KR102267359B1 - Acetobacter pasteurianus A37 and manufacturing method of fermented Kujippong vinegar using the same - Google Patents

Abstract

The present invention relates to Acetobacter pasteurianus A37 acetic acid bacteria and to a method for producing kkujippong fermented vinegar using the acetic acid bacteria. Specifically, the present inventors isolated and identified Acetobacter pasteurianus A37 acetic acid bacterium, which produces high concentration of acetic acid even at high alcohol concentration, has excellent alcohol resistance and acid production ability and is also excellent in fragrance production, and the Acetobacter pasteurianus A37 acetic acid bacteria As a result of preparing Cujippong fermented vinegar using , it was confirmed that the acid-producing ability, antioxidant activity, and content of functional ingredients were high at the initial pH of 4 and 20℃. Therefore, the method for producing kkujippong fermented vinegar of the present invention can make acetic acid fermentation at a low temperature and with fast efficiency, and has the advantage of being able to produce fermented kkujippong vinegar with a high content of antioxidant activity and functional ingredients.

Description

Acetobacter pasteurianus A37 acetic acid bacteria and fermented Kujippong vinegar manufacturing method using the acetic acid bacteria {Acetobacter pasteurianus A37 and manufacturing method of fermented Kujippong vinegar using the same}

The present invention relates to an acetobacter pasteurianus A37 acetic acid bacterium having excellent acid-producing ability, alcohol resistance and fragrance-producing ability, and a method for producing kkujippong fermented vinegar using the acetic acid bacterium.

Vinegar is one of the fermented foods that have been manufactured and used for a long time in both East and West, and is a representative seasoning with a sour taste that is easily used in daily life. Vinegar is divided into fermented vinegar and diluted acetic acid according to the manufacturing method. Fermented vinegar is vinegar made by fermenting grains, fruits, and alcoholic beverages as main ingredients, and diluted acetic acid is vinegar made by diluting glacial acetic acid or acetic acid with drinking water. Fermented vinegar is further divided into natural fermented vinegar and alcoholic fermented vinegar depending on the method of making it. Natural fermented vinegar is made by fermenting alcohol to make alcohol and then fermenting it again with acetic acid. Ethyl alcohol (alcohol) with a purity of 96~99% is diluted. Compared to alcoholic fermented vinegar that ferments acetic acid, it has richer functional ingredients and is beneficial to health. In addition, fermented vinegar is largely divided into two types depending on the raw material, and grain vinegar fermented as a raw material and fruit vinegar fermented as a raw material are representative. Various organic acids and amino acids present in vinegar are involved in energy metabolism in the body, thereby inhibiting the accumulation and production of lactic acid, a fatigue substance, and lipid peroxide that causes arteriosclerosis, thrombosis, and the like. In addition, vinegar prevents obesity and is good for skin health and beauty, as well as removing toxins and hangovers in the human body. In addition, it has been reported that it exhibits various physiological activities such as an increase in calcium absorption rate, relief of constipation, alleviation of eye fatigue, and increase in resistance.

Cudrania tricuspidata (Carr.) Bureau ex Lavallee) is a deciduous tree belonging to the Morus family, called Cudrania tricuspidata (Carr.) Bureau ex Lavallee. The root bark, bark, bark and leaves of Cudrania mulberry contain various ingredients effective for the human body, so Cuji mulberry has been used as a blood pressure lowering agent, tuberculosis, depending on its root, bark, stem, leaf, bark, fruit, etc. It has been used as a medicine such as a treatment, antipyretic, anti-dry, expectorant, diuretic, hemostatic, antipyretic, etc., and is used as an antifungal agent for athlete's foot and for chronic indigestion caused by weakness of the digestive system. The fruit of the mulberry tree is a chrysanthemum, round, about 2.5 cm in diameter, matures in red from September to October, and the flesh is sweet and edible. The fruit is known to contain useful organic substances such as vitamins B, B1, B2, C, linoleic acid, glucose, maltose, fructose, malic acid, and lemon acid. In addition, Cujippong fruit contains flavonoids, which are known to have anticancer effects, so that it is widely known from ancient times that it is used as a medicine in Donguibogam, Yakseonggam, and Bonchogangmok, and continuous research is being conducted in recent years. Kujippong has been shown to have good effects when applied to patients who cannot use chemotherapy or radiation therapy. It not only prevents tumors from growing or shrinks, but also relieves pain and increases appetite, thereby increasing weight and eliminating ascites. have.

Various physiologically active substances and antioxidants contained in kkujippong are unstable after extraction, and there are cases where they are toxic to the human body, so many attempts are being made to improve the effect by stabilizing, reducing toxicity, or converting them into stable derivatives. As a part of it, a biological transformation method using microorganisms or enzymes is being developed. Fermentation is a representative method of bioconversion. Among them, vinegar produced through acetic acid fermentation produces nutrients such as organic acids and amino acids such as acetic acid, citric acid, and lactic acid that give a sour taste, and has a function of decomposing lactic acid, so it has a fatigue recovery effect. It has various health and beauty effects, such as lowering the viscosity of blood and removing cholesterol from the inner wall of blood vessels.

Korean Patent No. 10-1139032 discloses a method for producing Cuji mulberry vinegar using Cuji mulberry bark and the Cuji mulberry vinegar produced thereby, and Korean Patent No. 10-1895521 discloses a method of manufacturing Cuji mulberry fermented vinegar using Cuji mulberry tree. Although disclosed, the fermented vinegar prepared by using Acetobacter pasteurianus A37 acetic acid bacteria and Cujippong fruit of the present invention has not been disclosed.

In order to make vinegar, it is necessary to inoculate alcohol with acetic acid bacteria and ferment it with acetic acid. In order to produce high-quality fermented vinegar, since acetic acid must be produced with high efficiency even in a high alcohol concentration environment, it is essential to isolate acetic acid bacteria having alcohol resistance and excellent acid production ability.

Accordingly, the present inventors have isolated and identified novel acetic acid bacteria suitable for fruit vinegar production due to excellent acid production ability and fragrance production ability in high concentration alcohol while having alcohol resistance, and as a result of manufacturing Cujippong fermented vinegar with the isolated acetate bacteria, at low temperature The present invention was completed by succeeding in producing kkujippong fermented vinegar with high acidity and high content of functional ingredients within a short time.

An object of the present invention is to use Acetobacter pasteurianus A37 acetic acid bacterium, which has excellent acid production ability, alcohol resistance and fragrance production ability, and Cujipon fermented vinegar having excellent acid production ability at initial pH 4 and 20 ℃ and high content of functional ingredients using the acetic acid bacteria. It is to provide a production method and kkujippong fermented vinegar prepared using the method.

In order to achieve the above object, the present invention

It provides an A37 strain of Acetobacter pasteurianus deposited with accession number KACC 92206P.

In addition, the present invention comprises the steps of 1) preparing a kkujippong juice;

2) pre-treating the kkujippong juice prepared in step 1);

3) fermenting the pre-treatment of step 2) to prepare a fermented kkujippong juice; and

4) Acetobacter pasteurianus ( Acetobacter pasteurianus ) A37 strain deposited with the accession number KACC 92206P in the kkujippong fermented strain of step 3) to inoculate to prepare kkujippong fermented vinegar; It provides a method for producing kkujippong fermented vinegar, comprising a.

In addition, the present invention provides a kkujippong fermented vinegar prepared by the above method.

The present invention relates to Acetobacter pasteurianus A37 acetic acid bacteria and to a method for producing kkujippong fermented vinegar using the acetic acid bacteria. Specifically, the present inventors isolated and identified Acetobacter pasteurianus A37 acetic acid bacterium, which produces high concentration of acetic acid even at high alcohol concentration, has excellent alcohol resistance and acid production ability and is also excellent in fragrance production, and the Acetobacter pasteurianus A37 acetic acid bacteria As a result of preparing Cujippong fermented vinegar using , it was confirmed that the acid-producing ability, antioxidant activity, and content of functional ingredients were high at the initial pH of 4 and 20℃. Therefore, the method for producing kkujippong fermented vinegar of the present invention can make acetic acid fermentation at a low temperature and with fast efficiency, and has the advantage of being able to produce fermented kkujippong vinegar with a high content of antioxidant activity and functional ingredients.

1 is a diagram of observing whether a transparent ring is formed by acetic acid production using a solid medium to which calcium carbonate is added in order to select acetic acid bacteria with excellent acid-producing ability from 38 points of fermented vinegar collected from farmhouse-type workplaces.
2a to 2h are diagrams showing the size of a transparent ring generated by acetic acid production using a solid medium to which calcium carbonate is added, and quantitatively evaluating the acid-producing ability of acetic acid bacteria.
3a to 3h are diagrams showing the results of measuring the acidity of acetic acid produced by the acetic acid bacteria in order to measure the quantitative acid-producing ability of the acetic acid bacteria.
Figure 4 is a diagram showing the results of measuring the acidity produced by each acetic acid bacteria at an alcohol concentration of 6 to 9% to select alcohol-resistant acetic acid bacteria.
FIG. 5 is a view of microscopic examination through a microscope after gram-staining each acetic acid bacteria in order to analyze the morphological characteristics of 11 selected acetic acid bacteria.
6 is a phylogenetic diagram of selected acetic acid bacteria.
7 is a view showing the size of the transparent ring produced by the seedlings prepared using the final selected three types of acetic acid bacteria (A26, A37 and B7) at 20 ℃ and 30 ℃ compared with the control ( A. malorum ).
8A and 8B are diagrams showing the acidity of acetic acid produced at 20° C. and 30° C. in seed plants prepared using the three final selected acetic acid bacteria (A26, A37 and B7).
9a to 9c are diagrams showing the browning inhibitory effect of kkujippong juice according to the concentrations (0.05, 0.1, 0.15 and 0.2%) of each browning inhibitor (PVPP, ascorbic acid, bentonite and calcium persulfate).
Figures 10a to 10c are for clarification of kkujippong juice, cellulase, pectinase and cellulase: pectinase = 1:1 clarification of the kkujippong juice according to the concentration (100, 200 and 300 ppm) of the mixed enzyme It is a diagram showing the fire effect.
11a to 11c are diagrams showing changes in pH and acidity of kkujippong fermented wine according to the fermentation period at each temperature (18, 25 and 30 ℃).
12a to 12c are diagrams showing changes in sugar content and alcohol concentration of kkujippong fermented wine according to the fermentation period at each temperature (18, 25 and 30 ℃).
13a to 13c are diagrams showing the browning degree and turbidity change of kkujippong fermented wine according to the fermentation period at each temperature (18, 25 and 30 ℃).
Figure 14a is a diagram showing the pH and acidity change of kkujippong fermented vinegar according to the fermentation period at each pH of Acetobacter Pasteurianus A26 acetic acid bacteria.
Figure 14b is a diagram showing the pH and acidity change of kkujippong fermented vinegar according to the fermentation period at each pH of Acetobacter Pasteurianus A37 acetic acid bacteria.
Figure 14c is a diagram showing the pH and acidity change of kkujippong fermented vinegar according to the fermentation period at each pH of Acetobacter Pasteurianus B7 acetic acid bacteria.
Figure 15a is a diagram showing the content of total phenolic compounds of kkujippong fermented vinegar according to the fermentation period at each pH of Acetobacter pasteurianus A26 acetic acid bacteria.
Figure 15b is a diagram showing the content of total phenolic compounds of kkujippong fermented vinegar according to the fermentation period at each pH of Acetobacter Pasteurianus A37 acetic acid bacteria.
Figure 15c is a diagram showing the content of total phenolic compounds of kkujippong fermented vinegar according to the fermentation period at each pH of Acetobacter Pasteurianus B7 acetic acid bacteria.
Figure 16a is a diagram showing the total flavonoid content of kkujippong fermented vinegar according to the fermentation period at each pH of Acetobacter Pasteurianus A26 acetic acid bacteria.
Figure 16b is a diagram showing the total flavonoid content of kkujippong fermented vinegar according to the fermentation period at each pH of Acetobacter Pasteurianus A37 acetic acid bacteria.
Figure 16c is a diagram showing the total flavonoid content of kkujippong fermented vinegar according to the fermentation period at each pH of Acetobacter Pasteurianus B7 acetic acid bacteria.
Figure 17a is a diagram showing the DPPH radical scavenging ability of kkujippong fermented vinegar according to the fermentation period at each pH of Acetobacter pasteurianus A26 acetic acid bacteria.
Figure 17b is a diagram showing the DPPH radical scavenging ability of kkujippong fermented vinegar according to the fermentation period at each pH of Acetobacter Pasteurianus A37 acetic acid bacteria.
Figure 17c is a diagram showing the DPPH radical scavenging ability of kkujippong fermented vinegar according to the fermentation period at each pH of Acetobacter Pasteurianus B7 acetic acid bacteria.
Figure 18a is a diagram showing the ABTS cation radical scavenging ability of kkujippong fermented vinegar according to the fermentation period at each pH of Acetobacter pasteurianus A26 acetic acid bacteria.
Figure 18b is a diagram showing the ABTS cation radical scavenging ability of kkujippong fermented vinegar according to the fermentation period at each pH of Acetobacter pasteurianus A37 acetic acid bacteria.
Figure 18c is a diagram showing the ABTS cation radical scavenging ability of kkujippong fermented vinegar according to the fermentation period at each pH of Acetobacter Pasteurianus B7 acetic acid bacteria.
19 is a schematic diagram showing the manufacturing process of kkujippong fermented vinegar.

Hereinafter, the present invention will be described in detail.

The present invention provides an A37 strain of Acetobacter pasteurianus deposited with accession number KACC 92206P.

The strain was isolated from plum vinegar.

The strain is excellent in any one or more selected from the group consisting of acid-producing ability, alcohol resistance and fragrance-producing ability.

The strain may be for producing kkujippong fermented vinegar, but is not limited thereto.

In addition, the present invention comprises the steps of 1) preparing a kkujippong juice;

2) pre-treating the kkujippong juice prepared in step 1);

3) preparing a fermented kkujippong juice by fermenting the kkujippong juice after the pretreatment of step 2) with alcohol; and

4) Acetobacter pasteurianus ( Acetobacter pasteurianus ) A37 strain deposited with the accession number KACC 92206P in the kkujippong fermented strain of step 3) to inoculate to prepare kkujippong fermented vinegar; It provides a method for producing kkujippong fermented vinegar, comprising a.

The kkujippong juice of step 1) can be used by washing, squeezing, and hydrolyzing the kkujippong fruit, and fermenting at 20 to 30 ° Brix, specifically, at 22 to 25 ° Brix. If the sugar content of the cujibbong juice is lower than 22 ° Brix, the sugar content of vinegar may be lowered, and overall preferences such as taste and aroma may also be lowered, and if the sugar content of the cujibbong juice is too high, the acetic acid fermentation may not be possible due to the high viscosity can

The pretreatment of kkujippong juice of step 2) is to suppress browning by adding 0.05 to 0.5 (w/v) ascorbic acid; and

2) clarification by adding 100 to 400 ppm of cellulase and pectinase in a ratio of 1:1; includes

In the pretreatment step, preferably, 0.1 to 0.3 (w/v) of ascorbic acid, 200 to 400 ppm of cellulase and pectinase may be added in a ratio of 1:1.

The alcoholic fermentation of step 3) may be subjected to stationary fermentation at 18 to 30°C for 3 days to 14 days, specifically, at 20 to 27°C for 10 to 14 days, more specifically at 23 to 26°C for 11 days to 13 days. It can be politically fermented for one day.

The seed seed is Acetobacter pasteurianus ( Acetobacter pasteurianus ) It can be prepared by inoculating the A37 strain into a kkujippong fermented strain having an alcohol concentration of 6 to 9% and culturing for 10 to 14 days at 27 to 32 ℃, specifically It can be prepared by inoculating kkujippong fermented wine with an alcohol concentration of 7 to 9% and culturing for 10 to 14 days at 27 to 32 ° C. It can be prepared by culturing at 31° C. for 11 to 13 days.

Kujippong fermented vinegar of step 4) is prepared by inoculating the seed prepared using the A37 strain Acetobacter pasteurianus deposited with accession number KACC 92206P.

The seed seed may be inoculated at a concentration of 7 to 15% (v/v), specifically, may be inoculated at a concentration of 9 to 12% (v/v).

The step 4) can be inoculated with Acetobacter pasteurianus A37 strain in the Kujippong fermented strain of initial pH 3 to 5 and fermented at 18 to 23 ° C. for 20 to 35 days, specifically, the initial pH 3.5 Acetobacter pasteurianus ( Acetobacter pasteurianus ) A37 strain can be inoculated into the kkujippong fermented strain of to 4.5 and fermented statically for 25 to 33 days at 19 to 22 ℃.

In step 4), acetic acid fermentation takes place, and the acetic acid fermentation may be performed by a farmhouse-type stationary fermentation (surface fermentation) or a corporate-type rapid fermentation (deep fermentation), and specifically, it may be performed by a method of stationary fermentation. Stationary fermentation is a method in which acetic acid bacteria are inoculated into the medium and then acetic acid fermentation is carried out in a stationary state. The fermentation facility is simple, so the initial investment cost can be minimized and a mild sour taste can be produced. Fermentation conditions such as skill must be controlled, fermentation must be carried out for a long time, and there are problems in that the yield is low and the vinegar already has an off-flavor. On the other hand, deep fermentation can control fermentation conditions such as fermentation temperature and aeration amount, so the fermentation period is shorter than that of stationary fermentation (surface fermentation), and the yield and acidity of vinegar can be increased. There is a problem that the sensibility is reduced.

In addition, the present invention provides kkujippong fermented vinegar prepared by the above manufacturing method.

In a specific embodiment of the present invention, the Acetobacter pasteurianus A37 strain has excellent acid production ability even at an alcohol concentration of 9%, and has excellent flavor production ability by generating sweet scent, and is separated into acetic acid bacteria suitable for fruit vinegar production. It was identified and deposited with the Korea Agricultural Microorganisms Conservation Center (KACC) on October 23, 2017, and was given an accession number KACC 92206P on October 30, 2017 In addition, as a result of preparing Cuji pony fermented vinegar using Acetobacter pasteurianus A37 strain, as a result of fermenting for 30 days at an initial pH of 4, 20 ℃, the acidity is increased in a short time, the antioxidant activity is high, and the functional It was confirmed that the high content of ingredients can produce excellent quality Cujipon fermented vinegar.

Therefore, the Acetobacter pasteurianus A37 strain of the present invention can be usefully used in the production of fruit vinegar, and has a high acidity through the production method of Cujippong fermented vinegar using the strain, and the content of antioxidant activity and functional ingredients This high Cujippong fermented vinegar can be prepared.

Hereinafter, the present invention will be described in detail by way of Examples and Experimental Examples.

However, the following Examples and Experimental Examples only illustrate the present invention, and the content of the present invention is not limited by the following Examples and Experimental Examples.

<Example 1> Selection of acetic acid bacteria for fruit vinegar production

<1-1> Fermented vinegar and acetic acid bacteria collection

Fruit Vinegar In order to select acetic acid bacteria with excellent ability to produce fruit vinegar, alcohol tolerance and fragrance, food experts, farmhouse-type businesses, and food-related research institutes were selected in 5 regions (Gyeonggi-do, Seoul, Chungcheong-do, Gangwon-do, Jeolla-do, and Gyeongsang-do) Fermented vinegar and acetic acid bacteria 96 points were collected.

A total of 96 samples were collected from Gangwon-do (39 points), Gyeonggi-do (6 points), Jeolla-do (35 points), Chungcheong-do (9 points), Gyeongsang-do (6 points), and Seoul (5 points). Tables 1 and 2 show the collection areas, raw materials, real photos, and collection dates of 38 kinds of vinegar collected, and Table 3 shows the collection areas and collection dates of 58 various acetic acid bacteria strains collected at food-related research institutes.

<1-2> Selection and separation of acetic acid bacteria with acid-producing ability from the collected vinegar

In Example 1-1, vinegar in which acetic acid-producing bacteria was present was selected from the vinegars of 38 points collected from farmhouse-type workplaces, and the following experiment was performed to isolate acetic acid bacteria from vinegar.

Specifically, the vinegar fermentation broth of 38 points collected in Example 1-1 was mixed with calcium carbonate (CaCO ₃ ) in a solid medium containing 1 g/ml (Acetobacter solid medium, ASM, Yeast extract 0.5%, glucose 3.0%, carbonic acid). Calcium 1.0%, ethanol 3.0%, agar 2.0%), spread and inoculated, and cultured at 30 ℃ for 5 days. Since acetic acid bacteria grown on the solid medium form colonies, they were re-inoculated by streaking on a new solid medium using platinum lice, and then culturing each medium again at 30° C. for 5 days to purely isolate the acetate bacteria. After that, the solid medium, which originally had an opaque color due to the content of calcium carbonate, is decomposed by acetic acid bacteria that produce acetic acid, resulting in a transparent ring. Accordingly, it was confirmed whether calcium carbonate was decomposed according to the generation of acetic acid to form a clear zone.

As a result, as shown in FIG. 1, the vinegar of 30 points in which a transparent ring is generated due to the decomposition of calcium carbonate by generating acetic acid was selected, and the acetic acid bacteria were separated from the vinegar.

<Example 2> Selection of acetic acid bacteria with excellent acid-producing ability

<2-1> Classification of acetic acid bacteria

Acetic acid bacteria isolated from 30 points of farmhouse-type fermented vinegar of Example 1-2, 58 acetic acid bacteria collected from food-related research institutes A (30 acetic acid bacteria isolated from farmhouse-type fermented vinegar), B (from food-related research institutes) Acetic acid bacteria collected) and C (Acetacid bacteria collected from the Agro-Food Research Institute) were numbered as shown in Tables 4 and 5 below, and 88 strains of acetate bacteria were numbered.

<2-2> Selection of acetic acid bacteria with excellent acid-producing ability through qualitative evaluation

In order to qualitatively select acetic acid bacteria with excellent acid-producing ability from the 88 strains of acetic acid bacteria of Example 2-1, the size of the transparent rings produced by each acetate bacteria according to the incubation period in a calcium carbonate solid medium was measured.

Specifically, calcium carbonate (CaCO ₃ ) 1.0% (v/v) added solid medium (Acetobacter solid medium, ASM, Yeast extract 0.5%, glucose 3.0%, calcium carbonate 1.0%, ethanol 3.0%, agar 2.0%) After 1 spot inoculation of each acetic acid bacteria grown on a toothpick (toothpick), while culturing at 30 ℃ for 168 hours, the size of the transparent ring formed by decomposition of calcium carbonate by acetic acid at 24 hour intervals was measured. For the size of the transparent ring, the diameter of the transparent ring was measured to two decimal places using a digital caliper. When the size of the transparent ring is 30 mm or more, '+++', when it is 20 mm or more, '++', when it is 10 mm or more, '+', when less than 10 mm, indicated by '-' and shown in Tables 6 and 7 below. For the control group of this experiment, Acetobacter pasteurianus CV3 (KACC 17058) registered with the Strain Conservation Center was received and used, and the acetic acid bacteria with a larger clear ring diameter than that of the control group were selected.

As a result, as shown in Tables 6 and 7, acetic acid bacteria that formed the largest diameter transparent ring were a total of 32 strains (A6, A9, A11-②, A12, A19, A21-①, A21-③, A24, A26). , A28-①, A28-②, A32, A33, A36, A37, A38, B3, B5, B6, B7, B11, B24, B25, B27, C1, C4, C9, C10, C11, C12, C14, C15 ), and as shown in FIGS. 2a to 2h, 16 strains of acetic acid bacteria isolated from farmhouse-type fermented vinegar (A type) compared to the control CV3 acetic acid bacteria (4, 6, 9, 11-2, 12, 19, 21-1, 21-3, 24, 26, 28-2, 32, 33, 36, 37, 38), food-related research institutes (type B) for 8 weeks (3, 5, 6, 7, 11, 24) , 25, 27), and 8 weeks (1, 4, 9, 10, 11, 12, 14, 15) of the Agro-Food Research Institute (C type) showed excellent acid production in proportion to the culture period for a total of 32 weeks.

<2-3> Selection of acetic acid bacteria with excellent acid-producing ability through quantitative evaluation

The acidity of acetic acid produced by the acetic acid bacteria was measured as follows in order to secondarily select acetic acid bacteria having excellent acid-producing ability through quantitative evaluation of the 32 strains of acetic acid bacteria isolated in Example 2-2.

Specifically, the measurement of the acidity of acetic acid produced by the activity of acetic acid bacteria was carried out through pre-culture and main culture. First, pre-culture is 10 ㎖ of liquid medium for acetic acid bacteria (Acetobacter liquid medium, ALM, Yeast extract 0.5%, glucose 0.5%, glycerin 1.0%, MgSO ₄ ㆍ7H ₂ O 0.02%, ethanol 6.0%, acetic acid 1.0%) in a test tube. After each aliquot, 1 platinum was inoculated with each of the acetic acid bacteria that had been firstly separated from pure water and cultured at 30° C. for 48 hours. Then, for the main culture, 100 ml each of the same liquid medium as the pre-culture was dispensed into a 500 ml Erlenmeyer flask, and then 10 ml of the pre-culture solution was inoculated and cultured at 30°C.

For acidity measurement, 1 ㎖ of sample was collected every 4 days, diluted 10 times with 9 ㎖ of distilled water, 2 to 3 drops of 1% phenolphthalein solution was added, and then the appropriate consumption of 0.1N NaOH solution was calculated by the following equation. .

Acidity (%) =V×F×A×D×1/S×100

V: Appropriate consumption of 0.1N-NaOH solution (ml)

F: titer of 0.1N-NaOH solution

A: Amount of organic acid equivalent to 1 ml of 0.1N-NaOH solution (acetic acid = 0.006)

D: dilution factor

S: Sample collection amount (ml)

Most of the acidity of acetic acid bacteria reached the stational phase after 7 days of culture and the acidity did not increase any more, so the amount of acetic acid production was measured by limiting the fermentation period to 7 days. .

As a result, as shown in FIGS. 3a to 3h, 15 strains of type A (A6, A9, A11-2, A12, A19, A21-1, A21-) in which the acidity of the isolated acetic acid bacteria according to the fermentation period was 5.5% or more 3, A24, A26, A28-1, A28-2, A33, A36, A37, A38), B type 7 weeks (B3, B5, B6, B7, B11, B24, B25) and C type 7 weeks (C1, A total of 29 strains of C4, C9, C10, C11, C12, C15) were secondarily screened.

<Example 3> Selection of acetic acid bacteria with excellent alcohol resistance

Since vinegar is produced by acetic acid fermentation of alcohol, in order to manufacture fermented vinegar with high efficiency, it is necessary to select acetic acid bacteria that produce acetic acid with high efficiency in an environment with high alcohol concentration. For the acetic acid bacteria selected in Example 2-3, the alcohol concentration of the medium (6.0, 7.0, 8.0, 9.0%) to select excellent native acetic acid bacteria that are resistant to high alcohol concentration and can produce a lot of acetic acid Under different conditions, the acid-forming ability they generate was compared.

Specifically, after inoculating the primary isolated acetic acid bacteria in each liquid medium (ALM) adjusted for each alcohol concentration (6 to 9%), the acidity was measured at 4 day intervals while culturing at 30 ° C for 20 days. At the same time confirming the alcohol tolerance, the acid production ability by alcohol concentration was comparatively analyzed. Alcohol concentration (6.0, 7.0, 8.0, 9.0%) and fermented at 30° C. for 20 days, the acidity was analyzed at 4-day intervals to select acetic acid bacteria with excellent acid-producing ability while resistant to high-alcohol conditions.

As a result, as shown in FIG. 4, in 15 strains of type A farmhouse type fermented vinegar, 6 strains of acetic acid bacteria excellent in acid production ability (A9, A21-3, A26, In the presence of A28-2, A36, A37) and 7-8% alcohol, 6 strains of acetic acid (A6, A11-2, A21-1, A24, A28-1, A33) with excellent acetic acid production were discovered, and 7 strains of B type 5 strains of acetic acid bacteria (B3, B5, B7, B11, B24) with excellent acid-producing ability even at an alcohol concentration of 9% and 1 strain (B6) with excellent acetic acid-producing ability in the presence of 8% alcohol were discovered. In addition, 2 strains of acetic acid bacteria (C1, C9) having excellent acid-producing ability at 7-9% alcohol in 7 strains of C type were discovered.

<Example 4> Selection of acetic acid bacteria with excellent fragrance-producing ability

In order to manufacture fruit vinegar with excellent aroma and flavor, it is necessary to use acetic acid bacteria with excellent fragrance-generating ability to produce fruity aroma. Therefore, in order to find out the scent generated by the 88 strains of acetic acid bacteria in Tables 4 and 5, a sniffing test through the smell of the researcher was performed.

Specifically, after inoculation of acetic acid bacteria isolated on solid medium (ASM) with a linear smear, cultured at 30° C. for 4 days, based on the flavor generated in the medium, the generation of fruity, floral, and dandelion was determined. Excellent acetic acid bacteria were selected.

As a result, as shown in Table 8 below, acetic acid bacteria that do not produce fragrance and acetic acid bacteria that produce fragrance were distinguished. The acetic acid bacteria that produce the fragrance showed the fragrance of sweet, fruity, floral, floral, and yoghurt. Among the acetic acid bacteria excellent in alcohol resistance and acid production capacity selected in Example 3, 11 strains of acetic acid bacteria with aroma production ability (A6, A11-2, A21-1, A21-3, A24, A26, A28-1, A37, B3, B7, C9) were selected.

<Example 5> Characterization and taxonomic identification of selected acetic acid bacteria

<5-1> Morphological characteristics analysis of selected acetic acid bacteria

In order to observe the morphological characteristics of the acetic acid bacteria of 11 weeks selected in Example 4, each isolated acetic acid bacteria was Gram-stained, and then examined through a phase-contrast microscope (DE/EM 109, Carl Zeiss, Germany, X800).

Gram staining is performed by incubating the test strains in a solid medium at 30°C for 2 days, then fixing 1 platinum lice on a slide glass, and then adding a few drops of crystal violet to dye for 1 minute - Washing with iodine solution for 1 minute - Mording with iodine solution - Washing-alcohol for 30 seconds dehydration-safranin for 1 minute staining-washing proceeded in the order, and the morphological characteristics were observed with a phase-contrast microscope.

As a result, as shown in FIG. 5 , all of the observed acetic acid bacteria were Gram-negative bacteria, and it was confirmed as a single type of bacilli without mobility.

<5-2> Analysis of biochemical characteristics of selected acetic acid bacteria

The biochemical characteristics of the acetic acid bacteria selected in Example 4 were analyzed using API 20NE Kit (BioMerieux, France).

Specifically, 100 μl of the acetic acid bacteria selected in Example 4 were inoculated into API 20NE Kit (BioMerieux, France) and reacted at 30° C. for 24 hours, followed by a biochemical test. For the biochemical test, each test acetic acid bacteria was suspended in physiological saline, inoculated into a cupule of a kit containing a dried substrate, and cultured, and then a color reagent was added to determine whether or not the substance was metabolized by color change.

As a result, all test strains showed a positive reaction for indole production, Glu. saccharivorans showed a negative reaction, and most of the isolated acetic acid bacteria matched the test results with A. pasteurianus used as a control. Some acetic acid strains (A6, A11-②, A37) showed a positive reaction in gelatin hydrolysis and showed a part consistent with the control A. malorum , but it was difficult to determine as A. malorum due to inconsistency in the nitrate reduction and glucose fermentation tests. Therefore, for more accurate identification, homology was compared through 16S rRNA sequencing in Examples 5-4 below.

<Biochemical properties of type strains using API Kit> characteristic A. pasteurianus A. malorum Glu. saccharivorans Catalase + + + Nitrate reduction - + - Indole production - - + glucose fermentation - + - Arginine dihydrolase - - - Urease - - - Escullin hydrolysis + + + Gelatin hydrolysis - + - β-glucosidase - - -

<Analysis of biochemical properties of isolated acetic acid bacteria> characteristic A6 A11-② B7 A21-① A21-③ A24 A26 A28-① C9 A37 B3 Catalase + + + + + + + + + + + Nitrate reduction - - - - - - - - - - - Indole production - - - - - - - - - - - glucose fermentation - - - - - - - - - - - Arginine dihydrolase - - - - - - - - - - - Urease - - - - - - - - - - - Escullin hydrolysis + + + + + + + + + + + Gelatin hydrolysis + + - - - - - - - + - β-glucosidase + - - - - - - - - - -

<5-3> Analysis of carbon source utilization characteristics of selected acetic acid bacteria

In order to investigate whether the 11 strains of acetic acid bacteria selected in Example 4 use various types of carbon sources, instead of glucose, various carbon sources (sucrose, lactose, mannose, rhamnose, galactose, fructose, maltose, glycerol, melibiose, xylose, inositol, mannitol, sorbitol, arabinose, lactate) were added and cultured with shaking at 30°C for 7 days at 110 rpm, and then the absorbance was measured at 660 nm to investigate the growth characteristics. (Table 10).

<Use of carbon source of isolated acetic acid bacteria> Carbon Source AE (3a/3e) broth-glucose down replacement A6 A11-② B7 A21-① A21-③ A24 A26 A28-① C9 A37 B3 sucrose + ++ +++ ++ - + + ++ - + - lactose + - + ++ - + ++ + - + + Mannose ++ ++ ++ + - - - +++ +++ + ++ rhamnose + + + ++ + - + ++ + + + galactose - + ++ +++ + + ++ ++ + - + fructose - ++ + ++ - + ++ + + + ++ maltose - - + ++ ++ - ++ + + + + glycerol + ++ + - - - - +++ +++ ++ + Melibios - - - - - - - + - - - xylose + +++ ++ + + + + +++ + + - inositol + ++ - + - - - ++ + - - mannitol + ++ +++ +++ + - - ++ + + ++ sorbitol + ++ ++ +++ ++ + +++ +++ + + ++ arabinose + + + +++ + + - ++ - + + lactate - - - +++ - - - - - - -

As a result, A11-2, A21-1, and A28-1 were excellent in using other carbon sources instead of glucose, and some acetic acid bacteria also had differences in their utilization depending on the type of carbon source. However, most of the acetic acid bacteria did not use melibiose. B7 has an excellent ability to use other carbon sources instead of glucose, and although some acetic acid bacteria have different uses depending on the type of carbon source, the availability of lactose, fructose, xylose, inositol and lactate is low.

<5-4> Analysis of molecular biological characteristics of selected acetic acid bacteria

16S rDNA nucleotide sequence was analyzed to prepare a phylogenetic tree of the selected acetic acid bacteria.

Specifically, the cultured cells of acetic acid bacteria selected in Example 4 were placed in an e-tube, and DNA was extracted using a gDNA prep kit (Genomic cell/tissue spin mini kit (Genotech)). 22.5 μl of the PCR master mix of Table 12 below was dispensed in a 200 μl tube or 96-well plate exclusively for PCR using a primer having the sequence of Table 11 for the extracted DNA, and gDNA extracted from the cells (20 ng/μl) was added by 2.5 μl, and PCR was performed under the conditions shown in Table 13 below.

name order size SEQ ID NO: 9F GAGTTTGATCCTGGCTCAG 19 SEQ ID NO: 1 1512R ACGGCTACCTTGTTACGACTT 21 SEQ ID NO: 2

division Stock solution concentration Final concentration (tube) 1 tube portion buffer solution 10× 1× 2.5 μl MgCl ₂ 25 mM 1.5 mM 1.5 μl dNTPs 10 mM (2.5 mM each) 1 mM (0.25 mM each) 2.5 μl pfu polymerase 5 U/ml 1.25 U 0.25 μl forward primer 10 μM 0.5 μM 1.25 μl Reverse primer 10 μM 0.5 μM 1.25 μl sterile distilled water 13.25 μl Template DNA 20 ng/μl 50 ng 2.5 μl total amount 25 μl

Temperature reaction time number of cycles 95℃ pre denaturation 5 minutes 95℃ denaturation 45 seconds 30 cycles 55℃ annealing 45 seconds 72℃ extension 60 seconds 72℃ last extension 10 minutes

After mixing 2 μl of the loading buffer into 2 μl of the PCR product, it was injected into the wells of a 1 to 2% agarose gel and electrophoresed at 200 V voltage (5 to 20 V/cm) for 10 minutes. The PCR product confirmed by electrophoresis was purified by PCR production purification kit (Nucleogene). The purified PCR product was subjected to PCR under the conditions shown in Table 15 using the primers having the sequence shown in Table 14 below, and the fluorescent material not participating in the reaction was washed with ethanol and then in distilled water or HDF (Hi-Ki Formamide). The nucleotide sequence was deciphered by the cycle sequencing method using the ABI BigDye terminatorcycle sequencing ready reaction kit V3.1 (ABI).

name order size SEQ ID NO: ITS1 TCCGTAGGTGAACCTGCGG 19 SEQ ID NO: 3 ITS4 TCCTCCGCTTATTGATATGC 20 SEQ ID NO: 4

Temperature reaction time number of cycles 96℃ pre denaturation 2 minutes 96℃ denaturation 10 seconds 30 cycles 50℃ annealing 10 seconds 60℃ extension 3 minutes

The homology test of the determined nucleotide sequence was performed through BLAST provided by the National Center for Biotechnology Information (NCBI; www.ncbi.nlm.nih/gov/), and 16S rDNA nucleotide sequence of standard strains and related taxa. was compared with the Genebank ribosomal DNA sequence.

To create a phylogenetic tree of the selected acetic acid bacteria, for homology between nucleotide sequences, multiple sequence alignment was performed between nucleotide sequences using the Clustal W program. To create a phylogenetic tree, the neighbor-joining method using the MEGA 4 program and Kimura -nei model was used. For the stability test of the phylogenetic tree, bootstrap resampling was performed 1,000 times (FIG. 6).

As a result, as a result of analyzing the 16S rDNA nucleotide sequence, most of the isolated strains were found to belong to A. pasteurianus because the nucleotide sequence was 99.5% identical to that of Acetobacter pasteurianus DSM 3509 (Table 16).

< Example 6> Preparation of seedlings using selected acetic acid bacteria and evaluation of acid-producing ability of the prepared seedlings

<6-1> Seed production using selected acetic acid bacteria

Among the acetic acid bacteria selected in Example 4, three types of acetic acid bacteria A26, A37 and B7, which are excellent in alcohol resistance, acid production ability, and fragrance production ability, were selected to prepare a seed, and the optimum medium, temperature, alcohol concentration, Optimal conditions for the fermentation period were established.

Specifically, acetic acid bacteria liquid medium (yeast extract 0.5%, glucose 0.5%, glycerin 1.0%, MgSO _4· 7H ₂ O 0.02%, acetic acid 1.0%), acetobacter medium (yeast extract 0.5%, glucose 2.0%, peptone 0.5) %, Na ₂ HPO ₄ 0.27%, acetic acid 1.0%) and GYC broth (yeast extract 0.5%, glucose 3.0%, acetic acid 1.0%) were added with ethanol having an alcohol concentration of 6, 7, and 8%, respectively, to prepare a medium. After that, the selected three types of acetic acid bacteria (A26, A37, B7) were inoculated, respectively, and the acidity was measured at 3-day intervals while culturing for 14 days at each culture temperature (20°C and 30°C) (Tables 17 to 19) .

As a result, as shown in Tables 17 to 19, in all three types of acetic acid bacteria at 30°C rather than 20°C, the higher the ethanol concentration, the better the acid-producing ability. A26 acetic acid bacteria in GYC broth, A37 and B7 acetic acid bacteria in acetic acid bacteria liquid medium were selected as the optimal medium because of their excellent acid-producing ability. In addition, the optimum ethanol concentration was established as 8%, and the optimum temperature was established as 30°C.

<6-2> Qualitative and quantitative evaluation of acid-producing ability of the prepared seed seed

Seedlings were prepared at the optimal medium and optimal alcohol concentration established in Example 6-2, 20°C and 30°C, and qualitative and quantitative evaluation of the acid-producing ability of the prepared seedlings was performed.

Specifically, three types of acetic acid bacteria (A26, A37 and B7) were added to GYC broth for A26 acetic acid bacteria, A37 and B7 acetic acid bacteria to acetic acid bacteria liquid medium, and ethanol having an alcohol concentration of 8% was added to prepare a medium. Seedlings were prepared by the method of 6-1. Thereafter, the acid-forming ability was qualitatively evaluated by the method of Example 2-2. After 1 platinum seed was inoculated on a solid medium, it was cultured at 30° C. for 120 hours to measure the size of the transparent ring. As a control group, Acetobacter malorum was used. In addition, in order to quantitatively evaluate the acid-producing ability of the seedlings prepared with three kinds of acetic acid bacteria, the acidity was quantitatively evaluated by the method and conditions described in Example 2-3.

As a result, as shown in FIG. 7 , it was confirmed that the acid-producing ability was higher than that of the control group in all test groups, and that the acid-producing ability was higher at 30°C than at 20°C. In addition, as shown in FIGS. 8A and 8B , it was confirmed that the acid-producing ability was higher at 30°C than 20°C, and the acid-producing ability was excellent in the order of B7>A26>A37 acetic acid bacteria.

<Example 7> Cujippong juice preparation for fermented vinegar preparation Cujippong

After washing and draining 15 kg of cujippong fruit in running water, it was homogeneously crushed and hydrolyzed (D.W. 27 L) to 180% (V/V) in the total raw material (Kujippong juice 15 L). In order to prepare 13% fruit wine with kkujippong juice (42 L, 3.1°Brix), 8.7 kg of white sugar was added to make 24°Brix.

<Example 8> Pre-treatment of Cujippong juice for the production of Cujippong fermented vinegar

<8-1> Browning suppression treatment of Cujippong juice

The following experiment was performed in order to select a browning inhibitor with the best browning inhibitory effect by treating various types of browning inhibitors in the kkujippong juice prepared in Example 7.

Specifically, in order to compare and analyze the browning inhibitory effect using four types of browning inhibitors, polyvinylpolypyrolidone (PVPP), ascorbic acid, bentonite and sodium sulfite, a control group not treated with a browning inhibitor at different treatment concentrations (0%) ) including 0.05, 0.1, 0.15, and 0.2% (w/v) were added to each sample. 100 ml each was dispensed into an Erlenmeyer flask. The browning inhibitor was dispensed by concentration (0, 0.05, 0.1, 0.15, 0.2% (w/v)), and then heat-treated at 80 °C for 1 hour. After filtration using a filter, the degree of browning was confirmed by measuring absorbance at a wavelength of 420 nm. Three types of commercially available cujippong juice (100%) used as a control are indicated by A, B, and C, and the cujibbong juice used in this study is indicated by S.

As a result, as shown in FIGS. 9a to 9d, the kkujippong juice (S) had the highest browning inhibition rate by about 3 times (0.130) than the control group (Control, 0.373) when treated with 0.2% ascorbic acid. could Browning degree according to browning inhibitor treatment Ascorbic Acid (0.130) > PVPP 0.2% (0.153) > bentonite (trace). Therefore, treatment with ascorbic acid 0.2% was selected as the optimal condition.

<8-2> Clarifying enzyme treatment of Cujippong juice

In order to set the clarification conditions following browning inhibition as a pretreatment condition of kkujippong, cellulase, pectinase, and cellulase and pectinase were mixed in a 1:1 ratio to confirm the clarification effect accordingly.

Specifically, 100, 200, and 300 ppm (titer: 12,000 U/g) including 0 ppm as a control group for a group of cellulase, pectinase, and a 1:1 mixture of cellulase and pectinase (titer: 12,000 U/g), respectively was added to the sample of Cellulase, pectinase, and a mixed enzyme cellulase: peck in kkujippong juice treated with ascorbic acid 0.2% (w/v), which is the optimal condition for browning inhibition set in Example 8-1, and heat-treated at 80° C. for 1 hour Tinase = 1:1 was dispensed by concentration (0, 100, 200, 300 ppm) and heat-treated at 60 °C for 1 hour. Then, in order to measure the turbidity, the absorbance was measured at 660 nm after filtration through a 0.45 μm membrane filter.

As a result, as shown in FIGS. 10a to 10c, in the test group treated with the complex enzyme (cellulase: pectinase = 1:1), controls A, B, C and kkujippong juice (S, developed in this study) The turbidity of cucurbita vinegar) was measured to be less than 0.05, indicating the greatest effect of clarification. In the case of cucurbita juice (S), cellulase: pectinase = 1:1 300 ppm in the treatment area Lowest turbidity (0.038) Measured, the effect of clarification is relatively high appeared to be confirmed. Thus, cellulase: pectinase = 300 ppm in a ratio of 1:1 The treatment conditions were set as the optimal conditions for clarification of kkujippong juice.

<Example 9> Cujippong fermented liquor production for the production of Cujippong fermented vinegar

<9-1> Cujippong Fermented Wine Manufacturing

The Kujippong juice pretreated under the optimal conditions of Example 8 (ascorbic acid 0.2%, cellulase: pectinase = 1:1 300 ppm) was cooled to 30 ° C., filtered, and each 250 ml was dispensed into an Erlenmeyer flask. . Then, 0.3% (v/v) of main rice prepared with commercially available yeast (Songcheon yeast) was inoculated, and the fermentation period (0, 3, 6, 9, 12 days) was performed while stationary fermentation was performed at each temperature (18℃, 25℃, 30℃). ), and then measured the pH, sugar content, acidity, organic acid content, and free amino acid content of the custard fermented wine as follows to explore the optimal conditions for the production of the cujippong fermented wine.

<9-2> Analysis of pH and acidity of the prepared Cujippong fermented wine

The pH and acidity of the fermented kkujippong prepared in Example 9-1 were analyzed as follows.

Specifically, the pH was measured using a pH meter (Orion 420A, USA) of the collected kkujippong fermented liquor sample 10 ㎖, and the sugar content was measured using a saccharide meter (B626544, Atago, Japan) of 0.5 ㎖ sample. For acidity measurement, 2 to 3 drops of 1 ml of phenolphthalein solution were added to the sample, and the appropriate consumption of 0.1N NaOH solution was calculated using the following equation.

Acidity (%) =V×F×A×D×1/S×100

V: Appropriate consumption of 0.1N-NaOH solution (ml)

F: titer of 0.1N-NaOH solution

A: Amount of organic acid equivalent to 1 ml of 0.1N-NaOH solution (acetic acid = 0.006)

D: dilution factor

S: Sample collection amount (ml)

As a result, as shown in FIGS. 11a to 11c , the initial acidity was 4.4, and as the fermentation progressed, it rapidly decreased on the 3rd day, showing a similar level of 3.88 to 3.92 depending on the fermentation temperature. As the fermentation period elapsed, the difference was insignificant. On the 12th day of fermentation, the fermentation was completed at 3.91 at 18°C and 25°C, and 3.99 at 30°C. The acidity of the Cujippong fermented wine increased rapidly on the 3rd day of fermentation from 0.14% of the initial acidity, and was measured to be 0.42% at 18℃ and 30℃ and 0.48% at 25℃. As the fermentation period elapsed, the acidity gradually decreased and decreased to 0.36 at 25℃ and 30℃. Fermentation was completed at %. However, when the fermentation was 18°C, the acidity was 0.54% at the end of the fermentation, which was relatively higher than that of 25°C and 30°C.

<9-3> Analysis of sugar content and alcohol concentration of the prepared Cujippong fermented wine

The sugar content and alcohol concentration of the fermented kkujippong prepared in Example 9-1 were analyzed as follows.

Specifically, for the alcohol content of kkujippong fermented wine, 80 ml of a distilled solution of 100 ml of the collected sample was purified by 100 ml of distilled water, and then the alcohol content was measured using a density meter (AT/DMA500M, Anton paar, USA). Sugar content was measured for 0.5 ml of the sample using a saccharometer (B626544, Atago, Japan).

As a result, as shown in FIGS. 12A to 12C , it was confirmed that the sugar content and the alcohol were in inverse proportion to the alcohol consumption while the sugar was consumed. The initial sugar content of Kujippong fermented wine was 24.2°Brix, and when fermented for 12 days at 18°C, the sugar content was 15.1°Brix and alcohol was analyzed to be 8.86%. In particular, it was found that the fermentation is progressing slowly because the fermentation temperature is low in the case of low alcohol content.

At 25℃, the alcohol concentration on the 9th day of fermentation was 12.38%, and when the fermentation on the 12th day was finished, 13.07% and sugar content were analyzed as 10.4°Brix. At 30℃, which was fermented at a higher temperature than these groups, the alcohol concentration was 13.02% on the 9th day of fermentation and 13.34% at the end of the fermentation, resulting in high alcohol production ability and 9.6°Brix sugar content. The above results suggest that the higher the fermentation temperature, the higher the alcohol production capacity.

<9-4> Browning degree and turbidity analysis of the prepared Cujippong fermented wine

The browning degree and turbidity of the kkujippong fermented wine prepared in Example 9-1 were analyzed as follows.

Specifically, the samples collected according to the fermentation period (0 days, 3 days, 6 days, 9 days, 12 days) were filtered with a membrane filter having a 0.45 μm pore, and the browning degree was 420 nm and the turbidity was 660 nm. Absorbance was measured using an analyzer (AT/Twlster, Tecan, Austria).

As a result, as shown in FIGS. 13a to 13c, browning degree according to fermentation temperature was 0.126 to 0.128, and turbidity was 0.038 to 0.04, so browning and turbidity were hardly observed during alcoholic fermentation at 18°C and 25°C. didn't seem to As shown in the results of Example 9-3 and Examples 9-5 and 9-6, the alcohol on the 9th day of fermentation at 30° C. showed the best fermentation power of 13.0% or more, and the content of organic acids and free amino acids was high, but fruit wine Due to the characteristics of alcoholic fermentation, fermentation at high temperature causes spoilage and off-flavor, making it impossible to obtain good quality kkujippong fruit wine. Therefore, browning degree and turbidity are 0.126 and 0.04, respectively, and there is relatively no change depending on the fermentation period. From the 12th day of fermentation, alcohol is produced more than 13.0%, and the conditions of fermentation at 25℃ with relatively high content of organic acids and free amino acids for 12 days. It was confirmed as the optimal condition for producing fermented wine.

<9-5> Analysis of organic acid of the prepared Cujippong fermented wine

The organic acid of the fermented kkujippong prepared in Example 9-1 was analyzed as follows.

Specifically, 10 ml of a sample was taken and filtered through a membrane filter having 0.2 μm pores, and organic acids were analyzed. HPLC (LC-20A Prominence, Shimadzu Co., Tokyo, Japan) was used as the analysis equipment, and the column was C18 ( 250×4.6 mm id, S-5 μm, 12 nm; YMC, Kyoto, Japan) was used. As a solvent, 0.1% phosphoric acid was added to the fermentation broth and 0.1% formic acid was added to vinegar, and the flow rate was 0.6 ml/min and the injection volume was 20 μl.

As a result, as shown in Table 20 below, the organic acid content of the fermented kkujippong alcohol at different fermentation temperatures showed a tendency to decrease overall as the fermentation progressed, 1,180.98 mg/100 ml at the beginning of the fermentation, and 288.89 mg at the end of the fermentation at 18 ° C. 294.40 mg/100 ml at 100 ml, 25°C and 441.34 mg/100 ml at 30°C. It was confirmed that the higher the fermentation temperature, the higher the organic acid content was maintained. Under all fermentation temperature conditions, the total organic acid content decreased sharply on the 3rd day of fermentation, 238.54 mg/100 ml at 18°C, 283.33 mg/100 ml at 25°C, and 269.78 mg/100 ml at 30°C, indicating the end of fermentation (12 1) showed a slight increase or decrease. These results, compared with the results of the analysis of pH and acidity according to the fermentation period and temperature confirmed in Example 9-2, rapidly decreased from 4.4 at the beginning of fermentation (day 0) to 3.88 to 3.92 for each fermentation temperature, indicating the end of fermentation. The results showed a similar trend to the results showing insignificant differences. At the end of the fermentation, on the 12th day, the acetic acid content was 11.95 mg/100 ml under the fermentation temperature of 18 °C, and the lactic acid content was the highest at 158.77 mg/100 ml and 298.95 mg/100 ml at 25 °C and 30 °C, respectively. Other succinic acid was not detected at the initial stage of fermentation, but showed a tendency to increase as the fermentation progressed.

<9-6> Analysis of free amino acids of the prepared Cujippong fermented wine

The free amino acids of the fermented kkujippong prepared in Example 9-1 were analyzed as follows.

Specifically, 5 ml of the sample was filtered through a membrane filter with 0.45 μm pores and used for analysis. The amino acid analyzer was Sykam's S7130 amino acid reagent organizer, S5200 sample injector and S2100 solvent delivery system, and the column was a cation separation column LCA K06. /NA (250 mm x 4.6 mm) was analyzed under the conditions of a flow rate of 0.45 ml/min for mobile phase and 0.4 ml/min for ninhydrin.

As a result, as shown in Table 21 below, the total free amino acid content was shown in the order of fermentation temperature 30°C (0.521 mg/ml) > 25°C (0.326 mg/ml) > 20°C (0.151 mg/ml). It was confirmed that the higher the content, the higher the content. In particular, the content of glutamic acid and lysine, which is umami, alanine, which is sweet, leucine, γ-aminobutyric acid (GABA), etc., which are bitter taste, increased or showed a tendency to be newly detected under high temperature fermentation conditions. The main amino acids common to each fermentation temperature are non-essential amino acids, b -aminobutyric acid, which is a final product produced in the catabolism of thymine, phosphoserine, which promotes calcium solubilization and absorption as an intermediate in serine biosynthesis, and proline, which gives a sweet taste. At 25℃, glutamic acid and lysine were umami, glutamic acid and lysine were umami at 30℃, proline was sweet, alanine and γ-aminobutyric acid (GABA), and arginine was bitter. As a result, it was confirmed that the higher the fermentation temperature, the higher the organic acid content and the various kinds of free amino acids during the production of kkujippong fermented liquor.

<Example 10> Cujippong fermented vinegar production

<10-1> Seed production

Seedling for the production of Cujippong fermented vinegar was prepared using the three types of acetic acid bacteria selected in Example 6.

Specifically, three types of acetic acid bacteria selected using the optimal conditions for seed production established in Example 6-1 were statically cultured at 30° C. in an acetic acid bacteria liquid medium, prepared at an alcohol concentration of 8%, and the 9- A seed seed was prepared by inoculating 10% (v/v) acetic acid bacteria culture solution into the Cujippong fermented liquor prepared in 1, and culturing at 30° C. for 12 days.

<10-2> Cujippong Fermented Vinegar Manufacturing

After crude filtration of the Cujippong fermented liquor prepared based on the optimal cujippong alcohol fermentation conditions established in Example 9-4 and preparation with an alcohol concentration of 8%, the initial acidity was adjusted to pH 2, 3, 4 was adjusted. After that, 10% (v/v) of the seedling prepared in Example 10-1 was inoculated, and the fermentation period (0, 6, 12, 18, 24) was performed while stationary fermentation was carried out at each fermentation temperature (20 ℃, 30 ℃, 35 ℃). , 30 days) to collect fermented malt and analyzed characteristics and functional ingredients as follows.

<10-3> Analysis of pH, acidity and chromaticity of the prepared Cujippong fermented vinegar

The pH, acidity and chromaticity of kkujippong fermented vinegar prepared in Example 10-2 were analyzed as follows.

Specifically, the pH was measured by using a pH meter (Orion 420A, USA) of 10 ml of the collected sample, and for acidity, 1 ml of the sample was collected, diluted 10-fold with 9 ml of distilled water, and 2 to 1% phenolphthalein solution After adding 3 drops, the appropriate consumption amount of 0.1N NaOH solution was calculated. Chromaticity was expressed as L (brightness), a (red value), and b (yellow value) values by using a colorimeter (UltraScan Pro, HunterLab, USA) by collecting 20 ml of a sample for each fermentation condition.

As a result, as shown in FIGS. 14A to 14C , acetic acid bacteria A26 were 1.90 at pH 2, 3.13 at pH 3, and 3.71 at pH 4 on day 0, A37 was 1.88, 2.81, 3.53, B7 was 1.77, 3.11, 3.72 appeared as It was observed that the pH does not decrease even if the A26 is maintained at a constant level or the fermentation proceeds at an initial acidity of pH 4, although the pH tends to decrease gradually due to acetic acid production as fermentation proceeds. Acetic acid bacteria A37 showed the lowest pH of 2.45 on the 30th day at the end of fermentation at an initial acidity pH of 4 and fermentation 20°C, and the largest difference was confirmed. Acetic acid B7 In addition, the final pH was measured to be 2.43 at pH 4 and 20°C, which was similar to that of A37. In conclusion, the acid-producing ability of A37 acetic acid bacteria was At pH 4, at the end of fermentation at 20°C, it showed 6.24% and B7 acetic acid bacteria In addition, at the end of fermentation (30 days) under the same fermentation conditions, it showed an acid production capacity of 6.12%. That is, acetic acid bacteria A26 confirmed that acid production was insignificant in all test conditions, and A37 and B7 acid bacteria showed high acid production ability during fermentation at initial acidity (pH 3 and pH 4) and fermentation temperature (20°C and 30°C) conditions. It was. This is contrary to the result showing that the acid-producing ability of A26 acetic acid bacteria was excellent when the acid-producing ability was measured during the preparation of seedlings in Example 6, and A26 was not suitable for producing kkujippong fermented vinegar, but A37 acetic acid bacteria, which had a relatively low acid-producing ability, was It shows a high acid-producing ability when manufacturing Cujippong fermented vinegar, suggesting that it is an acetic acid bacteria suitable for manufacturing Cujippong fermented vinegar.

As a result of examining the color change according to the fermentation period and temperature of the fermented Cujipon acetic acid, as shown in Tables 22 to 24, as the fermentation progresses, the overall L (brightness) value decreases and the b (yellow) value increases, resulting in browning. As the degree increased and the fermentation temperature decreased, the a (red) and b (yellow) values were measured to be relatively low, confirming that the degree of browning increased.

In other words, the optimal conditions for producing Cujippong fermented vinegar using A37 and B7 acetic acid bacteria under the conditions of 20 ℃, pH 4 with suppressed browning degree and excellent acid production ability were identified.

< Experimental Example 1> Analysis of functional ingredients of Cujippong fermented vinegar

<1-1> Analysis of total phenolic compound content of Cujippong fermented vinegar

Phenolic compounds, which are abundantly contained in plants, form a variety of structures as one of the secondary metabolites, and because of the phenolic hydroxyl (OH) group, they easily combine with proteins and other macromolecules and exhibit various physiological activities such as antioxidant and anticancer. have Therefore, in order to investigate the functional components of kkujippong vinegar for each fermentation condition, total phenolic compounds were analyzed as follows.

Specifically, for the analysis of total phenolic compound content, 1.8 ml of distilled water was added to 0.2 ml of a uniformly diluted sample for colorimetric quantification by Folin-Denis method, and 0.2 ml of 2N Folin-ciocalteu phenol reagent (Sigma-Aldrich, USA) was added. After mixing and reacting for 6 minutes, _{2 ml of 7% Na 2} Co ₃ was added and reacted in the dark for 2 hours. The absorbance of the reactant was measured at 750 nm, and the amount was converted to a standard curve using gallic acid (Sigma-aldrich, USA) and expressed as mg (GAE)/100 ml.

As a result, as shown in FIGS. 15A to 15C , it was confirmed that the total phenolic compound content decreased as the fermentation progressed, and decreased significantly as the fermentation temperature increased. However, under conditions of excellent fermentability, initial acidity pH 4 and fermentation temperature of 20° C., acetic acid bacteria A37 increased to 4.65 mg/100 ml and B7 increased to 5.90 mg/100 ml. The above results suggest that the higher the acid production ability, the higher the total phenolic compound content.

<1-2> Analysis of total flavonoid content of Cujippong fermented vinegar

Flavonoids derived from flavus meaning yellow refer to plant pigments having flavones as a basic structure. It is contained in a large amount in plants and has antioxidant activity in vivo, and has antibacterial, anticancer and anti-inflammatory activities. In order to investigate these physiologically active ingredients, the total flavonoid content of Kujippong acetic acid fermented product was analyzed as follows.

Specifically, using the Davis method, after reacting by adding 4 ml of 90% diethylene glycol to 0.4 ml of a sample, 40 μl of 1 N NaOH was added to react at 37° C. for 1 hour, and then absorbance at 420 nm was measured and the amount was converted to a standard curve using Catechin (Sigma-aldrich, USA) and expressed as mg (CE)/100 ml.

As a result, as shown in FIGS. 16a to 16c , as a result of analyzing the total flavonoid content, which is a functional component of kkujippong vinegar, in the case of acetic acid bacteria A26 that does not produce acid, it did not show a significant change in all test conditions. However, in the case of A37, when fermentation is completed under conditions of initial acidity pH 4 and fermentation temperature 35℃ The total flavonoid content was the highest at 2.74 mg/100 ml. Acetic acid bacteria B7 showed a relatively high increase from the 6th day of fermentation when the initial acidity was pH 3 and pH 4 at 30 and 35 °C, and on the 12th day at pH 3 and 35 °C, 3.25 mg/100 ml, pH 4, 35 °C conditions. On day 18, the total flavonoid content was relatively high at 3.70 mg/100 ml.

<Experimental Example 2> Antioxidative activity analysis of Cujippong fermented vinegar

<2-1> Measurement of DPPH free radical scavenging ability

DPPH, which is widely used to measure the content of antioxidants from natural materials, is a relatively stable free radical, and its radical scavenging ability through it has a role in preventing diseases and aging of the human body, so it is attracting attention as a functional food object. Therefore, the DPPH radical scavenging ability of kkujippong vinegar by manufacturing conditions was measured as follows.

Specifically, the DPPH radical scavenging ability was measured by applying the Blois method as an assay using the reducing power of the reducing substance analysis reagent DPPH (1,1-diphenyl-2-picrylhydrazyl). To 1 ml of the sample, 2 ml of 0.2 mM DPPH ethanol was added and shaken, followed by reaction at room temperature for 30 minutes. The absorbance of the reactant was measured at 517 nm, and as a positive control, 0.1% ascorbic acid (Daejung, Korea) was used to calculate the radical scavenging ability as a percentage (%) by the following formula.

DPPH radical scavenging activity (%) = (1 - Sample O.D. / Control O.D.) × 100

As a result, as shown in FIGS. 17a to 17c, acetic acid bacteria A26 and B7 did not show a significant difference as fermentation progressed, but A37 had excellent acid production, initial acidity pH 3, 4, and fermentation temperature of 20 ℃ Conditions except for conditions DPPH scavenging ability was measured to be very low. At the end of fermentation at 20°C conditions of pH 3 and 4, the DPPH radical scavenging ability was relatively high at 82.42% and 74.83%, respectively.

<2-2> Measurement of ABTS cation radical scavenging ability

ABTS cation scavenging ability is known to be able to measure antioxidant activity more sensitively because it responds to both hydrogen-donating antioxidants and chain-cleaving antioxidants that can be measured using DPPH. Therefore, ABTS radical scavenging ability was measured.

Specifically, 734 mM ABTS (2,2' (3-ethylbenzthia-zoline-6-sulfonic acid)) was mixed with 2.45 mM potassium persulfate and reacted in a dark place at 23 ° C for 16 hours. After adjusting the concentration by diluting with ethanol so that the absorbance becomes 0.700 ± 0.005 at a wavelength of nm, 0.1 ml of the sample and 3.9 ml of the mixed reagent were reacted at 23° C. for 6 minutes to measure the absorbance at 734 nm. As a positive control, 0.1% Using ascorbic acid (Daejung, Korea), the radical scavenging ability was calculated and expressed as a percentage (%) by the following formula.

ABTS ⁺ radical scavenging activity (%) = (1 - Sample OD / Control OD) x 100

As a result, as shown in FIGS. 18a to 18c , kkujippong fermented vinegar fermented at an initial acidity pH of 2 by inoculating acetic acid bacteria A26, A37, and B7 did not show a significant difference depending on the fermentation period, but A37 had excellent acid production. At the initial acidity of pH 3 and 4 and fermentation temperature of 20°C, the radical scavenging activity tends to increase, and the ABTS ⁺ radical scavenging activity is relatively high at 49.05% and 48.38% at the end of fermentation, respectively. Acetacid acid bacteria B7 decreased as fermentation proceeded at pH 3 and 4, and was measured to be 24.29% at the end of fermentation at pH 4, showing the lowest when the fermentation temperature was 30°C. ^{However, it was confirmed that the ABTS +} radical scavenging ability was relatively high as it was 39.62% at the end of the fermentation at 20 °C condition of pH 4.

In conclusion, the chosangyun A37 and B7 maintains the total phenolic compounds in a relatively high content, producing ability is DPPH and ABTS ⁺ radical scavenging activity shown by the antioxidant activity measurement acid with high initial pH pH which is acid producing ability in a low fermentation temperature Good It was confirmed that the value was higher than the low fermentation condition.

<Experimental Example 3> Analysis of content of organic acids, free amino acids and volatile aroma components in Cujipon fermented vinegar

<3-1> Analysis of organic acid content of Cujippong fermented vinegar

The organic acids of the fermented kkujippong vinegar prepared in Example 10-2 were analyzed in the same manner and conditions as in Example 9-5 under the conditions of acetic acid bacteria A26, A37 and B7 at an initial acidity of pH 4 and a fermentation temperature of 20°C.

As a result, as shown in Table 25 below, it was confirmed that the organic acid content of the acetic acid fermented products of each acetic acid bacteria fermented at 20° C. by adjusting the initial acidity to pH 4 increased as the fermentation progressed. Cujippong vinegar prepared with acetic acid bacteria A37 and B7 increased the organic acid content by about 10 times from day 0, and at the end of fermentation (30 days), the organic acid content was increased to 3,866.86 mg/100 ml for A37 and 4,166.29 mg/100 ml for B7. (Table 25). In particular, during acetic acid fermentation using acetic acid bacteria A37 and B7, acetic acid was found to be the major organic acid of Cujippong vinegar as the content of acetic acid was 3,734.09 mg/100 ㎖ and 3,934.45 mg/100 ㎖, respectively, on the 30th day after the end of fermentation. The next detected lactic acid was considered to be produced by the propagation of lactic acid bacteria in the initial stage of alcoholic fermentation of sugars for vinegar production, followed by citric acid > succinic acid > malic acid. Acetic acid bacteria A26, which showed low fermenting power, had the highest citric acid concentration of 462.11 mg/100 ml. Organic acids including acetic acid not only form the acidity and taste of fruit vinegar, but also have functions such as activating the TCA cycle to promote lactic acid decomposition, so it is presumed that there will be differences in the physiological activity of vinegar due to the difference in organic acid composition.

<3-2> Analysis of Free Amino Acid Content of Cujippong Fermented Vinegar

The free amino acids of Kujippong fermented vinegar prepared in Example 10-2 were analyzed in the same manner and conditions as in Example 9-6 under the conditions of acetic acid bacteria A26, A37 and B7 at an initial acidity of pH 4 and a fermentation temperature of 20°C.

As a result, as shown in Table 26 below, the total free amino acid content was found in the order of acetic acid bacterium A26 (0.195 mg/ml) > B7 (0.132 mg/ml) > A37 (0.078 mg/ml), indicating that the strain with excellent acid-producing ability was relatively It showed a low content, and a tendency to decrease as the fermentation progressed could be confirmed. These results show that although amino acids mainly derived from raw materials are known to affect taste depending on the type, they show a similar tendency to the reported result that 38 to 60% decreased due to magnetization during acetic acid fermentation.

<3-3> Analysis of volatile aroma components of Cujippong fermented vinegar

Vinegar forms aroma and taste by complex interactions of acids, aldehydes, alcohols, ketones, and esters other than acetic acid while going through the raw materials, fermentation method, and aging process. Therefore, in order to investigate the scent of Cujippong vinegar prepared by each strain, the volatile scent components were analyzed as follows.

Specifically, 3 ml of the sample is placed in a headspace glass vial, 2-methyl-1-pentanol designated as an internal standard is injected, and the vial containing the sample is equilibrated at 35°C for 30 minutes, and then SPME fiber ( DVB/CAR/PDMS) to collect volatile aroma components, and desorbed in a GC/MS injector at 200° C. for 5 minutes to analyze volatile aroma components. GC/MS used for analysis was GC-2010 Plus, GCMS-TQ 8030 (Shimadzu, Tokyo, Japan), and DB-WAX (30 mm×0.25 mm id, 0.25 μm film thickness, J&W, USA) was used for the column. was used. After staying at 40 °C for 3 minutes, the temperature was raised to 90 °C at a rate of 5 °C/min, raised to 230 °C at a rate of 19 °C/min, and then maintained for 5 minutes. The injector temperature was set at 250 °C, the carrier gas was helium, and the flow rate was 1.0 ml/min (Table 27).

item Condition GC device GC-2010 Plus, GCMS-TQ 8030 (Shimadzu, Japan) column DB-WAX (30 mm×0.25 mm id, 0.25 μm film thickness, J&W, USA) Analysis method 40℃(3min)→90℃(5℃/min) →230℃(19℃/min)→230℃(5min) carrier gas Helium (1 μl/min) injection volume 1 μl MS injection temperature 250℃ Ion source temperature 230℃ interface temperature 280℃ detection voltage 0.1 kV event time 0.03 ch, 15 eV

As a result, as shown in Tables 28 to 30, 12 volatile components were detected in acetic acid bacterium A37, which had the highest acid production capacity of 6.24%, indicating the most diverse components among the three types of acetic acid bacteria. In addition, at the end of fermentation (30 days), A37 and B7, which have excellent acid-producing ability, showed the highest levels of acetic acid and ethyl ester, respectively, and were measured to be 59.18% and 37.53%, which is an acid taste with an irritating odor and is an oxidation product produced by acetic acid bacteria It was found to be the main volatile component of vinegar. In the case of A26, which has a low acid-forming ability, acetic acid and ethyl ester were measured to be relatively low at 20.77%, and ethanol was the highest at 24.1%. Common volatile components in Cujipon vinegar prepared with acetic acid bacteria A37 and B7 are acetic acid, ethyl ester, 3-methyl-1-butanol (isoamyl alcohol), 2-hydroxybenzoic acid (salicylic acid), ethanol, decanal (orange flavor + fat), and 2-ethylhexanol. In conclusion, the organic acid content of Cujipon vinegar prepared with acetic acid bacteria A37 and B7 increased about 10-fold from day 0, and at the end of fermentation (30 days), A37 was 3,866.86 mg/100 ml and B7 was 4,166.29 mg/100 ml. The total amino acid content was determined to be 0.078 mg/ml in A37 and 0.132 mg/ml in B7. In addition, as a result of analyzing the fragrance component, it was confirmed that A37 and B7, which have excellent acid production ability, exhibit relatively various volatile components.

Korea Agricultural Microorganism Conservation Center KACC92206P 20171023

<110> REPUBLIC OF KOREA (MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Acetobacter pasteurianus A37 and manufacturing method of fermented Kujippong vinegar using the same <130> 2019P-10-021 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 9F <400> 1 gagtttgatc ctggctcag 19 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 1512R <400> 2 acggctacct tgttacgact t 21 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ITS1 <400> 3 tccgtaggtg aacctgcgg 19 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ITS4 <400> 4 tcctccgctt attgatatgc 20

Claims (10)

Characterized in that it has excellent acid production ability, alcohol resistance and fragrance production ability Acetobacter pasteurianus A37 strain deposited with accession number KACC 92206P.
delete According to claim 1, wherein the strain is for producing kkujippong fermented vinegar, Acetobacter pasteurianus ( Acetobacter pasteurianus ) A37 strain.
1) preparing kkujippong juice;
2) pre-treating the kkujippong juice prepared in step 1);
3) preparing a fermented kkujippong juice by fermenting the kkujippong juice after the pretreatment of step 2) with alcohol;
4) Characterized in that the kkujippong fermented liquor of step 3) has excellent acid production ability, alcohol resistance and fragrance production ability Acetobacter pasteurianus deposited with accession number KACC 92206P ( Acetobacter pasteurianus ) Preparing a fermented vinegar kkujippong by inoculating the A37 strain; A method of producing kkujippong fermented vinegar comprising a.
5. The method of claim 4, wherein the pretreatment of step 2) is
1) inhibiting browning by adding 0.1 to 0.3% (w/v) of ascorbic acid; and
2) clarification by adding 200 to 400 ppm of cellulase and pectinase in a ratio of 1:1; A method of producing kkujippong fermented vinegar comprising a.
The method of claim 4, wherein the alcoholic fermentation of step 3) is fermented for 10 to 14 days at 20 to 27 ℃, the method for producing kkujippong fermented vinegar.
According to claim 4, wherein the fermented kkujippong vinegar of step 4) is Acetobacter pasteurianus deposited with accession number KACC 92206P ( Acetobacter pasteurianus ) It is prepared by inoculating the seed prepared using the A37 strain, Cujippong fermentation Vinegar manufacturing method.
According to claim 7, wherein the seed seed is Acetobacter pasteurianus ( Acetobacter pasteurianus ) A37 strain is inoculated into kkujippong fermented strain having an alcohol concentration of 7 to 9%, and is produced by culturing at 27 to 32 ° C. for 10 to 14 days. That is, a method of producing Cujippong fermented vinegar.
According to claim 4, wherein the step 4) is to inoculate the Acetobacter pasteurianus A37 strain in the fermented strain of kkujippong of initial pH 3 to 5 and ferment it statically at 18 to 23 ° C. for 20 to 35 days. , Manufacturing method of Cujippong fermented vinegar.
According to any one of claims 4 to 9, low-temperature fermentation kkujippong fermented vinegar prepared by the above method.

Images