KR102223933B1 - A composition for improving memory and cognitive function comprising complex processed ginseng berry extract as an active ingredient - Google Patents

Abstract

The present invention provides a composition for improving memory and cognitive ability containing a complex processed and fermented extract of ginseng berries as an active component, which has an excellent effect of improving memory and cognitive ability by improving the content of active components such as ginsenoside and improving intestinal absorption through a steaming and fermentation process.

Description

A composition for improving memory and cognitive function comprising complex processed ginseng berry extract as an active ingredient}

The present invention relates to a composition for improving memory and cognitive ability, and more particularly, to a composition for improving memory and cognitive ability, containing a complex process extract of ginseng fruit as an active ingredient.

Ginseng (ginseng) is a well-known medicinal material, and in particular, saponin (ginsenoside) component acts on the central nervous system, immune system, and metabolic system of the human body, and has been proven to have various effects in regulating body functions. However, despite the pharmacological effect of ginseng saponin, it is a factor that makes it very difficult to absorb in the intestine because it forms a glycoside in which sugars are bound to the non-sugar part (quaternary ring or 5 ring shape) chemically. Therefore, when absorbed into the body, it is decomposed by the human intestinal flora and then absorbed.However, the intestinal microbes that decompose ginseng saponin depend on the presence or absence of ginseng saponin and the level of the ginseng saponin depending on the human constitution and eating habits. Due to the difference, non-glycosylation is required through a fermentation process by biocompatible bacteria in order to exclude the difference in the intestinal absorption rate of ginseng saponin.

On the other hand, through a recent study, it has been reported that a greater amount of ginsenoside is present in ginseng fruit than in ginseng root, and it has been reported that a specific ginsenoside (Re, etc.) is contained dozens of times more. According to Bonchogangmok Wet Oil (本草綱目拾遺), ginseng fruit (medicinal name: ginsengja) is like a kidney, and the raw one is blue, turns red when ripe, and resembles a small yellow bean. It is stated that if ginseng fruit is added to the medicine, there will be no ring of both towers (itch) in the future. In addition, according to data from the Chinese National Medicines Administration, ginseng fruit is known to have the effect of rejuvenating, strengthening the body, and delaying aging, and is generally known to be major in physical weakness and lack of energy, dizziness and insomnia, chest compressions and shortness of breath. . However, the harvest period of ginseng fruit is short and mature fruits can be obtained only during a specific growth period (4 years or more). It is a low situation. In this regard, Japanese Patent Application Laid-Open No. 2017-0019399 discloses a composition for treating neurodegenerative disorders containing a ginseng fruit extract.

However, in the case of the prior art, since the ginseng fruit extract does not include a fermentation process, there is a disadvantage in that the absorption capacity in the intestine is poor.

The present invention is to solve a number of problems including the above problems, and the content of active ingredients such as ginsenosides is increased through a fermentation process when preparing ginseng fruit extract after amplification of immature ginseng fruit and ginseng fruit with improved intestinal absorption. It is an object of the present invention to provide a composition for improving memory and cognitive ability, containing the extract of the complex process as an active ingredient. However, these problems are exemplary, and the scope of the present invention is not limited thereby.

According to one aspect of the present invention, there is provided a pharmaceutical composition for improving memory and cognition, comprising a mixture of Jeungpo ginseng fruit extract and fermented Jeungpo Ginseng fruit extract fermented with lactic acid bacteria as an active ingredient.

According to another aspect of the present invention, there is provided a pharmaceutical composition for the treatment of Alzheimer's disease, comprising a mixture of Jeungpo ginseng fruit extract and fermented Jeungpo ginseng fruit extract fermented with lactic acid bacteria as an active ingredient.

According to another aspect of the present invention, there is provided a health functional food for improving memory and cognition, comprising a mixture of Jeungpo ginseng fruit extract and fermented Jeungpo Ginseng fruit extract fermented with lactic acid bacteria as an active ingredient.

According to another aspect of the present invention, the steps of preparing a first enlarged ginseng fruit by increasing the immature ginseng fruit 3 to 5 times; Preparing a second enlarged ginseng fruit by increasing the immature ginseng fruit 6 to 8 times; Mixing the first evaporated ginseng fruit and the second evaporated ginseng fruit in equal amounts and then extracting with water, a lower alcohol of C1 to C4 or an aqueous solution of the lower alcohol to prepare an extract of enlarged ginseng fruit; Fermenting by inoculating lactic acid bacteria into the Jeungpo ginseng fruit extract; Filtering the fermented extract, concentrated under reduced pressure, and freeze-dried to prepare a fermented enhanced ginseng fruit extract; And there is provided a method for preparing a mixture of the Jeungpo ginseng fruit extract and the fermented Jeungpo ginseng fruit extract obtained by fermenting the Jeungpo Ginseng fruit extract with lactic acid bacteria, comprising the step of mixing the Jeungpo Ginseng fruit extract and the fermented Jeungpo Ginseng fruit extract.

The composition for improving memory and cognitive ability containing the complex process extract of the enlarged ginseng fruit of the present invention made as described above increases the content of active ingredients such as ginsenoside through the enlargement and fermentation process and also improves intestinal absorption. As it is excellent in improving memory and cognitive ability, it can be used as a health functional food material for preventing and improving learning and cognitive disorders. Of course, the scope of the present invention is not limited by these effects.

1 is a graph showing the results of HPLC analysis of 6 types of ginsenosides for a raw material derived from ginseng fruit obtained through the final process of the present invention.
Figure 2 is a schematic diagram schematically showing the final process of the laboratory scale (Lab. scale) for securing FSGC (Ginseng Fruit Fermented Powder), which is a test substance derived from enhanced ginseng fruit.
3 shows the HPLC analysis results of 6 types of ginsenosides before and after fermentation of the Jeungpo ginseng fruit extract obtained through the final process applying a plant scale. A) is a graph before fermentation, and b) is a fermentation. After that is the graph.
4 is a schematic diagram schematically showing the final process applying a plant scale to secure FSGC (Ginseng Fruit Fermented Powder), which is a test substance derived from enhanced ginseng fruit.
5 is a graph showing the results of HPLC analysis of 6 types of ginsenosides, which are index components contained in the final raw material.
6 is a graph analyzing the effect of inhibiting acetylcholinergic enzyme (AChE) activity by FSGC treatment of the present invention (●, vehicle; ○, FSGC 0.01 μg/mL; ▼, FSGC 0.1 μg/mL; △, FSGC 1 μg/mL; ■, FSGC 10 μg/mL).
7 is a graph analyzing the level of inhibition of cell activity according to the treatment of FSGC according to the concentration of the present invention.
8 is a graph showing cytotoxicity analysis after treatment with Aβ1-42 (7 μM) and FSGC of the present invention (0.1-500 μg/mL) in F3.ChAT human neural stem cell line (*P<0.05).
9 is a graph showing cytotoxicity analysis after treatment with Aβ1-42 (15 μM) and FSGC of the present invention (0.1-50 μg/mL) in F3.ChAT human neural stem cell line (*P<0.05).
10 is an analysis of the effect of regulating gene expression, A) is a graph analyzing the expression level of ChAT mRNA according to the concentration-specific treatment of FSGC of the present invention, and B) is the main ginsenosides (Re, Rd and Rg3) contained in FSGC. ) This is a graph analyzing the expression level of ChAT mRNA during treatment. Results are expressed as the mean±standard deviation from 3 individual experiments. * p <0.05; ** p <0.01 vs. control.
11 is a graph analyzing the results of the passive avoidance test according to FSGC treatment using dementia-induced mice (●, normal; ○, Aβ _1-42 alone; ▼, FSGC 100 mg/kg; △, FSGC 300 mg/kg ; ■, FSGC 500 mg/kg; □, epigallocatechin gallate (EGCG) 100 mg/kg (*, P<0.05. #,P<0.05).
12 is a graph analyzing the results of the aquatic rice test according to FSGC treatment using dementia-induced mice (●, normal; ○, Aβ _1-42 alone; ▼, FSGC 100 mg/kg; △, FSGC 300 mg/kg ; ■, FSGC 500 mg/kg; □, epigallocatechin gallate (EGCG) 100 mg/kg.(*, P<0.05. #,P<0.05).
13 is a graph showing an analysis of the acetylcholine content in brain tissue after treatment of the FSGC of the present invention by concentration in dementia-induced mice (*, P <0.05;#, P <0.05).
14 is a photograph of immunofluorescence staining in which dementia-induced mice were treated with the FSGC of the present invention by concentration and then observed the Aβ removal effect (Scale bar=100 μm).
15 is an immunofluorescence staining photograph of observing astrocytes expressing the expression of glial fibrous nitrate protein after treatment with the FSGC of the present invention by concentration in dementia-induced mice (Scale bar = 100 μm).
FIG. 16 is a graph showing the analysis of the number of astrocytes expressing the expression of glial fibrous nitrate protein after treatment with the FSGC of the present invention by concentration in dementia-induced mice (*, P<0.05. #,P<0.05).

Definition of Terms:

The "ginseng berry" used in this document is also called a ginseng berry, and is a fruit that is found in ginseng aged 4 years or older. In ginseng fruit, ginseng fruit must be grown for at least 3 years to produce ginseng fruit, and it is usually possible to collect fruit from 4 years old. Ginseng fruit contains about 20% of the total ginsenosides in ginseng, while the roots are known to contain only about 6%. In particular, Re shows a difference of about 30-40 times the content of vitamins, Minerang and polyphenols are also contained in relatively large amounts in ginseng fruit.

The term "saponins" used in this document is a glycoside of steroids, steroid alkaloids, or triterpene, and is a generic term for substances that dissolve in water and exhibit the foaming action of soap. It is present in various plants, and is also contained in the body of some echinoderm (starfish, sea cucumber). Saponin is known as a component that enhances the human body's immunity. In particular, it is known that ginsenoside and eleutheroside, the types of saponins contained in ginseng, are famous, and there are various types of saponins in green tea.

Detailed description of the invention:

According to one aspect of the present invention, there is provided a pharmaceutical composition for improving memory and cognition, comprising a mixture of Jeungpo ginseng fruit extract and fermented Jeungpo Ginseng fruit extract fermented with lactic acid bacteria as an active ingredient.

In the pharmaceutical composition, the lactic acid bacteria may be Lactobacillus plantarum , and the ginseng fruit may be an immature ginseng fruit.

In the pharmaceutical composition, the step of preparing a first enlarged ginseng fruit by evaporating the immature ginseng fruit 3 to 5 times in the enlarged ginseng fruit extract; Preparing a second enlarged ginseng fruit by increasing the immature ginseng fruit 6 to 8 times; Mixing the first evaporated ginseng fruit and the second evaporated ginseng fruit in equal amounts and then extracting with water, a lower alcohol of C1 to C4 or an aqueous solution of the lower alcohol; And after filtering the extracted extract can be prepared through the step of concentrating under reduced pressure and freeze-drying.

In the pharmaceutical composition, the fermentation of the fermented Jeungpo ginseng fruit extract is fermented by inoculating lactic acid bacteria in the Jeungpo Ginseng fruit extract; And it can be prepared through the step of drying the fermented jeungpo ginseng fruit extract. At this time, the lactic acid bacteria may be Lactobacillus plantarum.

According to another aspect of the present invention, there is provided a pharmaceutical composition for the treatment of Alzheimer's disease, comprising a mixture of Jeungpo ginseng fruit extract and fermented Jeungpo ginseng fruit extract fermented with lactic acid bacteria as an active ingredient.

In the pharmaceutical composition, the lactic acid bacteria may be Lactobacillus plantarum , and the ginseng fruit may be an immature ginseng fruit.

In the pharmaceutical composition, the step of preparing a first enlarged ginseng fruit by evaporating the immature ginseng fruit 3 to 5 times in the enlarged ginseng fruit extract; Preparing a second enlarged ginseng fruit by increasing the immature ginseng fruit 6 to 8 times; Mixing the first evaporated ginseng fruit and the second evaporated ginseng fruit in equal amounts and then extracting with water, a lower alcohol of C1 to C4 or an aqueous solution of the lower alcohol; And after filtering the extracted extract can be prepared through the step of concentrating under reduced pressure and freeze-drying.

In the pharmaceutical composition, the fermentation of the fermented Jeungpo ginseng fruit extract is fermented by inoculating lactic acid bacteria in the Jeungpo Ginseng fruit extract; And it can be prepared through the step of drying the fermented jeungpo ginseng fruit extract. At this time, the lactic acid bacteria may be Lactobacillus plantarum.

According to another aspect of the present invention, there is provided a health functional food for improving memory and cognition, comprising a mixture of Jeungpo ginseng fruit extract and fermented Jeungpo Ginseng fruit extract fermented with lactic acid bacteria as an active ingredient.

In the health functional food, it may be provided in the form of a bath, a drink, a powder, a pill, a capsule, a tablet, or a jelly.

According to another aspect of the present invention, the steps of preparing a first enlarged ginseng fruit by increasing the immature ginseng fruit 3 to 5 times; Preparing a second enlarged ginseng fruit by increasing the immature ginseng fruit 6 to 8 times; Mixing the first evaporated ginseng fruit and the second evaporated ginseng fruit in equal amounts and then extracting with water, a lower alcohol of C1 to C4 or an aqueous solution of the lower alcohol to prepare an extract of enlarged ginseng fruit; Fermenting by inoculating lactic acid bacteria into the Jeungpo ginseng fruit extract; Filtering the fermented extract, concentrated under reduced pressure, and freeze-dried to prepare a fermented enhanced ginseng fruit extract; And there is provided a method for preparing a mixture of the Jeungpo ginseng fruit extract and the fermented Jeungpo ginseng fruit extract obtained by fermenting the Jeungpo Ginseng fruit extract with lactic acid bacteria, comprising the step of mixing the Jeungpo Ginseng fruit extract and the fermented Jeungpo Ginseng fruit extract.

As used in the present invention, "extract" refers to a material extracted from a raw material by any method, and is used to include all of the extracted extract, the concentrate obtainable therefrom, the dried product and powder of the concentrate without limitation. .

When the extract is obtained by extracting from the raw material, all conventionally known extraction methods such as solvent extraction method, ultrasonic extraction method, filtration method and reflux extraction method can be used as the extraction method, and it is preferably prepared by using a solvent extraction method or a reflux extraction method. can do. The extraction process may be repeated several times, and thereafter may be additionally subjected to steps such as concentration or freeze-drying. Specifically, the obtained extract is concentrated under reduced pressure to obtain a concentrate, the concentrate is freeze-dried, and then a high-concentration extract powder can be prepared using a grinder.

At least one of water and ethanol may be used as a solvent used in preparing the ginseng fruit extract. The ethanol may be ethanol or an aqueous ethanol solution, and the ethanol aqueous solution may be an aqueous ethanol solution of 40% (v/v) or more to less than 100% (v/v), preferably 45% (v/v) to It may be a 90% (v/v) aqueous ethanol solution, more preferably 50% (v/v) to 80% (v/v) ethanol aqueous solution, and even more preferably 60% (v/v) It may be an aqueous ethanol solution of v) to 80% (v/v), but is not limited thereto. If the concentration of the ethanol aqueous solution is less than the lower limit, the effect of improving the memory of the fraction may decrease even after fractionation after extraction.

In addition to the fraction of the ginseng fruit extract, the pharmaceutical composition of the present invention further contains other ingredients that can give a synergistic effect to the effect of the fraction of the ginseng fruit extract within a range that does not impair the intended effect of the present invention. It may contain. Conventional auxiliaries or carriers such as, for example, antioxidants, stabilizers, solubilizers, vitamins, pigments and flavors may be included.

The route of administration of the pharmaceutical composition includes oral, intravenous, intramuscular, intraarterial, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, sublingual or rectal, such as topical application by application. The parenteral can be applied in a manner that includes subcutaneous, intradermal, intravenous, intramuscular, intralesional injection or infusion techniques.

The pharmaceutical composition of the present invention can be administered in a pharmaceutically effective amount.

In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the type and severity of the individual, age, sex, type of disease, It can be determined according to the activity of the drug, its sensitivity to the drug, the time of administration, the route of administration and the rate of excretion, the duration of treatment, factors including drugs used concurrently, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or administered in combination with other therapeutic agents, and may be administered sequentially or simultaneously with a conventional therapeutic agent. And can be single or multiple doses. It is important to administer an amount capable of obtaining the maximum effect in a minimum amount without side effects in consideration of all of the above factors, and can be easily determined by a person skilled in the art.

The pharmaceutical composition of the present invention is not particularly limited as long as it is an individual for the purpose of improving learning disability, cognitive impairment, and memory impairment, and any one can be applied. For example, non-human animals such as monkeys, dogs, cats, rabbits, mormons, rats, mice, cows, sheep, pigs, goats, humans, birds and fish can be used.

The pharmaceutical composition may further contain one or more active ingredients exhibiting the same or similar functions in the fraction of the ginseng fruit extract. Each of the compositions may be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, etc., external preparations, suppositories, and sterile injectable solutions according to a conventional method.

Solid preparations for oral administration include powders, granules, tablets, capsules, soft capsules, pills, and the like. Liquid preparations for oral administration include suspensions, liquid solutions, emulsions, syrups, etc.In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. have. Formulations for parenteral administration include powders, granules, tablets, capsules, sterilized aqueous solutions, solutions, non-aqueous solutions, suspensions, emulsions, syrups, suppositories, aerosols, etc. Formulated in a form and used, preferably, a pharmaceutical composition for external use of the skin of cream, gel, patch, spray, ointment, warning agent, lotion, liniment, pasta, or cataplasma may be prepared and used. , But is not limited thereto. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, and the like may be used.

The composition may further contain an adjuvant such as a preservative, a stabilizer, a hydrating agent or an emulsification accelerator, a salt and/or a buffer for controlling the osmotic pressure, and other therapeutically useful substances. It can be formulated according to the coating method.

The dosage of the pharmaceutical composition may vary according to various factors including the individual's age, weight, general health, sex, administration time, route of administration, excretion rate, drug formulation, and the severity of a specific disease. In addition, the pharmaceutical composition of the present invention may be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, and methods using biological response modifiers. In addition, the pharmaceutical composition may be administered at a dosage within the range of 0.001 to 2500 mg/kg on an adult basis, and when the pharmaceutical composition is for external use, once a day in an amount of 1.0 to 3.0 ml on an adult basis. It is recommended to apply once and continue for at least 1 month, but the dosage is not intended to limit the scope of the present invention.

When formulating the pharmaceutical composition in a unit dosage form, the fraction of the ginseng fruit extract of the present invention as an active ingredient is preferably contained in a unit dose of about (0.01 to 1,500) mg, and the dosage required for adult treatment is Depending on the frequency and intensity of administration, the range of about (1 to 500) mg per day is usually but not limited thereto, and a higher daily dose may be desirable for some patients.

Ginseng berry is known as an antioxidant food containing higher nutrients than ginseng root, which matures from 4 years after cultivation of ginseng. It was found to have a better efficacy. Even though ginseng fruit is being re-examined, farmhouses remove the fruit to concentrate nutrients to the roots unless it is seeding the fruit for sowing. Therefore, its utilization as a natural material was low. Therefore, the present inventors improved memory and cognitive ability by mixing the same amount of the extract extracted with ethanol and the fermented product fermented with the ethanol extract after the increase of the ginseng fruit, which was mainly the object of disposal until now, and the content of active ingredients and absorption in the intestine were also improved. A composition for improving memory and cognitive ability was developed that contains a complex fermented extract of ginseng fruit with excellent effect as an active ingredient.

Hereinafter, the present invention will be described in more detail through examples. However, the present invention is not limited to the embodiments disclosed below, but may be implemented in various different forms, and the following embodiments are intended to complete the disclosure of the present invention, and the scope of the invention to those of ordinary skill in the art. It is provided to fully inform you.

General method

Material and sample preparation

The ginseng fruit, which is a sample of the present invention, was harvested from ginseng for more than 4 years in Ginseng cultivation in Yeoncheon-gun, Gyeonggi-do, and was washed, dried, and augmented (4 bags for 4 bags, 7 bags for 7 bags) as a starting material. In early June, only hard green fruits were collected before the seeds in the pulp were healed. In order to secure test raw materials, 4 Jeungpo ginseng fruits and 7 Jeungpo ginseng fruits were mixed in equal amounts, and then immersed in 10 times the capacity of 50% fermented alcohol (Daehan Ethanol Life, Seoul, Korea) and extracted twice at room temperature. The extract was filtered through filter paper (Hyundai micro No. 20, Hyundai micro, Seoul, Korea), then concentrated under reduced pressure and freeze-dried to obtain a non-fermented dried sample (yield 32.9%). The non-fermented extract extracted and concentrated under reduced pressure in the same manner as above was diluted to 4 brix with distilled water, and Lactobacillus plantarum was inoculated (1×10 ⁷ CFU/mL), followed by fermentation for 48 hours in a 30 incubator to ferment dry sample. (Yield 31.6%) was obtained, and a 1:1 mixture FSGC (Fermented and Steam-dried Ginsengberry Compound)) was obtained by mixing a non-fermented dry sample and a fermented dry sample at a weight ratio of 1:1.

As a comparative substance of the present invention, it is a component that has been proven effective in improving cognition and memory in various studies (Cascella et al., infect. Agent Cancer . 19: 12:36, 2017) as a raw material for improving memory by the Ministry of Food and Drug Safety. Certified epigallocatechine gallate (EGCG) was used.

HPLC

The HPLC analysis of the present invention was performed according to the method standardized in previous studies (Jang et al., Korean J. Food Sci. Technol. 49: 676-684. 2017). Specifically, HPLC (UltiMate 3000 HPLC system, Thermo Fisher Scientific, MA, USA) was used for ginsenoside analysis, and water (A) and acetonitrile (B) (HPLC grade, Thermo Fisher Scientific) were used as mobile phases. The flow rate was 1.6 mL/min and detected at 203 nm. In addition, the column used in the analysis was measured by setting the temperature to 30°C with a YMCTriart C18 column (250×4.6 mm, S-5 μm, 12 nm, YMC, Tokyo, Japan), and 10 μL of a sample was injected. The conditions of the mobile phase are those specified in the National Institute of Technology and Standards (ginseng and ginseng products-measurement of ginsenoside content-high performance liquid chromatography, standard number KS H 2153), starting with 80% A and starting from 0 to 10 minutes (80% A). , 20% B), 10-40 minutes (80-68% A, 20-32% B), 40-55 minutes (68-50% A, 32-50% B), 55-70 minutes (50-35 % A, 50-65% B), 70-72 min (35-10% A, 65-90% B), 72-82 min (10% A, 90% B), 82-84 min (10-80 % A, 90-20% B), 84-90 min (80% A, 20% B) were used. Subsequently, 14 ginsenoside standards were purchased and used from Biopurify (Chengdu, China), and a measurement curve was prepared by serial dilution from 2,000 μg/mL, through which qualitative and quantitative analysis was performed.

Cell viability analysis

To measure the cell activity according to the sample concentration, seeding N2a cells in a 96-well plate at 6.0 × 10 ⁵ cells/well, incubating overnight and stabilizing them, and then replacing the medium with 100 µl of serum-free medium. With each concentration sample and a positive control H ₂ O ₂ were treated and incubated for 24 hours. After the reaction was terminated, 1/10 volume of a sterilized ez-cytox (EZ-CYTOX, Daeilbio, Korea) solution was added to each test well to measure the cell viability, and then reacted in an incubator at 37° C. for 2 hours. Absorbance was measured using an ELISA reader (SpectraMax plus384, Molecular Devices, CA, USA) at 450 nm wavelength.

Cytotoxicity test

For cytotoxicity test, human neural stem cells (F3.ChAT) were aliquoted into a 96-well plate at 5 x 10 ⁴ cells per well and cultured. Culture medium is 10% fetal bovine serum (FBS, #S1520, Biowest, Nuaille, France) and 1% antibiotic-antimycotic x100 (penicillin 10,000 U/mL, streptomycin 10 mg/mL, and amphotericin B 25 DMEM (#L0103-500, Biowest) containing μg/mL; #15240062, Thermo Fisher Scientific, MA, USA) was used to incubate at _{37° C. and 5% CO 2.} Thereafter, to evaluate the cytotoxicity of the test substance, after 24 hours of culture, the medium was replaced with a medium containing no FBS, _{and cells were treated with Aβ 1-42} with 7 μM as a positive control, and the experimental group was FSGC (0.1, 1, 10, 50, 100 or 500 μg/mL) alone was treated for 24 hours. Then, cell counting kit-8 (CCK-8; #KU652, Dojindo, Rockville, USA) solution was added at a rate of 10 μL per well, incubated for 4 hours, and absorbance was measured at 570 nm/450 nm with an ELISA reader. . As for the measured value, the solvent control value was set to 100%, and cell viability was compared and analyzed.

Cell protective effect evaluation

In order to induce the aggregation of Aβ for dementia induction, Aβ _1-42 (#ab120301, Abcam, Cambrige, UK) in a monomeric state was dissolved in PBS at a concentration of 1 mg/mL and then at 37°C for 7 days. aging was induced. The positive control group was _{treated with Aβ 1-42} alone to the cells with 15 μM, and the experimental group FSGC was additionally treated at concentrations of 0.1, 1, 5, 10, and 50 μg/mL, respectively, and CCK-8 was used after 24 hours of treatment. Cell viability was measured.

qPCR (quantitative real time polymerase chain reaction)

For gene expression analysis, total RNA was extracted from cells and tissues using Trizol Reagent (Life Technologies, Carlsbad, CA, USA). That is, 1 mL of Trizol solution was added to lyse the cells, allowed to stand at room temperature for 5 minutes, 200 μL of chloroform was added, and centrifuged at 13500 rpm for 15 minutes. A clear supernatant (500 μL) was taken, transferred to a new tube, and the same amount of isopropyl alcohol was added, followed by centrifugation at 13500 rpm for 10 minutes to precipitate RNA. The RNA precipitate was washed with 0.75 mL of 70% ethanol diluted with diethyl pyrocarbonate (DEPC, Sigma-Aldrich) treated distilled water, and then dried in air to use as a reverse transcription sample. First strand cDNA synthesis was performed using 1 μg of extracted total RNA, and reverse transcription reaction was performed using Improm-II reverse transcription system (Promega) and oligo dT primer. For qPCR analysis, Rotor-Gene 6000 (Qiagen, Venlo, Netherlands) was used, and the expression of the ChAT gene was quantitatively measured using the primers shown in Table 1 below, and the relative normalized to Glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The values were compared and analyzed. Information on the primers used in the PCR analysis is summarized in Table 1 below.

Primer nucleic acid sequence information primer Nucleic acid sequence (5' --> 3') size Access number Sequence number hChAT F GTGGCTCAGAACAGCAGCAT 274 bp NM_020984 One hChAT R CAATCATGTCCAGCGAGTCC 2 hGAPDH F GGAGCCAAAAGGGTCATCAT 203 bp AK_026525 3 hGAPDH R GTGATGGCATGGACTGTGGT 4

Experimental animals

Experimental animals were supplied with 6-week-old male ICR mice from Daehan Biolink and used after undergoing acclimatization for about 1 week. The environment of the animal laboratory was controlled at a temperature of 23±2℃, a relative humidity of 55±10%, a ventilation frequency of 12 times/hour, a lighting cycle of 12 hours, and an illuminance of 150-300 Lux. In addition, the Harlan 2018S rodent diet, a pellet-type solid feed for experimental animals, was supplied, and sterilized purified water was freely ingested for drinking water. All experiments performed in the present invention were performed in accordance with the institution's Standard Operation Procedures (SOP) under the approval of the Institutional Animal Care and Use Committee (IACUC) of the Laboratory Animal Research Support Center of Chungbuk National University. .

Dementia-causing animal model

To establish a dementia-causing animal model, a 7-week-old mouse (n=8/group) was orally administered FSGC (100, 300, or 500 mg/kg), an indicator of the present invention, daily for 3 weeks, and the comparative substance was EGCG ( epigallocatechin gallate, 100 mg/kg) was administered. After the last administration of the indicator substance, the mouse was anesthetized by inhalation with ether and then fixed on a stereotaxic frame (Stoelting, Wood daled, IL, USA), and Aβ _1-42 (5 μL, 5 mg/mL)/head in the ventricle. (AP: -2.0, ML: 2.9, DV: -3.0 mm) was administered to induce dementia.

Passive avoidance test

In the passive evasion test (model ENV-010MD; Med Associates, Albans, VT, USA), the animal is placed in a bright room of a passive evacuation box divided into a dark room and a light room, and when the animal moves to a dark room, electricity is performed at 1 mA for 2 seconds. Impact. After that, in the same test, the memory is evaluated by measuring the time the animal stays in the bright room in order to check the memory caused by the electric shock in the dark room. For the evaluation of learning and memory ability _{, 48 hours after administration of Aβ 1-42} , 6 times were performed at 20 minute intervals, and the electrical stimulation in the dark room was memorized in the Suttle box, and the time spent in a bright room for a certain period of time (180 seconds) or longer was measured and learned. And memory was evaluated.

Water maze test

The underwater maze test is a representative experiment that evaluates the effect of improving spatial perception. It measures the time it takes for the experimental animal to go to the platform located at a certain place in the tank by memorizing the markers around the tank. If it is not found, it is allowed to stay on the platform for 30 seconds to induce memory. In the present invention, for the evaluation of spatial perception ability, the improvement of cognitive function was evaluated as a phenomenon in which 48 hours after the induction of dementia in mice, the time to settle on the hidden platform by repetitive swimming daily using an underwater maze is shortened.

Measurement of ACh concentration in brain tissue

After the test was conducted on the dementia-causing animal model, an autopsy was performed to measure the concentration of acetylcholine (ACh), a neurotransmitter in brain tissue. After 24 hours of the last behavioral test, autopsy was performed and brain tissue was sufficiently perfused with cold saline to extract brain tissue, and then frozen and stored in liquid nitrogen at -80°C to minimize degeneration. After measuring the weight of the extracted brain tissue, 10 times the volume of low-temperature PBS was added, and a homogenate was prepared using a homogenizer. Amplex Red acetylcholine/acetylcholine hydrolase assay kit (Invitrogen, Carlsbad , CA, USA).

Immunofluorescence (IF)

Immunofluorescence staining was performed to confirm the accumulation of Aβ in the hippocampal CA1 region responsible for memory and the entire brain in a frozen tissue slide made to confirm the distribution of Aβ in the brain. When the confirmation was not clear, brain tissue that had been stored frozen was used. In addition, in order to quantitatively analyze Aβ, after measuring the weight of brain tissue, a 10-fold volume of low-temperature PBS was added, and the homogenate was prepared at 450 nm with an ELISA reader using an Aβ1-42 ELISA kit (IBL, Fujioka, Japan). The absorbance was measured.

Example 1: Final process establishment and component analysis

Through prior research, the inventors of the present invention have demonstrated that Rg3, a material after biotransformation, as well as Re and Rd, which have been found to have significant effects on the function as an indicator (function) material of a health functional food raw material for improving cognitive and memory using ginseng fruit. And Rg5 were selected.

As a result of establishing the final process, a large amount of ginsenosides including high content of Re and Rd were secured before fermentation, and as Rg3 and Rg5 increased after fermentation by a biocompatible strain, the absorption of the active substance in the body was expected to increase. In addition, Rg3 is known to effectively remove amyloid beta, which is known as the causative agent of dementia, so it was thought that synergistic effects could be obtained with Re and Rd (Jang et al., Eur. J. Pharmacol. 758: 1- 10. 2015). On the other hand, as the content of Re and Rd decreases after bioconversion and the content of Rg3 and Rg5 increases, the final raw material is mixed with the same amount of products before and after fermentation in order to preserve the content of Re and Rd, which are indicators and functional substances. Was prepared. As a result of analyzing the index components Re, Rd, Rg3 and Rg5 contained in the mixed raw material before/after fermentation obtained through the final process, Re 58.06 mg/g, Rd 30.66 mg/g, Rg3 13.96 mg/g, Rg5 7.91 mg/ It was confirmed that it contained g (Fig. 1). The ginsenoside analysis results of the raw materials obtained through the final process are summarized in Table 2 below.

Ginsenoside analysis result Ginsenoside Rg1 Re Rb1 Rd Rg3 Rg5 Content (mg/g) 5.05 58.06 26.56 30.66 13.96 7.91

In addition, the final process secured based on the results obtained through the stepwise extraction process screening before and after fermentation is the extract obtained after extracting twice for 2 hours at room temperature by adding 10 times 50% alcohol than the original ginseng fruit. The fermented product from which the extract was fermented was prepared by mixing the same amount (1:1), and the name of the raw material was named Ginseng Berry Fermented Powder (FSGC: Fermented and Steam-dried Ginsengberry Compound) (FIG. 2).

Example 2: Mass production scale (plant scale) application

The present inventors confirmed the reproducibility and conditions requiring adjustment by applying it to a large-scale production facility for industrialization after securing the final process of Example 1 above. As a result of applying the specifically secured process, a pattern similar to the lab scale was derived at the extraction stage, but the application ratio of 100:1 at the time of introduction of the fermentation process was confirmed to not exhibit sufficient bacterial activity, so the strain inoculation ratio was reduced to 50. After adjusting to :1, the content of ginsenoside was analyzed (FIG. 4).

As a result, the contents of ginsenosides in both laboratory and mass production scales showed high Rg1, Re, and Rd contents before fermentation, but the contents of Rg3 and Rg5 increased after fermentation. In addition, the amount of increase in Rg3 and Rg5 after fermentation was 27.22 mg/g and 14.47 mg/g in laboratory scale, respectively, and 26.85 mg/g and 15.31 mg/g in mass production scale, respectively (Fig. 3 and Table 3).

The comparison results of the ginsenoside content before/after fermentation according to the process scale are summarized in Table 3 below.

Ginsenoside content analysis result before/after fermentation division Process application scale Ginsenoside 6 types content (mg/g) Rg1 Re Rb1 Rd Rg3 Rg5 Before fermentation Lab. scale 10.26 113.66 11.45 47.42 1.40 0.36 Plant scale 8.43 87.67 18.11 55.45 - 2.92 After fermentation Lab. scale 1.33 1.02 45.24 19.66 27.22 14.47 Plant scale - - 16.47 13.51 26.85 15.31

In addition, as a result of analyzing the indicator substances Re, Rd, Rg3, and Rg5 contained in the final raw material, it was found that Re 43.69 mg/g, Rd 37.57 mg/g, Rg3 12.33 mg/g, and Rg5 6.61 mg/g ( 5 and Table 4). When compared with the laboratory scale process, it was confirmed that there was a difference in absolute amount but showed a similar pattern. The ginsenoside analysis results for the final raw materials are summarized in Table 4 below.

Ginsenoside content analysis result of the final raw material Ginsenoside Rg1 Re Rb1 Rd Rg3 Rg5 Content (mg/g) 3.22 43.69 24.05 37.57 12.33 6.61

Example 3: Selection and Analysis of Index Components

In the case of ginsenoside, many methods and analysis conditions are known for separating and analyzing the corresponding component from ginseng and similar plants, and Re, Rd, Rg3, Rg5 in ginseng fruit are used in the process of securing the extract derived from ginseng fruit. It is considered as a substance having specificity, representativeness, stability and ease that can prove standardity, so the present inventors have used the above four ginsenosides as an index component of a health functional food raw material for improving cognition and memory using ginseng fruit. Was selected. External agency analysis was carried out by an accredited agency (Korea Functional Food Research Institute) in 3 iterations of 3 lots secured at mass production scale, and validation was conducted to investigate the adequacy of specificity, accuracy, and linearity.

As a result, the content of the calibrated indicator component was analyzed as an average of Re 42.00 mg/g, Rd 29.76 mg/g, Rg3 12.89 mg/g, and Rg5 16.90 mg/g, and the specification of the indicator component was Re 33.60 to 50.40 mg /g, Rd 23.81~35.71 mg/g, Rg3 10.31~15.47 mg/g, Rg5 13.52~20.28 mg/g. The content of the index components in the FSGC based on the test report from the accredited institution is summarized in Table 5 below.

Results of analysis of the content of indicator substances in FSGC division Ginsenoside (mg/g) Re Rd Rg3 Rg5 1lot average 37.89 32.88 12.96 16.94 2lot average 44.08 28.19 12.95 16.96 3lot average 44.04 28.22 12.77 16.81 Average 42.00 29.76 12.89 16.90

Example 4: AChE inhibitory effect

The present inventors used the neurotransmitter acetylcholinesterase (AChE) to inhibit AChE in brain tissue over time after treatment with FSGC, a test substance, at different concentrations (0.01, 0.1, 1 and 10 μg/mL) in vitro. The effect was evaluated.

As a result, it was confirmed that AChE activity was significantly inhibited in FSGC 1 μg/mL, but the inhibition rate was slightly weaker in FSGC 10 μg/mL (FIG. 6). This is because the sample color and the reaction color were similar, so the absorbance was low. At a concentration of 10 μg/mL or higher, the absorbance value was not measured due to the effect of the sample color. Therefore, as FSGC showed a significant inhibitory effect at a concentration of 1 μg/mL or higher, it is thought that FSGC will enhance cognitive function through inhibition of AChE.

Example 5: Cell viability analysis

Cell activity is a cell counting kit-8 (CCK-8, Dojindo, Kumamoto) using the principle that dehydrogenase present in the mitochondrial electron transport system of living cells decomposes Tetrazolium salts, which are electron acceptors, to produce Formazan Dye, a color developing material. , Japan). The present inventors performed cell viability analysis to investigate the toxicity of the fucoxanthin complex of PHA against cell lines.

As a result, in the case of the H ₂ O ₂ treated modal control group, the cell viability significantly decreased, whereas the IC ₅₀ of the FSGC-treated experimental group was found to be 349.58 μg/mL, indicating that the effect on the cell activity was insignificant (FIG. 7 ).

Example 6: Cytotoxicity test

The present inventors investigated the cytotoxicity of FSGC, an indicator material of the present invention, using F3.ChAT cells, a human neural stem cell line overexpressing the ChAT gene.

As a result, the cell viability of the control group treated with Aβ, which is toxic to neurons, was significantly reduced, whereas the experimental group treated with FSGC showed no toxicity to neurons even from 0.1 μg/mL to a high concentration of 500 μg/mL. (Fig. 8).

Example 7: Evaluation of cell protective effect

The present inventors used F3.ChAT human neural stem cells to investigate the protective effect of FSGC treatment on neural stem cells.

As a result, the survival rate of the positive control group treated with Aβ decreased to 44%, whereas the experimental group treated with FSGC showed a high survival rate at a concentration of 0.1 μg/mL or higher, and a survival rate of 100% at a concentration higher than 10 μg/mL. It was confirmed that the effect of protecting nerve cells against apoptosis by Aβ was excellent (FIG. 9).

Example 8: Analysis of gene expression regulation effect

Increased ChAT expression is expected to have a direct or indirect effect on cognitive improvement through direct control of ACh amount, and may be included as a class of AD treatment regimens (Gil-Bea et al., Neurosci. Lett. 375: 37 -41.2005). Accordingly, the present inventors analyzed the effect of regulating gene expression after treatment with FSGC at different concentrations (0.1, 1, 10 and 100 μg/mL) in neural stem cells (F3.ChAT) overexpressing the ChAT gene.

As a result, compared to the control group, it was found that the ChAT gene concentration-dependently increased during FSGC treatment, and the ChAT gene expression was significantly increased when Rd and Rg3, the main active substances of FSGC, were administered alone (FIG. 10 ). Therefore, the above result suggests that FSGC is a major active substance in the effect of improving cognition and memory.

Example 9: Learning and memory evaluation

The present inventors performed a passive avoidance test using a dementia inducing mouse model in order to evaluate the effect of improving cognitive function according to the administration of FSGC of the present invention.

As a result, in _{the dementia-induced group that caused cognitive decline with Aβ 1-42} , memory did not recover until the 6th round, whereas the FSGC 100 and 500 mg/kg administered groups showed significant recovery from the 4th round, and compared from the 5th round. In the substance EGCG 100 mg/kg group and all FSGC-administered groups (100, 300 or 500 mg/kg), it was confirmed that the cognitive function was restored to a level similar to that of the normal group (FIG. 11).

Example 10: Evaluation of spatial perception ability

The present inventors performed an aquatic rice test using a dementia-causing mouse model in order to evaluate the effect of improving spatial perception ability according to the administration of FSGC of the present invention.

As a result, the _{spatial perception ability did not recover until day 6 in the dementia-inducing group administered with Aβ 1-42} , whereas in all experimental groups (100, 300, and 500 mg/kg) administered orally with FSGC for 3 weeks, significant from day 3 The improvement effect was shown, and it was confirmed that the spatial perception ability was restored to a level similar to that of the normal group on the 6th day (FIG. 12).

Example 11: Measurement of ACh concentration

The present inventors measured the concentration of acetylcholine, a neurotransmitter, in brain tissue according to the administration of the FSGC of the present invention in a dementia-causing animal model.

As a result, it was confirmed that the neurotransmitter ACh was reduced to 5.27 μM in the dementia-induced group compared to the normal group (9.29 μM), but the experimental groups (100, 300 and 500 mg/kg) administered FSGC for 3 weeks were 6.20 μM, respectively, It was found that the ACh concentration was recovered in a concentration-dependent manner to 6.41 μM and 8.07 μM (FIG. 13). In particular, in the FSGC 500 mg/kg administration group, the AChE inhibitory activity significantly increased to a level similar to that of EGCG 100 mg/kg (8.43 μM), which is known to have an effect of improving cognitive function. The above results suggest that as the ACh concentration increased by administration of the FSGC of the present invention, it is directly related to the effect of restoring cognitive function.

Example 12: Distribution of Aβ in the brain

The present inventors performed immunofluorescence staining to confirm the accumulation of Aβ in the hippocampal CA1 region and the entire brain in charge of memory in order to evaluate the effect of removing Aβ in the brain of the dementia-inducing animal model according to the administration of FSGC of the present invention.

As a result, Aβ accumulation and plaque were observed in the dementia-induced group administered with _{Aβ 1-42 intraventricularly.} On the other hand, no plaque could be observed in the FSGC-administered group (Fig. 14).

Example 13: Brain injury analysis

For the analysis of brain damage in a dementia-causing animal model, the present inventors sufficiently perfused the brain with low-temperature saline during autopsy, then extracted brain tissue, and fixed it in 4% formaldehyde solution to prepare a frozen tissue slide. Thereafter, the expression of glial fibrillary acidic proteins (GFAP) in the fixed brain tissue was confirmed by immunofluorescence staining, and the number of astrocytes according to the brain injury was analyzed.

As a result, a large number of GFAP-positive astrocytes were observed in the Aβ dementia-induced group, but GFAP expression was significantly reduced in the FSGC and EGCG-administered groups (FIG. 15). In addition, as a result of comparing the number of GFAP-positive astrocytes for the same area, it was found that the dementia-induced group increased more than 3 times compared to the normal group, but significantly decreased at all concentrations (100-500 mg/kg) by FSGC administration. Observation was observed, and EGCG (100 mg/kg) administration group also showed excellent effects (FIG. 16). The above results suggest that the FSGC of the present invention exhibits an effect similar to EGCG, which is recognized as a health functional food by the Ministry of Food and Drug Safety, and thus has an excellent effect on the defense of brain damage.

The present invention has been described with reference to the above-described embodiments, but these are merely exemplary, and those of ordinary skill in the art will appreciate that various modifications and equivalent other embodiments are possible therefrom. Therefore, the true technical protection scope of the present invention should be determined by the technical spirit of the appended claims.

<110> Korea Genetic Pharm Co., Ltd. <120> A composition for improving memory and cognitive function comprising complex processed ginseng berry extract as an active ingredient <130> PD20-5899 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> hChAT F <400> 1 gtggctcaga acagcagcat 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> hChAT R <400> 2 caatcatgtc cagcgagtcc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> hGAPDH F <400> 3 ggagccaaaa gggtcatcat 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> hGAPDH R <400> 4 gtgatggcat ggactgtggt 20

Claims (15)

A pharmaceutical composition for improving memory or cognition, comprising a mixture of Jeungpo (蒸曝) ginseng fruit extract and fermented Jeungpo Ginseng fruit extract obtained by fermenting the Jeungpo Ginseng fruit extract with lactic acid bacteria as an active ingredient. The method of claim 1,
The lactic acid bacteria is Lactobacillus plantarum (Lactobacillus plantarum), a pharmaceutical composition. The method of claim 1,
The ginseng fruit is immature ginseng fruit, pharmaceutical composition. The method of claim 1,
The Jeungpo Ginseng Fruit Extract
Preparing a first enlarged ginseng fruit by increasing the immature ginseng fruit 3 to 5 times;
Preparing a second enlarged ginseng fruit by increasing the immature ginseng fruit 6 to 8 times;
Mixing the first evaporated ginseng fruit and the second evaporated ginseng fruit in equal amounts and then extracting with water, a lower alcohol of C1 to C4 or an aqueous solution of the lower alcohol; And
A pharmaceutical composition prepared by filtering the extracted extract and then concentrating under reduced pressure and freeze-drying. The method of claim 1,
The fermentation jeungpo ginseng fruit extract is fermented by inoculating lactic acid bacteria in the jeungpo ginseng fruit extract; And
A pharmaceutical composition prepared through the step of drying the fermented Jeungpo ginseng fruit extract. The method of claim 5,
The lactic acid bacteria is Lactobacillus plantarum (Lactobacillus plantarum), a pharmaceutical composition. A pharmaceutical composition for the treatment of Alzheimer's disease, comprising a mixture of Jeungpo ginseng fruit extract and fermented Jeungpo ginseng fruit extract obtained by fermenting the Jeungpo ginseng fruit extract with lactic acid bacteria as an active ingredient. The method of claim 7,
The lactic acid bacteria is Lactobacillus plantarum (Lactobacillus plantarum), a pharmaceutical composition. The method of claim 7,
The ginseng fruit is immature ginseng fruit, pharmaceutical composition. The method of claim 7,
The Jeungpo Ginseng Fruit Extract
Preparing a first evaporated ginseng fruit by evaporating the immature ginseng fruit 3 to 5 times;
Preparing a second enlarged ginseng fruit by increasing the immature ginseng fruit 6 to 8 times;
Mixing the first evaporated ginseng fruit and the second evaporated ginseng fruit in equal amounts and then extracting with water, a lower alcohol of C1 to C4 or an aqueous solution of the lower alcohol; And
A pharmaceutical composition prepared by filtering the extracted extract and then concentrating under reduced pressure and freeze-drying. The method of claim 7,
The fermentation jeungpo ginseng fruit extract is fermented by inoculating lactic acid bacteria in the jeungpo ginseng fruit extract; And
A pharmaceutical composition prepared through the step of drying the fermented Jeungpo ginseng fruit extract. The method of claim 11,
The lactic acid bacteria is Lactobacillus plantarum (Lactobacillus plantarum), a pharmaceutical composition. A health functional food for improving memory or cognitive ability, comprising a mixture of Jeungpo (蒸曝) ginseng fruit extract and fermented Jeungpo Ginseng fruit extract obtained by fermenting the Jeungpo Ginseng fruit extract with lactic acid bacteria as an active ingredient. The method of claim 13,
Health functional food provided in the form of a bath, drink, powder, pill, capsule, tablet or jelly. Preparing a first evaporated ginseng fruit by evaporating the immature ginseng fruit 3 to 5 times;
Preparing a second enlarged ginseng fruit by increasing the immature ginseng fruit 6 to 8 times;
Mixing the first evaporated ginseng fruit and the second evaporated ginseng fruit in equal amounts and then extracting with water, a lower alcohol of C1 to C4 or an aqueous solution of the lower alcohol to prepare an extract of enlarged ginseng fruit;
Fermenting by inoculating lactic acid bacteria into the Jeungpo ginseng fruit extract;
Filtering the fermented extract, concentrated under reduced pressure, and freeze-dried to prepare a fermented enhanced ginseng fruit extract; And
A method for producing a mixture of a mixture of the Jeungpo ginseng fruit extract and the fermented Jeungpo ginseng fruit extract obtained by fermenting the Jeungpo Ginseng fruit extract with lactic acid bacteria, comprising mixing the fermented Jeungpo Ginseng fruit extract and the fermented Jeungpo

Images