 X 1e-8 to 1 X 1e-9.5 TCID50/ml in virto depending on the pathogenicity, and the VHSV infection experiment design of FIG. The following experiment was performed accordingly.

me. VHSV infection test for oF0 generation

The halibut used as the experimental fish was a group of halibut produced according to the breeding guidelines at the Jeju Institute of Oceans and Fisheries. Specifically, in order to analyze the genetic degree of VHSV resistance by pedigree, 103 adult females (37 females, 66 males) were mass-produced through artificial insemination, and the oF0 generation was bred to a size of 9 to 15 cm, and 2,000 of them were randomly selected. After selection, 250 animals per tank were stocked in 8 tanks with a diameter of 1.4m, and allowed to acclimatize for 5 days at 13±0.5°C water temperature. The water tank system was a circulation filtration tank, and an air-cooled cooler was used to maintain the water temperature, and 80-90% water exchange was performed once a day. Highly pathogenic VHSV per acclimated fry was intraperitoneally injected at a concentration of 1 X 1e-7.5 TCID50 using an insulin syringe, and feeding was restricted until acclimation and infection period. Dead individuals were collected every 6 hours, weight and total length were measured, and symptoms due to VHSV infection were checked, and a part of the caudal fin was sampled and stored at -80°C.

As shown in FIG. 4 , after 4 weeks of experimentation, 155 live fish and 1,845 dead fish were counted, and when they were stabilized from the experimental water temperature to the normal breeding water temperature, the individuals that died during this period were considered late-dead fish. 1,845 dead fish were classified according to the number of days post-injection (Day post challenge, DPI), accumulated mortality, and lethal dose (LD). VHSV assay was performed by Time PCR (qPCR). After qPCR was performed using the primer set for VHSV assay (Table 1), the presence or absence of virus infection was checked by _{the C T value according to the standard curve according to the VHSV copy number, and samples with C T} < 30.0 were included. 894 dead fish and 155 surviving fish selected by checking the number of days after injection, cumulative mortality rate, mortality interval, and presence or absence of VHSV infection were combined, and 1,049 oF0-VHSV test fish were selected as samples for the SNP array.

Table 1. Primer set for VHSV assay Name Sequence (5’-3’) Tm Forward primer (18-440) TGTCTCAGATCAGTGGGAAGTACGC 60℃ Reverse primer (18-441) GGACCTCAGCGACAAGTTCGG*?* 60℃

2-2. Genotyping to compare VHSV resistance

In order to analyze the VHSV resistance genetic trait of halibut and the difference in resistance according to the pedigree, 1,049 oF0-VHSV obtained after the VHSV infection experiment and 103 oP generation animals were identified and pedigree analysis was performed.

go. 70K SNP array and QC analysis

First, the QC (quality control) of gDNA was confirmed by the PicoGreen DNA quantification method in 1,049 selected oF0-VHSV experimental fish and 103 oP generation fish, and a 70K SNP chip was used for the passed samples. SNP array was performed (Fig. 5). ).

The extracted SNP array raw data was analyzed for sample QC and SNP QC with Axiom Analysis Suite 5.1.1 software (Thermo Fisher), and 55,161 SNPs finally passed QC. Specifically, 55K SNPs for VHSV resistance genotyping were obtained for a total of 1,152 animals (Table 2).

Table 2. SNP QC Thresholds QC Cr-cutoff Fld-cutoff Het-so-cutoff Num-minor-allele-cutoff Number of markers Number of Best and Recommended Percentage of Best and Recommended Thresholds ≥97 ≥4.0 ≥-0.04 ≥20 71,364 55,725 78.086 *Cr-cutoff = minimum acceptable call rate, Fld-cutoff = for autosomal probesets, minimum acceptable FLD value for cluster separation, Het-so-cutoff = minimum acceptable value for the correctness of the size (Y position) offset of the heterozygous cluster , Num-minor-allele-cutoff = minimum minor allele count for categorizing a probeset as PolyHighResolution.

me. Comparison of VHSV resistance through paternity identification and family structure analysis

Based on the SNP information of the 1,152 animals, parentage was performed using Cervus software, and the Cervus results were tested by estimating the association between individuals with Colony software.

Among the SNPs that passed QC, 1000 SNPs that fit the conditions were selected by filtering under the conditions of CR > 0.98, MAF > 0.487, FLD > 10, and HetSo range of 0.3 to 0.8, belonging to PolyHighResolution, ① Allele frequency analysis → ② Simulation (parent Pair with known sexes), → ③ Parentage analysis → ④ LOD < 15 Cervus analysis was performed to identify 966 maternal and 865 paternal lines.

Among the 67 families used in the experiment, 44 families were identified as a result of paternity verification, and the distribution ranged from 1 to 107 animals per household. The average number of children per household was 20.1.

As a result of pedigree structure analysis of 966 animals whose parents were confirmed in the paternity check (Table 3), looking at the distribution of surviving and dead fish by household, 37 fish in the oP_1142-oP_1421 line, and 37 in the oP_1142-oP-1535 line. 21 fish make up a high proportion of the surviving fish. When the ratio of live and dead fish was checked considering the number of progenys by household, 37 out of 106 (34.91%) in oP_1142-oP_1421 pedigree (34.91%) survived, and 21 out of 107 (19.63%) in oP_1142-oP-1535 pedigree. ) survived.

As shown in Fig. 6, if we look at only the survival rate, the oP_0305-oP_1489 pedigree is 100% (3 surviving / 3 animals), the oP_0305-oP_0349 pedigree is 60% (3 surviving / 5 animals), and the oP_0991-oP_1295 pedigree is 50%. (1 surviving/2), oP_1018-oP_1466 pedigree 50% (5 surviving / 10 surviving), oP_1161-oP_1388 pedigree 56.25% (9 surviving/16 brood), oP_1514-oP_0262 pedigree 60% (surviving) 3/5) survive.

Because there is a difference in the number of progenys per household, it is difficult to tell the viability of a household simply by the number of surviving fish, so the survival ratio by household must also be considered.

Table 3. Distribution of living and dead fish by household unique family name
(Assigned) Number of Progeny Dead Survivor Amount Rate (%) Amount Rate (%) oP_0006-oP_0278 28 22 78.57 6 21.43 oP_0006-oP_0323 40 29 72.50 11 27.50 oP_0006-oP_1385 15 11 73.33 4 26.67 oP_0009-oP_0438 17 16 94.12 One 5.88 oP_0010-oP_0295 45 42 93.33 3 6.67 oP_0052-oP_1470 79 75 94.94 4 5.06 oP_0052-oP_1262 103 100 97.09 3 2.91 oP_0194-oP_1454 15 9 60.00 6 40.00 oP_0194-oP_0464 19 18 94.74 One 5.26 oP_0305-oP_0309 6 6 100.00 0 0.00 oP_0305-oP_1489 3 0 0.00 3 100.00 oP_0308-oP_0349 5 2 40.00 3 60.00 oP_0308-oP_1386 2 2 100.00 0 0.00 oP_0308-oP_1512 3 2 66.67 One 33.33 oP_0631-oP_1457 2 2 100.00 0 0.00 oP_0631-oP_1294 One One 100.00 0 0.00 oP_0991-oP_1504 4 4 100.00 0 0.00 oP_0991-oP_1295 2 One 50.00 One 50.00 oP_1018-oP_1494 9 7 77.78 2 22.22 oP_1018-oP_1466 10 5 50.00 5 50.00 oP_1028-oP_0486 One One 100.00 0 0.00 oP_1054-oP_0409 7 4 57.14 3 42.86 oP_1054-oP_1343 9 6 66.67 3 33.33 oP_1074- 101 88 87.13 13 12.87 oP_1116-oP_1442 27 16 59.26 11 40.74 oP_1116-oP_1439 9 9 100.00 0 0.00 oP_1116-oP_0300 3 3 100.00 0 0.00 oP_1142-oP_1535 107 86 80.37 21 19.63 oP_1142-oP_1421 106 69 65.09 37 34.91 oP_1161-oP_0383 9 9 100.00 0 0.00 oP_1161-oP_1503 6 5 83.33 One 16.67 oP_1161-oP_0332 3 2 66.67 One 33.33 oP_1161-oP_1388 16 7 43.75 9 56.25 oP_1282-oP_1382 2 2 100.00 0 0.00 oP_1514-oP_0294 6 5 83.33 One 16.67 oP_1514-oP_0409 5 5 100.00 0 0.00 oP_1514-oP_0470 2 2 100.00 0 0.00 oP_1514-oP_0262 5 2 40.00 3 60.00 oP_1536-oP_1488 22 22 100.00 0 0.00 oP_1536-oP_0484 2 2 100.00 0 0.00 oP_1547-oP_1293 27 24 88.89 3 11.11 oP_1559-oP_1405 5 5 100.00 0 0.00 oP_1559-oP_0292 2 2 100.00 0 0.00 oP_1623-oP_1479 76 64 84.21 12 15.79 Total 966 794 (82.19%) 172 (17.81%)

As a result, when halibut is produced according to the breeding guideline strategy that considers the survival rate of the household, Since VHSV resistance is higher than that of general halibut, selective breeding that can increase the survival rate in aquaculture is possible.

2-3. Screening of SNPs that can predict VHSV resistance

Based on 55K SNP and VHSV experimental data, survival and mortality for VHSV resistance, mortality according to Day Post Challenge (DPC), weight, total length, ascites, haemorrhage, deformity, To analyze the SNP association according to the C _T value, whole genome association (GWAS) analysis was performed with PLINK 1.9 software, R package, and GCTA software.

Table 4 shows the trait data and the number of animals obtained from the VHSV infection experiment.

Table 4. Trait data obtained from VHSV infection experiment and the number of animals Phenotypic trait number of records Dead/Alive 1,019 Day Post Challenge (DPC) 1,019 Weight 1,019 Length 1,019 Ascites 866 Haemorrhage 865 Deformity 866 C _T value 141

The genotype data of each experimental word is QC with PLINK 1.9, then the SNP value is converted into a binary bfile format for the next analysis, and a Linear Mixed Model using R package “Gaston” , LMM) to estimate SNP association, and analyzes for binary and quantitative traits were attempted.

The proportion of phenotypic variation was estimated by applying the following equation.

GWAS analysis according to survival was performed under the condition of p-value = 0.0001 with survival as 1 and dead as 0, and heritability (h ² ) according to survival was estimated to be 0.14±0.04. and related specific SNPs were identified on chromosome 21, and other SNPs that did not exceed the effective threshold were identified (Table 5).

Table 5. Key SNP information identified in GWAS for survival CHR POS ID A1 A2 freq A2 tau beta sd p Significance Y 0 0 AX-419333515 G A 0.632974 0.701187 0.726494 0.18384 7.76E-05 Interesting 1.5% 21 5402197 AX-419319606 G A 0.515256 0.3487 -0.97187 0.191254 3.74E-07 Bonferroni 2.4% 21 5507658 AX-419319631 C A 0.523576 0.168433 -0.99603 0.177126 1.87E-08 Genome-Wide 3.0% 21 5944742 AX-419293931 A G 0.527255 0.431777 -0.88152 0.199736 1.02E-05 Interesting 1.8% 21 5989251 AX-419318420 T G 0.505435 0.371254 -0.95223 0.193814 8.96E-07 Bonferroni 2.3% 21 6041610 AX-419284664 G T 0.542365 0.416374 0.870633 0.209842 3.34E-05 Interesting 1.7% 24 10357799 AX-419329465 C T 0.600688 0.536869 0.715858 0.179702 6.79E-05 Interesting 1.5% 24 19686880 AX-419208711 T C 0.566863 0.744332 0.688369 0.176335 9.47E-05 Interesting 1.4% *CHR = chromosome number, POS = position of SNP at chromosome, ID = SNP ID, A1 = major allele, A2 = minor allele, freq A2 = minor allele frequency, beta = the SNP effect, sd = standard error, p = p -value, Y = proportion of phenotypic value explained by the SNP

GWAS analysis according to the number of days post-injection (DPC) was ^{performed under the condition of p-value = 10 -7} , giving survival 1 and death 0 per DPC, and heritability according to DPC was estimated to be 0.15±0.04, and the related specific SNP survived. Similar to the GWAS results, SNPs that were identified on chromosome 21 and that did not exceed the valid threshold were identified (Table 6).

Table 6. Key SNP information identified in DPC GWAS CHR POS ID A1 A2 freq A2 tau beta sd p Significance Y 0 0 AX-419333515 G A 0.632974 0.136321 21.06904 5.172425 4.63E-05 Interesting 1.6% 21 5402197 AX-419319606 G A 0.515256 0.098953 -25.4173 5.506198 3.91E-06 Bonferroni
1.6% 21 5507658 AX-419319631 C A 0.523576 0.081757 -25.7428 5.61771 4.60E-06 Bonferroni 2.0% 21 5944742 AX-419293931 A G 0.527255 0.106281 -24.2944 5.927224 4.15E-05 Interesting
2.0% 21 5989251 AX-419318420 T G 0.505435 0.102374 -24.1692 5.506461 1.14E-05 Interesting
1.9% 21 8631475 AX-419298730 C T 0.455217 0.133665 -23.7692 6.048988 8.51E-05 Interesting
1.5% 21 8997644 AX-419279745 A C 0.522124 0.1309 -22.9823 5.631475 4.48E-05 Interesting
1.6% 21 9548324 AX-419318749 A G 0.54626 0.141669 -23.1311 5.797107 6.60E-05 Interesting
1.5% 24 19686880 AX-419208711 T C 0.566863 0.147644 20.77149 5.028503 3.62E-05 Interesting
1.5% *CHR = chromosome number, POS = position of SNP at chromosome, ID = SNP ID, A1 = major allele, A2 = minor allele, freq A2 = minor allele frequency, beta = the SNP effect, sd = standard error, p = p -value, Y = proportion of phenotypic value explained by the SNP

SNPs related to body weight, body length, ascites, haemorrhage, and deformity were identified, but did not exceed the effective threshold, and _{SNPs related to CT} values were not identified.

11 SNPs for predicting VHSV resistance were selected based on the main SNP information confirmed by the survival GWAS and DPC GWAS, and their nucleotide sequences are shown in Table 7.

Table 7. Base sequence and related gene information of VHSV resistance prediction SNP SEQ ID NO: chr pos id A1 A2 Sequence VSHV resistance genotype Related gene Region One 0
(AGQT02032065.1) 0 AX-419333515 G A GTATTCTACAGAAGTGTTTAGATTTAGGTTTGTCT[A/G]TAAATCCGCTCTCTGTTTCCTGAACTCACCCACGT A (Gene) Paralichthys olivaceus 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase gamma-1-like exon 2 21
(CM007777.1) 5402197 AX-419319606 G A AGATTTCTGACAGCAGAAAATGACGCAGCTGCCAC[A/G]GAAAGAATTCTCACTGAATGAGGTTTGAATTCAAA G (Upstream) Paralichthys olivaceus ephrin type-A receptor 4-like
(Downstream) unknown intergenic 3 21
(CM007777.1) 5507658 AX-419319631 C A TGTTTAGTAAGCTTGTCTGGTTTTCATCCAGCTTC[A/C]CTTCTGCATCATGTGTGTCCCAAATCCATACCACA C (Upstream) Paralichthys olivaceus splA/ryanodine receptor domain and SOCS box containing 4 (spsb4)
(Downstream) Paralichthys olivaceus calsyntenin 2 (clstn2) intergenic 4 21
(CM007777.1) 5944742 AX-419293931 A G TTTTAAACCTGATTGATTAATAACATAACGCCAAG[A/G]AATTTGAAACGTGCTGAGCTTTTGTCCTCGTGCAG A (Gene) Paralichthys olivaceus phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta (pik3cb) intron 5 21
(CM007777.1) 5989251 AX-419318420 T G GTTATGGACTGTCATGGAGAATGATCCATTTCAAT[G/T]GATGGGTCTCAATGTGAGCCCAAGCTATATGTCAA T (Upstream) Paralichthys olivaceus transcription cofactor HES-6-like
(Downstream) Paralichthys olivaceus transcription cofactor HES-6-like predicted as intergenic
(possible intron) 6 21
(CM007777.1) 6041610 AX-419284664 G T AGCCGATGATCGACCAGACAAATCGCTCAGGTGAG[G/T]GTGGCCGTAATACACTTACTTATATTCTGCGCTTG T (Gene) Paralichthys olivaceus homeobox protein meis3-B-like intron 7 24
(CM007780.1) 10357799 AX-419329465 C T AGATAAGTGTGGTTCTAGCCTTCATTGTGATGATA[C/T]TCGTGCAGCTGCCTCATGTGGCTCCTGAGACGTGT T (Gene) Paralichthys olivaceus peroxiredoxin-6-like intron 8 24
(CM007780.1) 19686880 AX-419208711 T C TATTAACTTTATAATTGTCTTTTTCTTGCAGACTGA[C/T]GAGGAGAATGTTTCCTAACTTTTCTCTGCACTTAT C (Upstream) Paralichthys olivaceus microsatellite Poli422TUF sequence
(Downstream) Unknown
intergenic 9 21
(CM007777.1) 8631475 AX-419298730 C T CTCCAACATGTGCATAACACTGATCTGCTGAAAGT[C/T]TTCCACCAAACAGCATGGTGCAGTTCAACGTGTTA C (Gene) Paralichthys olivaceus centrosomal protein 164 (cep164) exon 10 21
(CM007777.1) 8997644 AX-419279745 A C GTGATGAGACAACTGATGAAGCTCATATATTCTGC[A/C]GAAAAGGAGCAGAGGCTTAAAATTAAATGACTACT A (Upstream) Paralichthys olivaceus sialic acid acetylesterase (siae)
(Downstream) Unknown intergenic 11 21
(CM007777.1) 9548324 AX-419318749 A G TGATGTTGCTGCTTTGCTGTATCACATCCTCGCTA[A/G]TTTCTCTGTCAAGATTTTCTGTACCATCTGTGCTT A (Upstream) Unknown
(Downstream) Kirre like nephrin family adhesion molecule 3b (kirrel3b) intergenic

The 11 SNPs were confirmed as VHSV resistance genotypes with reference to the following analysis results.

Referring to FIG. 7, as a Boxplot for the mean and standard error values for each genotype associated with VHSV resistance, a score of 1 for survival and 0 for death was given every day post challenge (DPC) in the VHSV infection experiment. A total score for 40 days of the total experiment time was calculated (DPC1).

The DPC1 and genotype of each individual were correlated with each other to calculate the mean and standard error for each genotype, and the number of surviving or dead individuals for each genotype was identified and displayed on the phenotype distribution graph for the genotype.

When the VHSV resistance genotype is included, it is confirmed that the DPC average is high and the number of surviving fish is high. When selecting an individual having the VHSV resistance genotype including the 11 SNPs, it can be expected that the survival probability against VHSV infection is high. .

2-4. Genetic analysis of VHSV resistance by pedigree

Table 8 shows the heritability estimated from GWAS analysis for VHSV resistance through genetic parameter analysis.

Table 8. Genetic heritability related to VHSV resistance Phenotypic trait Heritage p-value Significant to selection Major related chromosomes Survival 0.14±0.04 0.0001 Significant 21 Days after injection (DPC) 0.15±0.04 1X10 ^-7 Significant 21

In the survival and DPC-based analysis, an effective value of 0.14 to 0.15 is estimated, which is a value that can be sufficiently expected to improve the trait through genome selection, and the related SNP marker can be used as a marker for VHSV resistance selection. can be expected to be

<110> Jeju National University Industry-Academic Cooperation Foundation Jeju Special Self-Governing Province <120> SNP marker for predicting resistant to viral hemorrhagic septicemia virus of Paralichthys olivaceus and use thereof <130> DP20210072 <160> 11 <170> KoPatentIn 3.0 <210> 1 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> AX-419333515 <400> 1 gtattctaca gaagtgttta gatttaggtt tgtctagtaa atccgctctc tgtttcctga 60 actcacccac gt 72 <210> 2 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> AX-419319606 <400> 2 agatttctga cagcagaaaa tgacgcagct gccacaggaa agaattctca ctgaatgagg 60 tttgaattca aa 72 <210> 3 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> AX-419319631 <400> 3 tgtttagtaa gcttgtctgg ttttcatcca gcttcacctt ctgcatcatg tgtgtcccaa 60 atccatacca ca 72 <210> 4 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> AX-419293931 <400> 4 ttttaaacct gattgattaa taacataacg ccaagagaat ttgaaacgtg ctgagctttt 60 gtcctcgtgc ag 72 <210> 5 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> AX-419318420 <400> 5 gttatggact gtcatggaga atgatccatt tcaatgtgat gggtctcaat gtgagcccaa 60 gctatatgtc aa 72 <210> 6 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> AX-419284664 <400> 6 agccgatgat cgaccagaca aatcgctcag gtgaggtgtg gccgtaatac acttacttat 60 attctgcgct tg 72 <210> 7 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> AX-419329465 <400> 7 agataagtgt ggttctagcc ttcattgtga tgatacttcg tgcagctgcc tcatgtggct 60 cctgagacgt gt 72 <210> 8 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> AX-419208711 <400> 8 tattaacttt ataattgtct tttcttgcag actgactgag gagaatgttt cctaactttt 60 ctctgcactt at 72 <210> 9 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> AX-419298730 <400> 9 ctccaacatg tgcataacac tgatctgctg aaagtctttc caccaaacag catggtgcag 60 ttcaacgtgt ta 72 <210> 10 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> AX-419279745 <400> 10 gtgatgagac aactgatgaa gctcatatat tctgcacgaa aaggagcaga ggcttaaaat 60 taaatgacta ct 72 <210> 11 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> AX-419318749 <400> 11 tgatgttgct gctttgctgt atcacatcct cgctaagttt ctctgtcaag attttctgta 60 ccatctgtgc tt 72

Claims (7)

a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is G or A;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:2 is G or A;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:3 is C or A;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:4 is A or G;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is T or G;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:6 is G or T;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, in which the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is C or T;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:8 is T or C;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is C or T;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:10 is A or C; and
The 36th nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11 is A or G, and a polynucleotide consisting of 10 to 50 consecutive bases including the 36th nucleotide or a nucleotide complementary thereto; selected from the group consisting of; containing one or more of the
A single nucleotide polymorphism (SNP) marker composition for predicting resistance to flounder viral hemorrhagic septicemia virus (VHSV). The method of claim 1,
When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is A; When the 36th nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is G; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is C; When the 36th nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is A; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is T; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 is T; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is T; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 is C; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is C; When the 36th nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10 is A; Or, when the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11 is A, it is predicted to be VHSV-resistant halibut,
SNP marker composition for predicting VHSV resistance of halibut. A composition for predicting VHSV resistance of halibut, comprising an agent capable of detecting or amplifying a SNP (Single Nucleotide Polymorphism) marker for prediction of viral hemorrhagic septicemia virus (VHSV) resistance of halibut,
The SNP marker is
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is G or A;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:2 is G or A;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:3 is C or A;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:4 is A or G;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is T or G;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:6 is G or T;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, in which the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is C or T;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:8 is T or C;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is C or T;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:10 is A or C; and
The 36th nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11 is A or G, and a polynucleotide consisting of 10 to 50 consecutive bases including the 36th nucleotide or a nucleotide complementary thereto; selected from the group consisting of; containing one or more of the
A composition for predicting VHSV resistance of halibut. 4. The method of claim 3,
Wherein the agent is a primer or probe capable of detecting or amplifying the SNP marker, the composition for predicting VHSV resistance of halibut. A kit for predicting resistance to viral hemorrhagic septicemia virus (VHSV) resistance of halibut, comprising the composition of claim 3 . (a) amplifying or detecting the polymorphic site of the SNP marker for prediction of viral hemorrhagic septicemia virus (VHSV) resistance of halibut from the DNA of the sample isolated from halibut; and
(b) determining the base of the polymorphic site amplified or detected in step (a),
The SNP marker of step (a) is,
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is G or A;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:2 is G or A;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:3 is C or A;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:4 is A or G;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is T or G;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:6 is G or T;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, in which the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is C or T;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:8 is T or C;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is C or T;
a polynucleotide consisting of 10 to 50 consecutive bases including the 36th base, or a nucleotide complementary thereto, wherein the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:10 is A or C; and
The 36th nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11 is A or G, and a polynucleotide consisting of 10 to 50 consecutive bases including the 36th nucleotide or a nucleotide complementary thereto; selected from the group consisting of; A method for predicting VHSV resistance of flatfish, including one or more of which is. 7. The method of claim 6,
When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is A; When the 36th nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is G; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is C; When the 36th nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is A; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is T; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 is T; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is T; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 is C; When the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is C; When the 36th nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 10 is A; Or, when the 36th base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11 is A, it is predicted to be VHSV-resistant halibut,
A method for predicting VHSV resistance in halibut.

Images