KR102237383B1 - Biomarkers of benA and cyp51A gene for the molecular diagnosis of clinical Aspergillus and genetic synthetic control template for the qualitative and quantitative analysis - Google Patents

Abstract

The present invention relates to a biomarker of benA and cyp51A genes for molecular diagnosis of major clinical Aspergillus species and a control gene synthesis for qualitative quantitative analysis, and more specifically, the present invention relates to molecular diagnosis of Aspergillus species By using the benA and cyp51A gene biomarkers for aspergillosis, the Aspergillus species that cause Aspergillosis are molecularly and quickly diagnosed, and the azole-resistant Aspergillus species is identified, and the effective aspergillus species is selected through the selection of an appropriate antifungal agent. It makes it possible to cure perugillosis.

Description

Biomarkers of benA and cyp51A gene for the molecular diagnosis of clinical Aspergillus and genetic synthetic control template for the qualitative and quantitative analysis. quantitative analysis}

The present invention relates to a biomarker of benA and cyp51A genes for molecular diagnosis of major clinical Aspergillus species and a control gene synthesis for qualitative quantitative analysis.

Invasive aspergillosis (IA) is known as a fatal infection caused by Aspegillus spp . that occurs in immunocompromised patients. Recently, the number of immune patients is on the rise, and the morbidity of IA and The mortality rate is also very high, and thus the social and economic costs are increasing rapidly. Representative fungal species that cause IA are Aspergillus fumigatus (A. fumigatus ), Aspergillus flavus (A. flavus ), Aspergillus terreus (A. terreus ), Aspergillus niger ( A. niger ) is a group of closely related species, and it is often difficult to classify it with the existing morphology test or ITS molecular diagnostic test method), but recently, antifungal resistance such as azole resistance has increased. Is becoming a big problem.

Existing diagnosis of IA includes morphological diagnosis of fungi through culture (microscopic examination after culture, etc.) and molecular diagnosis through PCR-sequencing. Both tests require the process of generating conidia through cultivation in a clinical sample. Depending on the conditions, it takes 3 to 10 days to generate conidia (morphological test), and then DNA is extracted and sequencing is performed. There is a problem that it takes 2 to 3 days to obtain the analysis result (molecular diagnosis) through. In addition, it takes an additional 2-3 days to judge antifungal resistance.

In order to treat IA, which has a high mortality rate, rapid diagnosis is required, so improvement of the existing diagnosis method is very urgent. Therefore, many researchers are developing molecular diagnosis of A. fumigatus , a major species (using ITS biomarker) or molecular diagnosis of azole resistance, using real-time PCR.

Herbrecht R et al., Ann N Y Acad Sci 2012;1272:23-30 Meis JF et al., Philos Trans R Soc Lond B Biol Sci 2016;371(1709), pii: 20150460 Cho SY et al., Medicine (Baltimore) 2017;96:e8841

An object of the present invention is to provide a composition and kit for diagnosing invasive aspergillosis comprising a primer set and a probe for detecting benA and cyp51A genes for molecular diagnosis of aspergillosis.

Another object of the present invention is to provide a method of providing information necessary for diagnosis of invasive aspergillosis using a primer set for detecting benA and cyp51A genes and probes for molecular diagnosis of aspergillosis.

In order to achieve the above object, the present invention provides a nucleic acid sequence of benA gene comprising the nucleotide sequence of SEQ ID NO: 13; A primer set for amplifying the benA gene of Aspergillus spp. consisting of the nucleotide sequences of SEQ ID NO: 1 and 2; A control probe for detecting the Ascomycetes benA gene consisting of the nucleotide sequence of SEQ ID NO: 3; And SEQ ID NOS: provides a composition for diagnosing aspergillosis comprising a probe for detecting benA gene of Aspergillus spp. consisting of one or more nucleotide sequences selected from the group consisting of 4 to 7 .

The present invention also provides a nucleic acid sequence of benA gene comprising the nucleotide sequence of SEQ ID NO: 13; A primer set for amplifying the benA gene of Aspergillus spp. consisting of the nucleotide sequences of SEQ ID NO: 1 and 2; A control probe for detecting the Ascomycetes benA gene consisting of the nucleotide sequence of SEQ ID NO: 3; And SEQ ID NOS: provides a diagnostic kit for aspergillosis (aspergillosis) comprising a probe for detecting the benA gene of Aspergillus species (Aspergillus spp.) consisting of one or more nucleotide sequences selected from the group consisting of 4 to 7 .

The present invention also provides a nucleic acid sequence of the benA gene comprising the nucleotide sequence of SEQ ID NO: 13,

A primer set for amplifying the benA gene of Aspergillus spp. consisting of the nucleotide sequences of SEQ ID NO: 1 and 2; A control probe for detecting the Ascomycetes benA gene consisting of the nucleotide sequence of SEQ ID NO: 3; And SEQ ID NOS: preparing a standard quantitative curve by reacting with a probe for detecting benA gene of Aspergillus spp. consisting of one or more nucleotide sequences selected from the group consisting of 4 to 7; And

The benA gene amplification primer set and the benA gene detection probe of Aspergillus spp. were contacted with a biological sample and compared with a standard quantitation curve to measure the presence of Aspergillus spp. It provides a method of providing information necessary for the diagnosis of aspergillosis, including the step of.

The present invention also provides a nucleic acid sequence of the benA gene comprising the nucleotide sequence of SEQ ID NO: 13,

A primer set for amplifying the benA gene of Aspergillus spp. consisting of the nucleotide sequences of SEQ ID NO: 1 and 2; A control probe for detecting the Ascomycetes benA gene consisting of the nucleotide sequence of SEQ ID NO: 3; And SEQ ID NOS: preparing a standard quantitative curve by reacting with a probe for detecting benA gene of Aspergillus spp. consisting of one or more nucleotide sequences selected from the group consisting of 4 to 7; And

The benA gene amplification primer set and the benA gene detection probe of Aspergillus spp. were contacted with a biological sample and compared with a standard quantitation curve to measure the presence of Aspergillus spp. It provides a method for diagnosing aspergillosis comprising the step of.

The composition, kit, and method for diagnosing aspergillosis include a primer set for amplifying Cyp51A gene of Aspergillus tubingensis consisting of the nucleotide sequences of SEQ ID NOs: 8 and 9 to determine azole resistance. And a primer set for amplifying the Cyp51A gene of Aspergillus fumigatus consisting of the nucleotide sequences of SEQ ID NO: 10 and 11; And a probe for detecting Cyp51A gene mutation of the Aspergillus tubingensis strain consisting of the nucleotide sequence of SEQ ID NO: 12.

The present invention uses benA and cyp51A gene biomarkers for molecular diagnosis of Aspergillus species to quickly molecularly diagnose Aspergillus strains that cause Aspergillosis, as well as azole-resistant Aspergillus strains. It enables effective treatment of Aspergillosis through the selection of an appropriate antifungal agent by determining

1 shows an overview of multiplex identification using the biomarker of the present invention.
Figure 2 shows the sensitivity measurement and quantification curves of the benA gene control and genomic DNA.
3 is an analysis result of an azole-sensitive Aspergillus fumigatus (A. fumigatus ) strain and a resistant strain.

Hereinafter, the configuration of the present invention will be described in detail.

The present invention provides a nucleic acid sequence of benA gene comprising the nucleotide sequence of SEQ ID NO: 13; A primer set for amplifying the benA gene of Aspergillus spp. consisting of the nucleotide sequences of SEQ ID NO: 1 and 2; A control probe for detecting the Ascomycetes benA gene consisting of the nucleotide sequence of SEQ ID NO: 3; And SEQ ID NOS: It relates to a composition for diagnosing aspergillosis comprising a probe for detecting the benA gene of Aspergillus spp. consisting of one or more nucleotide sequences selected from the group consisting of 4 to 7 .

In addition, the present invention is a nucleic acid sequence of the benA gene comprising the nucleotide sequence of SEQ ID NO: 13; A primer set for amplifying the benA gene of Aspergillus spp. consisting of the nucleotide sequences of SEQ ID NO: 1 and 2; A control probe for detecting the Ascomycetes benA gene consisting of the nucleotide sequence of SEQ ID NO: 3; And SEQ ID NOS: provides a diagnostic kit for aspergillosis (aspergillosis) comprising a probe for detecting the benA gene of Aspergillus species (Aspergillus spp.) consisting of one or more nucleotide sequences selected from the group consisting of 4 to 7 .

The present invention is characterized in that the benA gene biomarker (primer/probe set) is used for rapid identification by multiplex identification method for major clinical strains of IA and for molecular diagnosis by qualitative/quantitative method (Table 1). Reference). Next, aspergillus tubingensis (Aspergillus tubingensis ) (section Nigri) in which the TR mutation of the Cyp51A promoter of Aspergillus fumigatus involved in azole resistance and the azole-resistant strain frequently occurs Cyp51A It is characterized by being used for rapid quantitative/qualitative analysis through biomarkers using genes (Table 1). In addition, a standard material to be used for quantitative analysis by designing a control DNA template that can be used for quantification/qualification of benA (control DNA template: each has five probe sequences of benA genes) (see Table 2: SEQ ID NO: 13) Was developed. 1 shows an overview of the molecular diagnosis method of the present invention utilizing the above-described biomarker.

The term "biomarker" as used herein refers to a substance capable of indicating a disease state. In the context of the present invention regarding the diagnosis of Aspergillosis , "biomarker" refers to a specific site of the benA or Cyp51A gene of Aspergillus spp. "Biomarkers" may or may not appear in individuals suffering from aspergillosis or more susceptible to aspergillosis than in a normal healthy state, depending on the type.

As used herein, the term “diagnosis” refers to ascertaining the presence or character of a pathological condition. For the purposes of the present invention, "diagnosis" means determining the presence and risk of developing clinical Aspergillus spp. based on in vitro analysis of a biological sample. Preferably, the present invention can diagnose invasive aspergillosis (IA).

The clinical Aspergillus spp. is Aspergillus fumigatus (A. fumigatus ), Aspergillus niger (A. niger ), Aspergillus flavus (A. flavus ) and Aspergillus terreus (A. terreus ) may be included.

The biomarkers of the benA and Cyp51A genes are primer sets and probes used for real-time PCR,

The primer set for amplifying the benA gene of Aspergillus spp. consists of the nucleotide sequences of SEQ ID NO: 1 and 2. The gene control compound that can be amplified by the primer set may include the nucleotide sequence of SEQ ID NO: 13.

Ascomycetes (Ascomycetes) The control probe for detecting the benA gene may be composed of the nucleotide sequence of SEQ ID NO: 3.

The probe for detecting the benA gene of Aspergillus spp. may consist of one or more nucleotide sequences selected from the group consisting of SEQ ID NOS: 4 to 7.

In addition, the composition, kit, and method for diagnosing aspergillosis are for amplifying the Cyp51A gene of Aspergillus tubingensis consisting of the nucleotide sequences of SEQ ID NO: 8 and 9 to determine azole resistance. A primer set and a primer set for amplifying the Cyp51A gene of Aspergillus fumigatus consisting of the nucleotide sequences of SEQ ID NO: 10 and 11; And a probe for detecting Cyp51A gene mutation of the Aspergillus tubingensis strain consisting of the nucleotide sequence of SEQ ID NO: 12.

As used herein, the term "probe" refers to a linear oligomer having a natural or modified monomer or linkage including a deoxyribonucleotide and a ribonucleotide capable of hybridizing to a specific nucleotide sequence. Specifically, the probe is single-stranded for maximum efficiency in hybridization, and more specifically, it is a deoxyribonucleotide. As the probe used in the present invention, a sequence that is perfectly complementary to the benA or Cyp51A gene nucleic acid sequence may be used, but a sequence that is substantially (substantially) complementary within a range that does not interfere with specific hybridization may be used. May be. Accordingly, the sequence used in the present invention is interpreted to include a sequence exhibiting substantial identity with the sequence listed in the sequence listing, if considering a mutation having biologically equivalent activity. The term'substantial identity' means that the sequence of the present invention and any other sequence are aligned to correspond as much as possible, and when the aligned sequence is analyzed using an algorithm commonly used in the art, at least 60 % Homology, more specifically 70% homology, even more specifically 80% homology, and most specifically 90% homology.

The composition or kit of the present invention is characterized in that it further comprises a DNA polymerase, dNTPs, and a buffer as a reagent for performing an amplification reaction. For example, it may include an amplification reaction mixture consisting of DNA polymerase, dNTP (dATP, dCTP, dGTP, dTTP), reaction buffer, distilled water, etc., and add agarose and electrophoresis buffer to confirm whether or not the amplification product is detected. Can be included as. In addition, the composition or kit of the present invention may further include a user's manual describing the optimum reaction performance conditions, and may be manufactured as a plurality of separate packaging or compartments including the reagent components described above.

The present invention also provides a primer for amplifying the benA gene of Aspergillus spp., comprising the nucleic acid sequence of the benA gene including the nucleotide sequence of SEQ ID NO: 13, and the nucleotide sequence of SEQ ID NO: 1 and 2 set; A control probe for detecting the Ascomycetes benA gene consisting of the nucleotide sequence of SEQ ID NO: 3; And SEQ ID NOS: preparing a standard quantitative curve by reacting with a probe for detecting benA gene of Aspergillus spp. consisting of one or more nucleotide sequences selected from the group consisting of 4 to 7; And the benA gene amplification primer set and the benA gene detection probe of Aspergillus spp. contacted with a biological sample, and compared with a standard quantitation curve to determine the presence of Aspergillus spp. It relates to a method of providing information necessary for diagnosing aspergillosis, including the step of measuring.

The present invention also provides a primer for amplifying the benA gene of Aspergillus spp., comprising the nucleic acid sequence of the benA gene including the nucleotide sequence of SEQ ID NO: 13, and the nucleotide sequence of SEQ ID NO: 1 and 2 set; A control probe for detecting the Ascomycetes benA gene consisting of the nucleotide sequence of SEQ ID NO: 3; And SEQ ID NOS: preparing a standard quantitative curve by reacting with a probe for detecting benA gene of Aspergillus spp. consisting of one or more nucleotide sequences selected from the group consisting of 4 to 7; And the benA gene amplification primer set and the benA gene detection probe of Aspergillus spp. contacted with a biological sample, and compared with a standard quantitation curve to determine the presence of Aspergillus spp. It provides a method for diagnosing aspergillosis comprising the step of measuring.

The biological sample is any biological-derived sample capable of genetic analysis including nuclei and/or mitochondria derived from an individual, and may be a sample of cells, tissues, organs, body fluids, blood, and the like. In addition, the nucleic acid extracted from the biological sample is a nucleic acid including all or part of a target gene in which a genetic marker of an infectious bacteria to be detected is present, and may be DNA or RNA.

In the method of the present invention, the primer set and probe may be for real-time PCR.

The method of providing information necessary for diagnosing aspergillosis and the diagnosis method of the present invention will be described in detail step by step as follows.

The steps are Aspergillus species (Aspergillus spp.) To target the control nucleic acid sequence of benA genes, Aspergillus species (Aspergillus spp.) Primer sets, ascorbyl my three tests (Ascomycetes) for benA gene amplification of 1 A standard quantification curve is created through real-time PCR using a control probe for detecting benA gene and a probe for detecting benA gene of Aspergillus spp.

The control nucleic acid sequence may include the nucleotide sequence of SEQ ID NO: 13.

The second step is to target a biological sample, a primer set for amplifying the benA gene of Aspergillus spp., and a control probe for detection of Ascomycetes benA gene, and Aspergillus spp. .)'S benA gene detection probe was used to perform a real-time PCR reaction, and the presence of Aspergillus spp. was determined through sensitivity measurement and quantitative analysis by comparing it with the standard quantitative curve prepared above. It is to do.

The method and diagnostic method for providing information necessary for diagnosing aspergillosis of the present invention may further include a third step of determining an azole-resistant strain.

The identification of the azole-resistant strain is a primer set for amplifying the Cyp51A gene of Aspergillus tubingensis , a primer set for amplifying the Cyp51A gene of Aspergillus fumigatus , and Aspergillus tubing It is to measure the presence of azole-resistant Aspergillus fumigatus (Aspergillus fumigatus) strain by reacting a probe for detection of Cyp51A gene mutation of the gensis (Aspergillus tubingensis) strain with a biological sample.

According to an embodiment of the present invention, as a result of analyzing the difference between the susceptible strain and the resistant strain through melting curve analysis to molecularly diagnose azole-resistant Aspergillus fumigatus, the temperature of the melting peak is respectively There was a clear difference between 83℃ and 85.6℃.

Hereinafter, the present invention will be described in more detail through examples according to the present invention, but the scope of the present invention is not limited by the examples presented below.

<Example 1> Aspergillus (Aspergillus) analysis

In this example, the specificity was measured in 102 total clinical Aspergillus isolates and 129 environmental isolates, and 78 non-Aspergillus ascomycetes. I did.

The collected Aspergillus isolates were classified into subgenus, section, and species (including cryptic species) using molecular indicators, and as a result, the species belonging to Fumigati and Nigri were detected at high frequency in clinical and environmental isolates. In Fumigati (especially A. fumigatus ) and in the environment, the species belonging to the Nigri section were highly isolated.

As a result of examining the antifungal susceptibility of these isolates, antifungal susceptibility of Nigri strains was decreased in azole antifungals, and antifungal susceptibility was decreased in fungal species belonging to Flavi and Terrei section in amphotericin B antifungals. Aspergillus fumigatus (A. fumigatus) clinical environment separatist Cyp51A genetic variation, azole-resistant and look at the correlation between clinical data and genetic indicators of azole-resistant strains of the promoter insert TR34 than other genetic variations And L98H genetic mutations were closely related in domestic isolates.

Therefore, the biomarker of the fungal species through the benA gene was changed from the exon portion with high homology to the relatively low intron portion, and a biomarker was designed that targets Nigri, Fumigati, Flavi, etc.

Also, for species identification, Cyp51A Aspergillus fumigatus (A. fumigatus), Aspergillus tubingensis (Aspergillus tubingensis) biomarkers that are important clinically and highly related to azole-resistance were designed using genes. Each probe and primer for real-time PCR was designed to enable a multiplex reaction.

The control DNA template was designed to have the nucleotide sequence of each of the five benA genes, and was designed to enable quantitative analysis using standard curves in quantitative analysis as well as the control for qualitative analysis. This experiment was tested and analyzed on an LC-480 (roche) real-time PCR machine. Each sensitivity was 10 ^-1 genome copy and could be analyzed in association with the control group, and LOD and LOQ were measured through clinical strains (Table 3).

Figure 2 shows the sensitivity measurement and quantification curves of the benA gene control and genomic DNA.

Nucleic acid sequence (primer and/or probe set) of biomarkers designed for multiplex identification PCR Target species designation Sequence number Sequence (5'　→　3') Target gene Remark primer Aspergillus spp.
benA Forward direction benA F3 One TCGGTGTAGTGACCCTTGG benA The present invention
Reverse benA R2 2 GCTGGAGCGYATGAACGTCT A. tubingensis
cyp51A Forward direction Tubcyp_
1F46 8 CTCGTTGCGATAGTCTTKAATGT Cyp51A Reverse Tubcyp_
1R308 9 GCCCAAGTATACGGTKGTCTTTT A. fumigatus Forward direction TR F1 10 TAATCGCAGCACCACTTCAG Ref** Reverse TR R1 11 AGGGTGTATGGTATGCTGGAA The present invention Hydrolysis probe Section of Ascomycetes Asco_1F9 3 AVACGAAGTTGTCGGGRC benA The present invention Section of Fumigati Fumi_1R2 4 CGGCAACATCTCACGATCTGACTCGC Section of Nigri Nig_1R26 5 ACTTCAGCAGGCTAGCGGTAACAAGT Section of Flavi Flavi_1F18 6 CGGTCAGGAGTTGCAAAGCGTTTTCA Section of Terrei Terrei_1R29 7 ACCATCCTGGGACAGATTCTYCACGC A. tubingensis Tubcyp_201 12 GTCAGYC ^* ACTGTCC ^* ATATGC ^* GATTG Cyp51A The present invention ^* Site synthesized with LNA probe
** Morio F et al. Journal of Antimicrobial Chemotherapy 2012;67:1870-3.

sequence of benA control template (control gene composite) Oligo DNA sequence (5'→3') (SEQ ID NO: 13) Aspergillus species positive control (276bp) ATCGTAAGCTTTCGGTGTAGTGACCCTTGGCCCAGCCGAAGACGAAGTTGTCGGGACGGACGGTCAGGAGTTGCAAAGCGTTTTCAGCACGGACAACTCAGGGACGGTGTGATCTAACCTCATGGTACGCGTGGAGAATCTGTCCCAGGATGGTAGCGCCAGTAGGCATGCATGCGACCGCGAGCATGCATGCGAGCGA

LOD and LOQ of each benA biomarker from IA major Aspergillus species Probe name LOD LOQ Fumi_1R2 40 fg 400 fg Nigri 1R26 40 fg 400 fg Flavi 1F18 40 fg 400 fg Terrei 1R29 40 fg 400 fg LOD = limit of detection, LOQ = limit of quantification; R ² = correlation coefficient.

<Example 2> Analysis of azole-resistant Aspergillus strains

The difference between the susceptible and resistant strains was analyzed through melting curve analysis for molecular diagnosis of Azole-resistant Aspergillus fumigatus, and the melting peak temperatures were 83℃ and 85.6℃, respectively. The difference could be analyzed (Fig. 3).

<110> CATHOLIC UNIVERSITY INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> Biomarkers of benA and cyp51A gene for the molecular diagnosis of clinical Aspergillus and genetic synthetic control template for the qualitative and quantitative analysis <130> P19U11C1088 <160> 13 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> benA F3 forward primer of Aspergillus spp. benA <400> 1 tcggtgtagt gacccttgg 19 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> benA R2 reverse primer of Aspergillus spp. benA <400> 2 gctggagcgy atgaacgtct 20 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Asco_1F9 probe of Section of Ascomycetes benA <400> 3 avacgaagtt gtcgggrc 18 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Fumi_1R2 probe of Section of Fumigati benA <400> 4 cggcaacatc tcacgatctg actcgc 26 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Nig_1R26 probe of Section of Nigri benA <400> 5 acttcagcag gctagcggta acaagt 26 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Flavi_1F18 probe of Section of Flavi benA <400> 6 cggtcaggag ttgcaaagcg ttttca 26 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Terrei_1R29 probe of Section of Terrei benA <400> 7 accatcctgg gacagattct ycacgc 26 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Tubcyp_1F46 forward primer of A. tubingensis Cyp51A <400> 8 ctcgttgcga tagtcttkaa tgt 23 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Tubcyp_1R308 reverse primer of A. tubingensis Cyp51A <400> 9 gcccaagtat acggtkgtct ttt 23 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TR F1 forward primer of A. fumigatus Cyp51A <400> 10 taatcgcagc accacttcag 20 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TR R1 reverse primer of A. fumigatus Cyp51A <400> 11 agggtgtatg gtatgctgga a 21 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Tubcyp_201 probe of A. tubingensis Cyp51A <400> 12 gtcagycact gtccatatgc gattg 25 <210> 13 <211> 276 <212> DNA <213> Artificial Sequence <220> <223> Aspergillus benA positive control <400> 13 atcgtaagct ttcggtgtag tgacccttgg cccagccgaa gacgaagttg tcgggacgga 60 cggtcaggag ttgcaaagcg ttttcagcac ggacaactca gggacggtgt gatctaacct 120 catggtacgc gtggagaatc tgtcccagga tggtagaacg gcacgaggta gcgagtcaga 180 tcgtgagatg ttgccgaaat agtataaatc aagagacttg ttaccgctag cctgctgaag 240 taaatagacg ttcatgcgct ccagcgagct catcgt 276

Claims (9)

The nucleic acid sequence of the benA gene comprising the nucleotide sequence of SEQ ID NO: 13;
A primer set for amplifying the benA gene of Aspergillus spp. consisting of the nucleotide sequences of SEQ ID NO: 1 and 2;
A control probe for detecting the Ascomycetes benA gene consisting of the nucleotide sequence of SEQ ID NO: 3; And
Including a probe set for detection of the benA gene of Aspergillus spp. consisting of SEQ ID NOS: 4 to 7,
The probe set for detecting the benA gene of the Aspergillus spp. is Aspergillus fumigatus (A. fumigatus ), Aspergillus niger (A. niger ), Aspergillus flaverse. ( A. flavus ) and Aspergillus terreus (A. terreus ) that is for detecting, aspergillosis (aspergillosis) diagnostic composition.
delete The method of claim 1, wherein the composition is
A primer set for amplifying the Cyp51A gene of Aspergillus tubingensis consisting of the nucleotide sequences of SEQ ID NO: 8 and 9 and Aspergillus fumigatus consisting of the nucleotide sequences of SEQ ID NO: 10 and 11 ( Aspergillus fumigatus ) Cyp51A gene amplification primer set; And
A composition for diagnosing Aspergillosis further comprising a probe for detecting Cyp51A gene mutations of Aspergillus tubingensis strain consisting of the nucleotide sequence of SEQ ID NO: 12.
The method of claim 3,
The composition is for determining azole resistance, a composition for diagnosing aspergillosis.
The method according to claim 1 or 3,
Primers and probes for real-time PCR, a composition for diagnosing aspergillosis.
The nucleic acid sequence of the benA gene comprising the nucleotide sequence of SEQ ID NO: 13;
A primer set for amplifying the benA gene of Aspergillus spp. consisting of the nucleotide sequences of SEQ ID NO: 1 and 2;
A control probe for detecting the Ascomycetes benA gene consisting of the nucleotide sequence of SEQ ID NO: 3; And
Including a probe set for detection of the benA gene of Aspergillus spp. consisting of SEQ ID NOS: 4 to 7,
The probe set for detecting the benA gene of the Aspergillus spp. is Aspergillus fumigatus (A. fumigatus ), Aspergillus niger (A. niger ), Aspergillus flaverse. ( A. flavus ) and Aspergillus terreus (A. terreus ) to detect, Aspergillosis (aspergillosis) diagnostic kit.
The method of claim 6,
A primer set for amplifying the Cyp51A gene of Aspergillus tubingensis consisting of the nucleotide sequences of SEQ ID NO: 8 and 9 and Aspergillus fumigatus consisting of the nucleotide sequences of SEQ ID NO: 10 and 11 ( Aspergillus fumigatus ) Cyp51A gene amplification primer set; And
Aspergillus tubingensis consisting of the nucleotide sequence of SEQ ID NO: 12 (Aspergillus tubingensis) further comprising a probe for detecting Cyp51A gene mutation of the strain, Aspergillosis (aspergillosis) diagnostic kit.
A primer set for amplifying the benA gene of Aspergillus spp. consisting of the nucleic acid sequence of the benA gene including the nucleotide sequence of SEQ ID NO: 13, and the nucleotide sequence of SEQ ID NO: 1 and 2; A control probe for detecting the Ascomycetes benA gene consisting of the nucleotide sequence of SEQ ID NO: 3; And preparing a standard quantitative curve by reacting with a probe set for detecting benA gene of Aspergillus spp. consisting of SEQ ID NOS: 4 to 7; And
The benA gene amplification primer set and the benA gene detection probe set of Aspergillus spp. were contacted with a biological sample and compared with a standard quantitation curve to determine the presence of Aspergillus spp. Including the step of measuring,
The probe set for detecting the benA gene of the Aspergillus spp. is Aspergillus fumigatus (A. fumigatus ), Aspergillus niger (A. niger ), Aspergillus flaverse. ( A. flavus ) and Aspergillus terreus (A. terreus ) to detect, aspergillosis (aspergillosis) method for providing information necessary for diagnosis.
The method of claim 8,
A primer set for amplifying the Cyp51A gene of Aspergillus tubingensis consisting of the nucleotide sequences of SEQ ID NO: 8 and 9 and Aspergillus fumigatus consisting of the nucleotide sequences of SEQ ID NO: 10 and 11 ( Aspergillus fumigatus ) Cyp51A gene amplification primer set; And a probe for detecting Cyp51A gene mutation of the Aspergillus tubingensis strain consisting of the nucleotide sequence of SEQ ID NO: 12,
The method further comprising the step of determining the presence of an azole resistant Aspergillus fumigatus strain by contacting the biological sample.

Images