KR101326567B1 - Method for producing shiitake vinegar and shiitake vinegar produced by the same method - Google Patents

Abstract

The present invention relates to Lentinus edode vinegar, and a production method of the Lentinus edode vinegar which comprises the following steps: extracting Lentinus edode by adding water, and concentrating the obtained extract to obtain concentrate; adding yeast to the concentrate, and alcohol-fermenting the mixture to obtain fermented liquid; and adding an acetobacter with excellent acetic acid production rate into the fermented liquid, and culturing the mixture while vibrating and acetic fermenting. [Reference numerals] (AA) Alcohol content (%);(BB) Fermentation period (day)

Description

Method for producing shiitake vinegar and shiitake vinegar produced by the above method {Method for producing shiitake vinegar and shiitake vinegar produced by the same method}

The present invention is a method of preparing shiitake mushroom vinegar to maximize the production of acetic acid by optimizing the alcohol fermentation period, acetic acid bacteria, acidity, ethanol concentration, organic nitrogen source concentration, yeast extract concentration, fermentation period, culture method, sterilization temperature and time It relates to shiitake mushroom vinegar prepared by the above method.

The shiitake is a mushroom belonging to the pineal fungus Basidiomycetes, 目 目 Agaricales, Plerotaceae. It is a woody fungus that parasitic to hardwoods, such as oak and beech in temperate regions, from spring to autumn, and grows or grows on stumps and stumps of hardwoods. It has long been widely used for food along with oysters, and is one of the most commercially produced mushrooms due to artificial cultivation. It has been used as a good medicine in addition to food. Recent studies have shown that it has anticancer and antihypertensive effects, and its wood decomposing ability is high, and its use value is increasing in the pulp industry wastewater purification and livestock waste purification industry. Artificial cultivation is active wood cultivation using the oak and oak tree, and cultivation using sawdust or rice straw, but has not been put to practical use because of the problems of mushroom quality and cultivation time. The optimum cultivation temperature is 22 ~ 26 ℃, and the humidity is about 70%.

The altitude, which is easy to get around and cheap, often rises to our table, is so rich that it has long been known as the omen of immortality. In the 'Agreement' and 'Herbine,' it is written that it helps to strengthen the spirit and not feel the hunger, thereby repairing the wind and helping blood circulation. It also clears your blood and boosts your appetite.

Shimano's unique flavor is that guanylic acid is more abundant than other mushrooms. Guanylic acid lowers cholesterol levels, which is good for people with high blood pressure and heart disease. Retinan, also found in altitude, is a powerful anticancer substance that activates the immune system. Therefore, as well as cancer, viral diseases such as cold, high blood pressure, diabetes is effective.

Altitude is rich in minerals and vitamins, and fiber helps digestion of the stomach and small intestine, which is good for obesity, diabetes, heart disease and liver disease. It is also good for growing children because it is rich in protein, calcium, phosphorus, iron, vitamin D, which strengthens bones, vitamin B, which is essential for hematopoiesis, and elite-attenin, which helps metabolize blood. Sun-dried shiitake is twice as nutritious as raw shiitake, especially vitamin D, which helps absorb calcium, making it stronger and preventing osteoporosis.

Vinegar is a fermented food that has a long history in both East and West. It is closely related to our diet, along with soy sauce and miso, and is an important seasoning.

Vinegar is the principle that alcohol and fermentation of various raw materials containing sugars or starch are made by using microorganisms, and 25 kinds of organic acids, 20 kinds of amino acids, 20 kinds of species It is a complex acidity seasoning and health food containing ether and various nutrients.

Vinegar is a traditional fermented food that has been used for a long time regardless of East and West, and is widely used as a food fragrance or therapeutic agent as well as food preservation effect. In general, vinegar not only improves the taste of the food itself, but also reduces saltiness and neutralizes fat. Vinegar is also known as a good raw material for clearing blood and effective in recovering fatigue and treating various adult diseases. Organic acids and amino acids contained in vinegar increase the resistance to diseases and are absorbed in the stomach has the effect of improving the acid constitution.

Vinegar contains various volatile and nonvolatile organic acids, sugars, amino acids, and esters other than acetic acid, which has a direction and taste that stimulates appetite, and is easily decomposed in biological tissues to generate calories faster than other caloric sources. Known as food. Natural vinegar has been recognized as a functional food and has been reported for research on the prevention of adult diseases such as arteriosclerosis and hypertension, bactericidal effect of food poisoning bacteria, cholesterol lowering effect, body fat reduction and fatigue recovery.

Korean Patent Registration No. 0454227 discloses acorn vinegar and its manufacturing method, but is different from the method of preparing shiitake mushroom vinegar of the present invention.

The present invention is derived from the above requirements, the object of the present invention is to prepare the shiitake mushroom vinegar with excellent taste and quality, alcohol fermentation period, acetic acid bacteria during acid fermentation, acidity, ethanol concentration, organic matter through a preliminary experiment The present invention was completed by developing shiitake mushroom vinegar that maximized the production of acetic acid by optimizing the wish concentration, yeast extract concentration, fermentation period, culture method, sterilization temperature and time.

In order to solve the above problems, the present invention comprises the steps of (a) extracting by adding water to shiitake mushrooms to produce a concentrated solution; (b) adding fermentation yeast to the concentrate of step (a) to produce alcohol fermentation broth; And (c) by adding the acetic acid bacteria to the fermentation broth of step (b) provides a method for producing shiitake mushroom vinegar comprising the step of fermenting acetic acid while shaking culture.

The present invention also provides shiitake mushroom vinegar prepared by the above method.

According to the present invention, the shiitake mushroom vinegar of the present invention can provide vinegar having high palatability with excellent taste and aroma without the off-flavor of shiitake mushrooms. The manufactured vinegar does not change quality even at room temperature storage for at least 60 days. In addition, the added value of shiitake mushrooms can contribute to stabilization of income of growers.

Figure 1 shows the alcohol content change during the alcoholic fermentation of shiitake concentrate.
Figure 2 shows the results of the PCR using agarose gel.
Figure 3 shows the PCR product purification results.
Figure 4 shows the transformation results.
5 shows colony PCR results.
Figure 6 shows the result of the enzyme treatment on the extracted plasmid.
Figure 7 compares the change in total acid content (%) during acetic acid fermentation according to static culture and shaking culture.
Figure 8 compares the change in total acid content (%) during acetic acid fermentation with initial acidity.
9 compares the total acid content (%) change during acetic acid fermentation with initial ethanol concentration.
Figure 10 compares the change in total acid content (%) during acetic acid fermentation with the initial nitrogen source concentration.
FIG. 11 compares the total acid content (%) change during acetic acid fermentation according to the initial yeast extract concentration.
12 compares the total acid content (%) change during acetic acid fermentation according to alcohol type.
A: alcohol fermentation broth of shiitake concentrate, B: alcohol 7%

In order to achieve the object of the present invention,

(a) adding water to shiitake mushroom, extracting and concentrating to prepare a concentrate;

(b) adding fermentation yeast to the concentrate of step (a) to produce alcohol fermentation broth; And

(c) by adding acetic acid bacteria to the fermentation broth of step (b) provides a method for producing shiitake mushroom vinegar, characterized in that it comprises the step of fermenting acetic acid while shaking culture.

The method for producing shiitake vinegar of the present invention is preferably

(a) extracting water by adding water to shiitake mushrooms and concentrating to prepare a concentrate of 8-12 brix;

(b) adding fermentation glucose and yeast to the concentrate of step (a) to prepare a fermentation broth by alcoholic fermentation for 5-7 days; And

(c) the fermentation broth of step (b) is set to pH 1.5-2.5%, ethanol concentration 3-5%, organic nitrogen source concentration 0.2-0.3% and yeast extract concentration 0.4-0.6%, and then Acetobacter aceti ( Acetobacter aceti) JMI2 (accession number: KACC91667P) was added to a shaking culture for 12 to 16 Acetic Acid Fermentation, filtration and may include the step of sterilization for 8 to 12 minutes at 65 ~ 75 ℃,

More preferably,

(a) adding 80 to 120 parts by weight of shiitake mushrooms to 1600 to 2400 parts by weight of water, extracting and concentrating at 70 to 90 ° C. for 3 to 5 hours to prepare a concentrate of 8 to 12 brix;

(b) 8 to 12 parts by weight of glucose and Saccharomyces cerevisiae ( Saccharomyces ) in 180 to 200 parts by weight of the concentrate of step (a) cerevisiae ) 4 to 6 parts by weight of alcohol fermentation for 5 to 7 days to prepare a fermentation broth; And

(c) the fermentation broth of step (b) is set to pH 1.5-2.5%, ethanol concentration 3-5%, organic nitrogen source concentration 0.2-0.3% and yeast extract concentration 0.4-0.6%, and then Acetobacter aceti ( Acetobacter aceti) JMI2 (accession No. After a while to KACC91667P) was added and cultured with shaking for 12 to 16 Acetic Acid Fermentation, filtration and may include the step of sterilization for 8 to 12 minutes at 65 ~ 75 ℃,

Most preferably,

(a) adding 2000 parts by weight of water to 100 parts by weight of shiitake mushroom, extracting and concentrating at 80 ° C. for 4 hours to prepare a concentrate of 10 brix;

(b) 10 parts by weight of glucose and 200 parts by weight of the concentrate of step (a) and Saccharomyces ( Saccharomyces) cerevisiae ) 5 parts by weight of alcohol fermentation for 6 days to prepare a fermentation broth; And

(c) wherein (b) the pH of 2% the fermentation broth of step, the ethanol concentration of 4%, and then an organic nitrogen source concentration set from 0.2 to 0.3% and yeast extract concentrations of 0.5% acetonitrile bakteo Oh Shetty (Acetobacter aceti) JMI2 (accession No. KACC91667P) may be added, followed by fermentation of acetic acid with shaking culture for 14 days, followed by filtration and sterilization at 70 ° C. for 10 minutes.

Method for producing shiitake mushroom vinegar of the present invention comprises the step of preparing a shiitake mushroom concentrate first. The concentration of the shiitake mushroom concentrate is preferably 8 to 12 brix, preferably 10 brix. The sensory evaluation of the vinegar prepared in the above range was the best.

The method of preparing shiitake mushroom vinegar of the present invention includes the step of preparing a fermentation broth by adding alcohol to the yeast prepared shiitake concentrate. The alcohol fermentation period is 5-7 days, preferably 6 days. There was no change in alcohol content after 6 days, so 6 days were found to be suitable.

In the method of preparing shiitake mushroom vinegar of the present invention, the alcohol fermentation broth is set to 1.5-2.5% acidity, 3-5% ethanol concentration, 0.2-0.3% organic nitrogen source concentration, and 0.4-0.6% yeast extract concentration, and then acetobacter aceti. ( Acetobacter aceti) JMI2 (accession No. added to KACC91667P) comprises After incubation with shaking for 12 to 16 acetic acid fermentation, the method comprising filtration and sterilized at 65 ~ 75 ℃ for 8 to 12 minutes.

For the fermentation of acetic acid, a strain excellent in acetic acid production was selected in the present invention, Acetobacter Aceti ( Acetobacter aceti) JMI2 (accession No. KACC91667P a) strains were used for this strain by acetic acid producing ability is the most excellent in the acid fermentation.

In fermentation of acetic acid, the shaking culture was superior to the fermentation culture, so the time to reach the highest acidity was shortened.

The initial acidity at the time of acetic acid fermentation was 1.5-2.5%, Preferably the sample adjusted to 2% was the most efficient for acetic acid production ability compared with other samples.

Samples adjusted to an initial ethanol concentration of 3 to 5%, preferably 4%, were most effective for acetic acid production.

Organic nitrogen source concentrations of 0.2-0.3% were the most efficient for acetic acid production.

The yeast extract concentration was 0.4-0.6%, preferably 0.5% of the sample adjusted to the most efficient for acetic acid production ability.

The fermentation of acetic acid for 12-16 days, preferably 14 days showed the best results in sensory evaluation.

The sterilization conditions of the prepared shiitake vinegar were treated for 8 to 12 minutes at 65-75 ° C., preferably for 10 minutes at 70 ° C., and were most suitable for the bactericidal effect of microorganisms.

The present invention also provides shiitake mushroom vinegar prepared by the method of the present invention.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

1. Manufacturing method of shiitake mushroom vinegar

(a) 20 L of water was added to 1 kg of shiitake mushrooms and extracted at 80 ° C. for 4 hours. The sugar content of the extracted extract was about 2 brix, and the extract was concentrated 5 times using a reduced pressure concentrator to prepare a concentrate of 10 brix.

(b) wherein (a) the elevation concentrate for the concentrate with 2 to L-glucose and 100 g of acetic acid produced in the step prior to incubation saccharide My process three Levy jiae (Saccharomyces cerevisiae A-6) was added to 50 ml of alcohol fermentation for 6 days to prepare a fermentation broth.

(c) wherein (b) the pH of 2% the fermentation broth of step, the ethanol concentration of 4%, and then an organic nitrogen source concentration set from 0.2 to 0.3% and yeast extract concentrations of 0.5% by the addition of acetonitrile bakteo Oh Shetty (Acetobacter aceti JMI2) 14 Vinegar was prepared by fermenting acetic acid while shaking culture for one day.

(d) The vinegar prepared in step (c) was placed in a nonwoven fabric and filtered by compression using a press machine, and sterilized at 70 ° C. for 10 minutes.

2. Experimental method

A) Isolation and Identification of Acetic Acid Bacteria

1) Acetic Acid Strain Separation Medium

The flat medium for separating acetic acid-producing bacteria for preparing shiitake vinegar is shown in Table 1, and the liquid medium for separating is shown in Table 2. In other words, the acetic acid bacteria separation plate medium was sterilized by 121 ℃ in autoclave for 15 minutes and then cooled to 45 ℃ after ethanol was added aseptically shaken well and then used to make a plate medium in Petri dishes. A medium in which 20% of shiitake was added to each of the separation media in ethanol 7%, yeast extract 1%, glucose 5%, and acetic acid 2% was used as a medium for separating the excellent strains for producing shiitake vinegar.

Composition of Flat Media for Separation of Acetic Acid Producing Bacteria division content(%) Glucose 5 Yeast extract One Ethanol 4 CaCO3 3 Agar 2.5

Composition of Liquid Media for Separation of Acetic Acid Producing Bacteria division content(%) Glucose 5 Yeast extract One Ethanol 7 Acetic acid 2

2) Acetic Acid Preservation Medium

The composition of the preservation medium of the finally selected acetic acid-producing strains is shown in Table 3. The medium was sterilized at 121 ° C. for 15 minutes in an autoclave, inoculated with the isolated acetic acid, incubated at 30 ° C. for 48 hours, and stored in a 5 ° C. refrigerator. It was used while.

Composition of Preservative Media of Acetic Acid-Derived Strains content(%) Glucose 5 Yeast extract One Ethanol 4 Agar 2.5

3) Isolation of Acetogenic Strains

Acetic acid-producing strain was incubated and activated for 24 hours at 30 ℃ for the seed of the sample collected in each composition, and diluted appropriately with physiological saline 0.2 ml was plated in a separate plate medium. A strain that forms a transparent ring around the colonies by incubating at 30 ° C. for 3 to 4 days is determined as a strain capable of producing acetic acid using ethanol, and is stored in a preservation medium and stored as acetic acid. It was used as an excellent strain target.

4) Selected excellent acetate strain

To select a strain having excellent acetic acid production, a liquid medium prepared with 20% shiitake mushrooms was prepared in the basic medium of Table 2, inoculated strains determined as acetic acid-producing strains in a separating plate medium, and a shaking incubator (150 rpm) were used. After shaking culture at 30 ° C. for 8 days, the amount of acetic acid produced was measured, and finally the strain having the best acetic acid production was selected.

5) Identification of Excellent Acetic Acid-Producing Strains by PCR

(A) Genomic DNA Extraction

Incubate in acetic acid preservation liquid medium until the OD ₆₀₀ value is 0.8 ~ 1.0. About 3-5 ml of the cultured strain was obtained using a culture centrifuge. Genomic DNA was extracted from the cells obtained using a G-spin genomic DNA Extraction Kit for microorganisms. First, 50 μl of pre-buffer and 3 μl of lysozyme were added and then cultured at 37 ° C. for 15 minutes to destroy the cell walls of the strains. Next, 250 μl of G buffer, 10 μl of Proteinase K, and 5 μl of RNase A were mixed and incubated at 65 ° C. for 15 minutes. After cell destruction has occurred, 250 μl of binding buffer is added to the column to allow genomic DNA to bind to the column. This was recovered only by column through centrifugation. Next, 500 μl of Washing buffer A and 500 μl of Washing buffer B were centrifuged at 13,000 rpm for 1 minute to wash the column. To separate only the clean DNA, 50 μl of Elution Buffer was added to the column, followed by centrifugation to obtain pure genomic DNA.

(B) Genomic DNA PCR

For the classification of this strain, the protein amplifies the internal transcribed spacer 1 and 2 (ITS) region known as the region containing information on the differentiation between species and genus among rDNA encoding ribosomal RNA (rRNA), an essential component when synthesizing the strain. Primers (518F 5'-CCAgCAgCCgCggTAATACg-3 '(SEQ ID NO: 1), 800R 5'-TACCAgggTATCTAATCC-3' (SEQ ID NO: 2)) were prepared. For PCR, 1 μl of two primers of purely genomic DNA and 10 pmol of each primer were added to the PCR premix tube (Bioneer) with 16 μl of SDW and mixed well. The conditions of PCR were first established by performing gradient PCR using various annealing temperatures, and then preliminarily denatured at 94 ° C. for 5 minutes, followed by 94 ° C. 30 seconds (modification) and 55 ° C. 30 seconds (primer binding). 40 cycles were performed at 72 ° C. for 45 seconds (amplification) and then maintained at 72 ° C. for 7 minutes to ensure amplification.

(C) PCR product purification

DNA was extracted using a PCR product extraction kit (G-spin PCRquick-spin ^™ PCR Product Purification Kit). 500 μl of Binding Buffer was added to the PCR product, mixed well, and then allowed to stand at room temperature for 1 minute, followed by centrifugation for 1 minute. Only the column was recovered by centrifugation, and then centrifuged at 13,000 rpm for 1 minute to wash the column using 700 μl of washing buffer. To separate only clean DNA, 30 μl of Elution Buffer was added to the column, followed by centrifugation to obtain pure DNA.

(D) Cloning into a vector for sequencing

In order to confirm the nucleotide sequence of the PCR product identified in the agarose gel, a pure PCR product obtained through the PCR purification method was obtained. In order to ligation the obtained 3 μl DNA with pGEM T-easy vector, incubate at 4 ° C. for 16 hours, and then 5 μl of the ligation mixture was added to E. coli. (XL1-blue) was transformed. A large number of colonies transformed on LB / amp medium can be seen, and colony PCR using primers used previously was performed to finally select correctly transformed clones.

(E) Culture of Selected Clones and Plasmid DNA Extraction

Selected clones are placed in LB / amp liquid medium and grown overnight at 37 ° C. About 3-5 ml of the cultured strain was obtained using a culture centrifuge. Plasmid DNA was extracted from the cells obtained using the plasmid DNA purification kit. First add 250µl of Resuspension buffer and 250µl of Lysis buffer and mix well. Next, 350 μl of Neutralization buffer was added thereto, mixed well, and centrifuged at 4 ° C. for 10 minutes. The supernatant obtained through centrifugation was placed in a column and centrifuged for 1 minute to recover only the column. Next, centrifuged for 1 minute at 13,000 rpm to wash the column using 700 μl Washing buffer B. To separate only clean DNA, 50 μl of Elution Buffer was added to the column, followed by centrifugation to obtain pure plasmid DNA.

(F) Enzyme treatment on the extracted plasmid

5 μl of the extracted plasmid, 1 μl of EcoR1, 1.5 μl of EcoR1 buffer, and 7.5 μl of SDW were added and treated at 37 ° C. for 2 hours.

(G) Base sequence determination and NCBI blast

Plasmids were extracted from the transformed clones and submitted for sequencing (macrogen). The results were put into NCBI program for analysis.

B) establishment of acetic acid fermentation conditions

1) Materials

The altitudes used in this experiment were those produced at Jangheung-gun Mushroom Research Institute in 2010 and used as samples.

2) Used strain

The chosangyun is to separate the pure from the chosangyun collected vinegar to collect 12 points jongcho acid producing ability is best used Acetobacter Acetic Acid Fermentation It was used JMI2 aceti strain.

3) used badge

Separation flat medium for the establishment of acetic acid fermentation conditions for the preparation of shiitake vinegar is shown in Table 4, the liquid medium for separation is shown in Table 5. In other words, the acetic acid bacteria separation plate medium was sterilized by 121 ℃ in autoclave for 15 minutes and then cooled to 45 ℃ after ethanol was added aseptically shaken well and then used to make a plate medium in Petri dishes. As a medium for separating excellent strains for the production of shiitake vinegar, 7% of ethanol, 1% of yeast extract, 5% of glucose, and 2% of acetic acid were used.

Composition of Flat Media for Separation of Acetic Acid Producing Bacteria division content(%) Glucose 5 Yeast extract One Ethanol 4 CaCO3 3 Agar 2.5

Composition of Liquid Media for Separation of Acetic Acid Producing Bacteria division content(%) Glucose 5 Yeast extract One Ethanol 7 Acetic acid 2

3) Experiment Method

(1) Verification of growth inhibition ability of acetic acid bacteria by adding shiitake

The antimicrobial activity was determined to affect the growth of acetic acid bacteria by citing the results of the antimicrobial activity measurement of shiitake. As an experimental method, 20% of the sea level was added to the flat medium for separating acetic acid-producing bacteria, and Acetobacter The aceti JMI2 culture was dispensed on a plate medium and incubated at 30 ° C. for 3 to 4 days, and then the clear circumference around the colonies was measured to confirm the inhibition of the growth of acetic acid bacteria.

(2) Comparison of Acetic Acid Production Capacity in Political Culture and Shake Culture

Acetobacter under the conditions of each culture solution added 20% of altitude to compare acetic acid production ability according to the culture method in vinegar culture It was inoculated JMI2 aceti strain and with each at 30 ℃ 16 ilgan static culture and shaking culture measuring the pH every two days compared to stationary culture and shaking culture during acid producing ability.

(3) Comparison of acetic acid production capacity according to initial acidity

In order to investigate the effect of initial acidity on acetic acid production, acidity was adjusted to 1, 2, 4 and 8% in each culture condition with 20% elevation, and Acetobacter year and 30 ℃ 16 days with shaking culture was inoculated JMI2 aceti strain measuring the pH every two days was examined the influence of initial pH on the amount of acetic acid.

(4) Comparison of acetic acid production capacity according to the concentration of initial ethanol

By an initial ethanol concentration of inoculated with Acetobacter aceti JMI2 strains respectively adjust the ethanol concentration to 1, 2, 4 and 8% in each culture condition was added to the altitude of 20% to examine the effect of the acetic acid produced in 30 ℃ 16 Acidity was measured at two-day intervals during daily shaking culture to investigate the effect of initial ethanol concentration on acetic acid production.

(5) Comparison of acetic acid production capacity according to concentration of organic nitrogen source

In order to investigate the effect of acetic acid production on the concentration of initial nitrogen source, diammonium hydrogenphosphate ((NH ₄ ) ₂ HPO ₄ ) was added 0.1, 0.5, 1, and 2% were added to the inoculation by the Acetobacter aceti JMI2 strains were cultured at 30 ℃ 16 days with shaking measuring the pH every two days was examined the influence of the initial concentration of nitrogen sources on the production of acetic acid.

(6) Comparison of acetic acid production ability according to the concentration of yeast extract

In each culture condition was added to 20% of elevation in order to examine the effect of acetate produced in accordance with the yeast extract concentration of yeast extract (yeast extract) to a concentration adjustment by 1, 2, 4 and 8% of Acetobacter The effect of yeast extract concentration on acetic acid production was investigated by inoculating the aceti JMI2 strain and measuring the acidity at 2 days intervals with shaking culture at 30 ° C. for 16 days.

(7) Acetic acid production ability and sensory evaluation by alcohol type

(A) Acetic acid production ability according to alcohol type

To investigate the effect of vinegar on acetic acid production ability according to the type of alcohol, the altitudes of alcoholic fermented specimens and Acetobacter in 7% alcohol aceti respectively inoculated JMI2 strain and at 30 ℃ shaking culture for 16 days was measured for acid producing ability by measuring the pH in the interval 2 days.

(B) Sensory evaluation

The sensory evaluation of vinegar prepared with different kinds of alcohols was conducted on 10 panelists who passed the preliminary examination. The scoring criteria are very good at this time; 5 points, good; 4 points, normal; Three points, bad; 2 points, very bad; One point was used and the number of samples was changed every two hours. The same panel was repeated three times, and the average score was obtained except for the highest and lowest scores for each iteration. The significance test by treatment group was statistically processed by Duncan's multiple comparison using SPSS program.

C) Sterilization and storage of vinegar

1) sterilization

(A) microbiological testing

The microorganisms of shiitake vinegar were measured by the number of bacteria, lactic acid bacteria, yeast, and acetic acid bacteria by a flat cloth culture method. The bacteria were incubated in flat agar plates, lactic acid bacteria in a Rogosa SL agar medium with 0.133% acetic acid adjusted to 5.5 and yeast were incubated at 25 ° C / 72 hours in YM agar medium. After culturing in acetic acid preservation medium, the number of colonies was measured by 30-100 colonies, and the number of microorganisms per unit volume was calculated by multiplying the dilution factor.

(B) Chromaticity change according to treatment temperature and time

In order to compare the chromaticity of the shiitake vinegar according to the sterilization conditions were analyzed as follows. In other words, 20 ml of the sample was centrifuged to filter the supernatant, and the color values (super color SP-80, Tokyo, Denshoku, JAPAN) of the Hunter values L (brightness), a (red) and b ( Yellowness) value was measured.

(C) sensory evaluation

The sensory test of shiitake vinegar, which was heated at 60 ~ 100 ℃ for 10 minutes, consisted of 10 panelists who passed preliminary tests, and performed color, aroma, taste, turbidity, and overall acceptability by 5-point grading method. It was. The scoring criteria are very good at this time; 5 points, good; 4 points, normal; Three points, bad; 2 points, very bad; One point was used and the number of samples was changed every two hours. The same panel was repeated three times, and the average score was obtained except for the highest and lowest scores for each iteration. The significance test by treatment group was performed by Duncan's multiple comparison using SPSS program.

2) retention period according to storage conditions

In order to measure the preservation period according to the storage condition of the shiitake vinegar, the sterilized vinegar was stored at 4 ℃ and 30 ℃ for 60 days, and the viable cell count was measured at 6 days intervals. The setup was reviewed.

Example  1: setting alcohol fermentation conditions

1) Manufacture of Shiitake Concentrate

20 L of water was added to 1 Kg above sea level and extracted at 80 ° C for 4 hours. The sweetness of the extract was about 2 brix, and the extract was concentrated 5 times using a reduced pressure concentrator to prepare a 10 brix concentrate.

2) Manufacture of shiitake fermentation broth

Saccharomyces Saccharomyces Precultured in Shiitake Concentrate for Acetic Acid Production 50 ml of cerevisiae A-6) was added to ferment alcohol. As the sugar content of the shiitake concentrate was not high, glucose (5%) was added to increase the alcohol fermentation ability. The alcoholic fermentation of the sea level concentrate significantly reduced the area of the rich seam that is always a problem in processed products using sea level.

3) Alcohol content change of fermentation broth

The alcohol content of the shiitake fermentation broth is shown in FIG. After the start of fermentation, the alcohol content was about 0.6% on the first day, and as fermentation progressed, it was 1.4% on the second day, 3.1% on the third day, 5.4% on the fourth day, and 6.2% on the fifth day. It was. The fermentation took a total of six days and after the final fermentation had an alcohol content of about 6.7%. After 6 days, it was confirmed that there is no change in alcohol content, and the alcohol fermentation period of shiitake concentrate should be 6 days.

Example  2: Acetic Acid Bacteria Isolation and Identification

1) Selection of Acetogenic Strains

A total of 12 species of acetic acid strains judged as acetic acid bacteria were isolated by observing the morphological characteristics and colony of colonies while inoculating the seedlings collected from each composition on a plate medium for separating acetic acid bacteria and incubating at 30 ° C. .

2) Selection of excellent acetic acid producing strains

In order to select strains with excellent acetic acid production, 12 kinds of strains purely isolated from medium containing shiitake concentrate were inoculated into the basic medium for vinegar fermentation, followed by shaking culture for 3 days at 30 ° C. 6 is shown. That is, the acetic acid producing ability of 12 strains was expressed by the relative activity in% by the amount of acetic acid of JMI2 strain 100. As a strain having a relatively high production ability of more than 90%, JMI-9 strain was found to be 90.20%. Therefore, the JMI2 strain was found to be the best fermentation of shiitake vinegar, which was recognized as having the highest acetic acid production ability compared to other strains. Acetobacter the Acetobacter aceti) JMI2 strain was deposited with the National Academy of Agricultural Sciences Agricultural Genetic Resources dated 1 September 2011, the Center (accession number: KACC91667P).

Excellent Acetic Acid Bacteria Isolation Acetic acid bacteria Acidity Relative activity JMI-1 4.1 80.39 JMI-2 2.1 41.18 JMI-3 2.6 50.98 JMI-4 2.8 54.90 JMI-5 2.7 52.94 JMI-6 2.2 43.14 JMI-7 3.3 64.71 JMI-8 1.9 37.25 JMI-9 4.6 90.20 JMI2 5.1 100.00 JMI-11 4.2 82.35 JMI-12 4.3 84.31

3) Identification of Excellent Acetic Acid Strains by PCR

A) Genomic DNA Polymerase chain reaction (PCR)

As a result of confirming the amplification of the gene in all strains by electrophoresis on agarose gel of 1% concentration of DNA amplified by PCR. Genetic amplification of about 600-700 bp was confirmed in all strains.

B) PCR product purification

Purification of the PCR product by electrophoresis on 1% agarose gel as a result confirmed by the UV as shown in FIG. About 600 to 700 bp of DNA fragments were identified in all strains, and only one band was confirmed, and only the desired band was purified.

C) cloning into a vector for sequencing

As a result of the transformation, it was confirmed that white colonies and blue colonies were formed as shown in FIG. 4. Blue colonies are colonies that do not have a gene inserted. White colonies are expected to have a gene inserted. Only a few colonies of white colonies were selected and colony PCR was performed.

The PCR product was electrophoresed using 1% agarose gel and confirmed through UV as shown in FIG. 5. It was confirmed that the gene was inserted in two colonies among eight colonies, one in acetic acid bacterium 6, four in acetic acid bacterium 8, two in acetic acid bacterium 9, and two in acetic acid bacterium 10. Colony PCR was performed to select colonies showing 600-700 bp bands expected as target genes among several colonies.

D) Culture of Selected Colonies and Plasmid DNA Extraction

Selected colonies were incubated at 37 ° C. for one day . Cultured colonies were confirmed to grow hazy.

E) Enzyme treatment on the extracted plasmid

When only the plasmid DNA is extracted from the colonies expected to be inserted into the gene and subjected to enzymatic treatment, the result of confirming through UV that the circular plasmid is cut by the vector and the gene DNA is shown in FIG. 6. Enzyme treated DNA was electrophoresed using 1% agarose gel and visually confirmed through UV. As a result, it was confirmed that the selected colonies were transformed by confirming that the vector (top band) and the gene (bottom band) were cut.

F) Base sequence determination and blast results of acetic acid bacteria

The base sequence of 679bp was determined, and the result of confirming the strain name of the analyzed base sequence is shown in Table 7. The sequence shown in Table 7 is the sequence of 628 bp in which 5 'and 3' portions of 679 bp were omitted. Search results using NCBI blast program Acetobacter The isolated strain was identified as acetic acid 100% matched to acet i. Also, gene No was identified as dbj | AB569643.1.

Sequencing blast results Strain name Acetic acid bacteria Base sequence AATATCTACGAATTTCACCTCTACACTGGGAATTCCACAACCCTCTCTCACACTCTAGTCTGCACGTATCAAATGCAGCTCCCAGGTTAAGCCCGGGGATTTCACATCTGACTGTACAAACCGCCTACACGCCCTTTACGCCCAGTCATTCCGAGCAACGCTAGCCCCCTTCGTATTACCGCGGCTGCTGGCACGAAGTTAGCCGGGGCTTCTTCTACGGGTACCGTCATCATCGTCCCCGTCGAAAGTGCTTTACAATCCGAAGACCTTCTTCACACACGCGGCATTGCTGGATCAGGGTTGCCCCCATTGTCCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCTGATCATCCTCTCAAACCAGCTATTGATCATCGCCTTGGTAGGCCTTTACCCCACCAACTAGCTAATCAAACGCAGGCTCCTCCACAGGCGACTTGCGCCTTTGACCCTCAGGTGTCATGCGGTATTAGCACCAGTTTCCCAGTGTTATCCCCCACCCATGGATAGATACCTACGCGTTACTCACCCGTCCGCCACTAAGGCCGAAACCTTCGTGCGACTTGCATGTGTTAAGCATGCCGCCAGCGTTCGCTCT (SEQ ID NO: 3) Scientific name Acetobacter aceti Similarity 100% gene No. dbj | AB569643.1

Example  3: acetic acid fermentation conditions

1) Verification of growth inhibition ability of acetic acid bacteria by adding shiitake

As a result of verifying the ability to produce acetic acid bacteria due to the addition of shiitake, the activity of acetic acid bacteria also appeared in the medium added with shiitake when compared to the control without the addition of shiitake.

2) Acetic acid production ability during political culture and shaking culture

In order to determine the acetic acid production ability according to the culture method, the result of comparing the acetic acid production ability in the static culture and shaking culture is shown in FIG. The amount of acetic acid produced by cultivation was 0.16% immediately after soaking, and it increased from the 4th day of fermentation and decreased after reaching the peak acidity of 3.38% at 14 days of fermentation. It was 0.12% and it increased sharply from the 4th day of fermentation and decreased after reaching the highest acidity of 3.51% around 12th day of soaking. According to the results of acetic acid production according to the culture method, the shaking culture was faster than the fermentation culture, and the time to peak acidity was shortened.

3) Acetic acid production capacity according to initial acidity

In order to compare acetic acid production ability according to the initial acidity, the initial acidity of the acetic acid production medium was adjusted to 0%, 1%, 2%, 3% and 4% to confirm the effect on acetic acid production as shown in FIG. 8. In general, acetic acid fermentation is to adjust the initial acidity to prevent contamination of various bacteria, Acetobacter The aceti JMI2 strain was inhibited by harmful bacteria as the fermentation period elapsed in the control and 1% control groups, and acetic JMI2 was not well progressed. The vinegar production efficiency showed that the initial acidity of 2% of the sample was the highest change of acetic acid content compared to the other sample.

4) Acetic acid production ability according to the concentration of initial ethanol

In order to compare acetic acid production ability according to the initial ethanol concentration, the result of confirming the effect on acetic acid production by adjusting the initial ethanol content of acetic acid production medium to 2%, 4%, 6%, 8% and 10% is shown in FIG. Fermentation was completed after 6 days of cultivation in the ethanol content of 2%, but the acetic acid content was low and fermentation was complete in 8 days of cultivation in the control of 4%. And fermentation was completed at 14 days of culture in the sample sphere adjusted to 10%. These results showed that the fermentation period was shorter in the sample with 2% ethanol content but the efficiency was lower due to the lower total acid content, while the fermentation period took longer time for the sample with 6%, 8% and 10%. Was low.

5) Acetic acid production capacity according to nitrogen source concentration

In order to compare the acetic acid production ability according to the nitrogen source concentration by adjusting the initial nitrogen source content of the acetic acid production medium to 0%, 0.1%, 0.2%, 0.3% and 0.4% to confirm the effect on the amount of acetic acid production is shown in FIG. Fermentation was completed after 14 days of cultivation in the control group without the nitrogen source and 0.1% control, and fermentation was completed after 12 days in the culture control group at 0.2% and 0.3%. Fermentation was completed 14 days after incubation as in the control group, 0.4% adjusted to 0.4%, the most effective organic nitrogen source concentration of acetic acid production is estimated to be 0.2 ~ 0.3%.

6) Acetic acid production ability according to yeast extract concentration

In order to compare the acetic acid production ability according to the yeast extract concentration, the initial yeast extract content of the acetic acid production medium was adjusted to 0.1%, 0.5%, 1.0%, 2.0% to confirm the effect on the amount of acetic acid production is shown in FIG. The acetic acid content was 4.37% in the control group which was not added, and 5.17% in the control group adjusted to 0.1% and 5.96% in the control group added to 0.5%. In the 1.0% and 2.0% sample groups, the acetic acid contents were 5.71% and 6.04%, so that 0.5% was not found.

7) Acetic acid production ability and sensory evaluation by alcohol type

A) Acetic acid production ability according to alcohol type

As a result of confirming acetic acid production ability according to the alcohol type is shown in FIG. Alcohol produced by fermenting shiitake concentrate and Acetobacter in 7% alcohol As a result of acetic JMI2 strain inoculation and acetic acid fermentation, both samples showed the maximum alcohol content at 12 days of fermentation.

B) sensory evaluation

Sensory evaluation results of vinegar prepared by different alcohol types are shown in Table 3. The results showed that the preference of the vinegar prepared by fermenting the shiitake concentrate was 3.6, and the preference of the vinegar prepared by adding 7% alcohol was slightly higher than 3.5. Vinegar prepared by adding% alcohol was higher than 3.5. Although the fragrance of the sea level decreased significantly, it was slightly lower than the vinegar prepared by adding 7% alcohol. High.

Sensory Evaluation of Vinegars Prepared with Different Alcohols division incense color flavor Likelihood Shiitake concentrate alcohol fermentation 3.6 3.4 4.1 3.7 7% spirit 3.9 3.6 3.5 3.6

8) Component Analysis of Vinegar According to the Elevated Concentration Concentration

Vinegar was prepared at different concentrations of 3, 5, 10, and 15 brix, and the quality was measured. The fermentation of acetic acid for 14 days was the most efficient for vinegar fermentation. .

9) Set sterilization conditions of shiitake vinegar

A) Total bacterial count

Experimental results of the microbial sterilization according to the treatment temperature and time of the finished shiitake vinegar are shown in Table 9. Shiitake vinegar without heat sterilization showed a total bacterial count of 1.0 × 10 ⁴ CUF / ml. On the basis of this, the microbial sterilization effect according to the treatment temperature was slightly different for each sample, but it was generally sterilization effect from 70 ℃. In addition, when looking at the sterilization effect of the microorganism by time zone did not show the sterilization effect at 60 ℃. Overall, the microbial sterilization effect according to the treatment temperature and time is the most suitable method of heat treatment for 10 minutes at 70 ℃ showing the bactericidal bactericidal effect.

Total bacteria test result Heating temperature (℃) Time (minutes) Total number of bacteria Control 1.0 x 10 ⁴
60 5 6.7 × 10 ³ 10 4.2 × 10 ² 15 1.6 × 10
70 5 2.4 × 10 10 - 15 -
80 5 - 10 - 15 -
90 5 - 10 - 15 -
100 5 - 10 - 15 -

B) sensory evaluation

Sensory evaluation results of shiitake vinegar sterilized at different temperatures are shown in Table 10. The palatability of shiitake vinegar was the highest in the specimens sterilized at 60 ° C and 70 ° C. The higher the sterilization temperature, the lower the palatability. Therefore, the optimum sterilization temperature of shiitake vinegar is determined to be 70 ° C.

Sterilization temperature (10 minutes) incense color flavor Likelihood 60 ° C 4.0 3.5 3.7 3.8 70 ℃ 4.0 3.5 3.7 3.8 80 ℃ 4.0 3.5 3.6 3.6 90 ° C 3.9 3.5 3.5 3.6 100 ℃ 3.6 3.5 3.4 3.4

10) Preservation Period According to Storage Conditions of Shiitake Mushroom Vinegar

The results of measuring the storage period according to the storage conditions of the prepared and sterilized vinegar are shown in Tables 11 and 12. Looking at the microbiological test results by storage temperature, the microorganisms were not detected in all the specimens stored for 60 days at 4 ℃ and 30 ℃ is determined that the quality change does not occur even at room temperature storage for at least 60 days.

Microbiological test results according to the storage condition of shiitake vinegar at 4 ℃ microbe term 6 12 18 24 30 36 42 48 54 60 Germ - - - - - - - - - - Lactic acid bacteria - - - - - - - - - - leaven - - - - - - - - - - Acetic acid bacteria - - - - - - - - - -

Microbiological Test Results According to the Storage Conditions of 30 ℃ of Shiitake Vinegar microbe term 6 12 18 24 30 36 42 48 54 60 Germ - - - - - - - - - - Lactic acid bacteria - - - - - - - - - - leaven - - - - - - - - - - Acetic acid bacteria - - - - - - - - - -

Agricultural Biotechnology Research Institute KACC91667 20110901

Attach an electronic file to a sequence list

Claims (4)

(a) extracting water by adding water to shiitake mushrooms and concentrating to prepare a concentrate of 8-12 brix;
(b) adding fermentation glucose and yeast to the concentrate of step (a) to prepare a fermentation broth by alcoholic fermentation for 5-7 days; And
(c) the fermentation broth of step (b) is set to 1.5 ~ 2.5% acidity, 3 ~ 5% ethanol concentration, 0.2 ~ 0.3% organic nitrogen source concentration and 0.4 ~ 0.6% yeast extract concentration, and then Acetobacter aceti ) Shiitake mushroom comprising the step of adding acetic acid fermentation while shaking culture for 12-16 days by adding JMI2 (Accession No .: KACC91667P), filtering and sterilizing at 65-75 ℃ for 8-12 minutes. Method of preparing vinegar. delete The method of claim 1,
(a) adding 80 to 120 parts by weight of shiitake mushrooms to 1600 to 2400 parts by weight of water, extracting and concentrating at 70 to 90 ° C. for 3 to 5 hours to prepare a concentrate of 8 to 12 brix;
(b) 8 to 12 parts by weight of glucose and 4 to 6 parts by weight of Saccharomyces cerevisiae are added to 180 to 220 parts by weight of the concentrate of step (a), followed by alcohol fermentation for 5 to 7 days. Preparing a; And
(c) the fermentation broth of step (b) is set to 1.5 ~ 2.5% acidity, 3 ~ 5% ethanol concentration, 0.2 ~ 0.3% organic nitrogen source concentration and 0.4 ~ 0.6% yeast extract concentration, and then Acetobacter aceti ) Shiitake mushroom comprising the step of adding acetic acid fermentation while shaking culture for 12-16 days by adding JMI2 (Accession No .: KACC91667P), filtering and sterilizing at 65-75 ℃ for 8-12 minutes. Method of preparing vinegar. Shiitake vinegar prepared by the method of claim 1.

Images