KR102198421B1 - Primer composition for recombinase polymerase amplification reaction for detecting pear viruses and use thereof - Google Patents

Primer composition for recombinase polymerase amplification reaction for detecting pear viruses and use thereof Download PDF

Info

Publication number
KR102198421B1
KR102198421B1 KR1020200046090A KR20200046090A KR102198421B1 KR 102198421 B1 KR102198421 B1 KR 102198421B1 KR 1020200046090 A KR1020200046090 A KR 1020200046090A KR 20200046090 A KR20200046090 A KR 20200046090A KR 102198421 B1 KR102198421 B1 KR 102198421B1
Authority
KR
South Korea
Prior art keywords
rpa
nucleotide sequence
seq
amplification
composition
Prior art date
Application number
KR1020200046090A
Other languages
Korean (ko)
Other versions
KR20200043345A (en
Inventor
정래동
김남연
Original Assignee
전남대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 전남대학교산학협력단 filed Critical 전남대학교산학협력단
Priority to KR1020200046090A priority Critical patent/KR102198421B1/en
Publication of KR20200043345A publication Critical patent/KR20200043345A/en
Application granted granted Critical
Publication of KR102198421B1 publication Critical patent/KR102198421B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 배 바이러스 검출용 조성물, 이를 포함한 진단용 키트 및 이를 이용한 배 바이러스병 진단방법에 관한 것이다.
본 발명의 조성물, 키트 및 진단방법을 이용하는 경우, 기존의 까다롭고 시간이 오래 소요되는 RNA 추출 과정 없이도 바로 RNA의 증폭이 가능하므로, RT-PCR 방법 등에 비하여 보다 간편하고 신속하게 배 바이러스의 검출 및 배 바이러스병의 진단에 유용하게 사용될 수 있다.
The present invention relates to a composition for detecting pear virus, a diagnostic kit including the same, and a method for diagnosing pear virus disease using the same.
In the case of using the composition, kit, and diagnostic method of the present invention, since RNA can be amplified immediately without the existing difficult and time-consuming RNA extraction process, it is more convenient and faster than the RT-PCR method. It can be usefully used for diagnosis of pear viral disease.

Description

배 바이러스를 검출하기 위한 재조합-중합효소 증폭 반응용 프라이머 조성물 및 이의 이용{Primer composition for recombinase polymerase amplification reaction for detecting pear viruses and use thereof}Primer composition for recombinase polymerase amplification reaction for detecting pear viruses and use thereof

본 발명은 배 바이러스 검출용 조성물, 이를 포함한 진단용 키트 및 이를 이용한 배 바이러스병 진단방법에 관한 것으로, 구체적으로는 서열번호 1의 염기서열로 이루어진 정방향 프라이머 및 서열번호 2의 염기서열로 이루어진 역방향 프라이머로 이루어진 제1 프라이머 세트 또는 서열번호 3의 염기서열로 이루어진 정방향 프라이머 및 서열번호 4의 염기서열로 이루어진 역방향 프라이머로 이루어진 제2 프라이머 세트를 포함하는 배 바이러스 검출용 조성물, 이를 포함하는 진단용 키트 및 이를 이용한 배 바이러스병 진단방법에 관한 것이다.The present invention relates to a composition for detecting pear virus, a diagnostic kit including the same, and a method for diagnosing pear virus disease using the same, specifically, a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2 A composition for detecting a embryo virus comprising a first primer set or a second primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 3 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 4, a diagnostic kit containing the same, and It relates to a method for diagnosing pear virus disease.

전 세계적인 지구 온난화로 인하여 새로운 바이러스의 출현과 피해가 급증하고 있다. 그 중 식물 바이러스 병은 곰팡이나 세균에 의한 다른 식물 병들과는 다르게 화학적 방제가 불가능하고, 소수의 친환경 방제 법이 있지만 효과는 크지 않은 문제가 있다. 그렇기 때문에 식물 바이러스 병은 방제보다는 신속한 진단으로 작물의 피해를 줄이고 병의 확산을 막는 것이 중요하다.Due to global warming, the emergence and damage of new viruses is increasing rapidly. Among them, unlike other plant diseases caused by fungi or bacteria, chemical control is impossible, and there are few environmentally friendly control methods, but the effect is not great. Therefore, it is important to reduce damage to crops and prevent the spread of the disease through rapid diagnosis rather than control of plant virus diseases.

국내 과수 바이러스 감염률은 30~60 %로 높으며, 감염으로 인해 과수의 생산량 20~40 % 감소, 당도 감소 및 기형과 발생 등으로 품질이 저하되어 경쟁력이 취약하다(농촌진흥청 원예특작과학원). 특히, 개방화가 가속되는 상황에서 바이러스에 감염된 과수는 과수 산업의 경쟁력을 떨어뜨린다. 그 중 특히 배의 바이러스 감염률은 29 %(최저 감염률)이며, 피해도 증가하고 있다. The domestic fruit tree virus infection rate is as high as 30-60%, and its competitiveness is weak because the quality of fruit tree production decreases by 20-40%, sugar content decreases, and malformations occur due to infection (Rural Development Administration Institute of Horticultural Science). In particular, in a situation where openness is accelerating, fruit trees infected with viruses degrade the competitiveness of the fruit industry. Among them, the virus infection rate of ships is 29% (the lowest infection rate), and the damage is also increasing.

한편, 우리나라 배에서 발생하는 주요 바이러스는 사과 황화 반점 바이러스(Apple chlorotic leafspot virus; ACLSV), 사과 줄기 구멍 바이러스(Apple stem pitting virus; ASPV) 및 사과 줄기 홈 바이러스(Apple stem grooving virus; ASGV) 등이 있다. Meanwhile, major viruses that occur in Korean pears include Apple chlorotic leafspot virus (ACLSV), Apple stem pitting virus (ASPV), and Apple stem grooving virus (ASGV). have.

기존에는 이러한 바이러스들을 검출 및 진단하기 위해 중합효소 연쇄 반응(Polymerase chain reaction; PCR) 기법을 이용하였다. 그러나 PCR은 특별한 장비가 필요하고, 평균 90 분이라는 오랜 시간이 걸리기 때문에 신속한 검출 및 진단이 어렵다는 문제가 있다.Previously, a polymerase chain reaction (PCR) technique was used to detect and diagnose these viruses. However, since PCR requires special equipment and takes a long time, an average of 90 minutes, it is difficult to detect and diagnose quickly.

국내공개특허 10-2016-0126654호Korean Patent Publication No. 10-2016-0126654

본 발명자들은 보다 간편하고 신속하게 배 바이러스를 검출 및 진단하는 방법을 개발하고자 예의 연구 노력하였다. 그 결과, 서열번호 1의 염기서열로 이루어진 정방향 프라이머 및 서열번호 2의 염기서열로 이루어진 역방향 프라이머로 이루어진 제1 프라이머 세트 또는 서열번호 3의 염기서열로 이루어진 정방향 프라이머 및 서열번호 4의 염기서열로 이루어진 역방향 프라이머로 이루어진 제2 프라이머 세트를 이용한 RT-RPA의 방법을 이용하는 경우, RNA 추출 과정 없이도 바로 RNA의 증폭이 가능함을 규명함으로써, 본 발명을 완성하게 되었다.The present inventors have made intensive research efforts to develop a simpler and faster method for detecting and diagnosing pear virus. As a result, a first primer set consisting of a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2 or a forward primer consisting of the nucleotide sequence of SEQ ID NO: 3 and a nucleotide sequence of SEQ ID NO: 4 In the case of using the RT-RPA method using a second primer set consisting of reverse primers, it was found that RNA can be amplified immediately without the RNA extraction process, thereby completing the present invention.

따라서, 본 발명의 목적은 서열번호 1의 염기서열로 이루어진 정방향 프라이머 및 서열번호 2의 염기서열로 이루어진 역방향 프라이머로 이루어진 제1 프라이머 세트 또는 서열번호 3의 염기서열로 이루어진 정방향 프라이머 및 서열번호 4의 염기서열로 이루어진 역방향 프라이머로 이루어진 제2 프라이머 세트를 포함하는 배 바이러스 검출용 조성물을 제공하는 것이다.Accordingly, an object of the present invention is a first primer set consisting of a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2 or a forward primer consisting of the nucleotide sequence of SEQ ID NO: 3, and the It is to provide a composition for detecting a embryo virus comprising a second primer set consisting of a reverse primer consisting of a base sequence.

본 발명의 다른 목적은 서열번호 1의 염기서열로 이루어진 정방향 프라이머 및 서열번호 2의 염기서열로 이루어진 역방향 프라이머로 이루어진 제1 프라이머 세트 또는 서열번호 3의 염기서열로 이루어진 정방향 프라이머 및 서열번호 4의 염기서열로 이루어진 역방향 프라이머로 이루어진 제2 프라이머 세트를 포함하는 배 바이러스 검출용 조성물을 포함하는 배 바이러스병 진단용 키트를 제공하는 것이다.Another object of the present invention is a first primer set consisting of a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2 or a forward primer consisting of the nucleotide sequence of SEQ ID NO: 3 and a base of SEQ ID NO: 4 It is to provide a kit for diagnosing embryo virus disease comprising a composition for detecting embryo virus comprising a second primer set consisting of a reverse primer consisting of a sequence.

본 발명의 또 다른 목적은 배 바이러스병의 진단방법을 제공하는 것이다.Another object of the present invention is to provide a method for diagnosing pear virus disease.

본 발명자들은 보다 간편하고 신속하게 배 바이러스를 검출 및 진단하는 방법을 개발하고자 예의 연구 노력하였다. 그 결과, 서열번호 1의 염기서열로 이루어진 정방향 프라이머 및 서열번호 2의 염기서열로 이루어진 역방향 프라이머로 이루어진 제1 프라이머 세트 또는 서열번호 3의 염기서열로 이루어진 정방향 프라이머 및 서열번호 4의 염기서열로 이루어진 역방향 프라이머로 이루어진 제2 프라이머 세트를 이용한 RT-RPA의 방법을 이용하는 경우, RNA 추출 과정 없이도 바로 RNA의 증폭이 가능함을 규명하였다.The present inventors have made intensive research efforts to develop a simpler and faster method for detecting and diagnosing pear virus. As a result, a first primer set consisting of a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2 or a forward primer consisting of the nucleotide sequence of SEQ ID NO: 3 and a nucleotide sequence of SEQ ID NO: 4 In the case of using the RT-RPA method using a second primer set consisting of reverse primers, it was found that RNA can be amplified immediately without the RNA extraction process.

본 발명은 배 바이러스 검출용 조성물, 이를 포함한 진단용 키트 및 이를 이용한 배 바이러스병 진단방법에 관한 것으로, 서열번호 1의 염기서열로 이루어진 정방향 프라이머 및 서열번호 2의 염기서열로 이루어진 역방향 프라이머로 이루어진 제1 프라이머 세트 또는 서열번호 3의 염기서열로 이루어진 정방향 프라이머 및 서열번호 4의 염기서열로 이루어진 역방향 프라이머로 이루어진 제2 프라이머 세트를 포함하는 배 바이러스 검출용 조성물, 이를 포함하는 진단용 키트 및 이를 이용한 배 바이러스병 진단방법에 관한 것이다.The present invention relates to a composition for detecting pear virus, a diagnostic kit including the same, and a method for diagnosing pear virus disease using the same, and a first consisting of a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2 A composition for detecting embryo virus comprising a primer set or a second primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 3 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 4, a diagnostic kit containing the same, and a pear virus disease using the same It is about the diagnosis method.

이하, 본 발명을 더욱 자세히 설명하고자 한다.Hereinafter, the present invention will be described in more detail.

본 발명의 일 양태는 서열번호 1의 염기서열로 이루어진 정방향 프라이머 및 서열번호 2의 염기서열로 이루어진 역방향 프라이머로 이루어진 제1 프라이머 세트 또는 서열번호 3의 염기서열로 이루어진 정방향 프라이머 및 서열번호 4의 염기서열로 이루어진 역방향 프라이머로 이루어진 제2 프라이머 세트를 포함하는 배 바이러스 검출용 조성물에 관한 것이다.One aspect of the present invention is a first primer set consisting of a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2, or a forward primer consisting of the nucleotide sequence of SEQ ID NO: 3 and a base of SEQ ID NO: 4 It relates to a composition for detecting embryonic virus comprising a second primer set consisting of a reverse primer consisting of a sequence.

본 발명에서 용어 "프라이머"는 짧은 자유 3 말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로 식물체 핵산의 상보적인 주형(template)과 염기쌍(base pair)을 형성할 수 있고, 주형 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다.In the present invention, the term "primer" is a nucleic acid sequence having a short free 3'hydroxyl group and can form a base pair with a complementary template of a plant nucleic acid, and template strand copying is performed. It refers to a short nucleic acid sequence that functions as a starting point for.

상기 제1 프라이머 세트는 사과 줄기 구멍 바이러스(Apple stem pitting virus; ASPV) 검출용 프라이머 세트일 수 있다.The first primer set may be a primer set for detecting apple stem pitting virus (ASPV).

본 발명에서 용어 "사과 줄기 구멍 바이러스(Apple stem pitting virus; ASPV)"는 배 바이러스병(고접병)의 원인균 중 하나로, ASPV에 감염된 나무는 일반적인 쇠약 증상을 나타내고 잎이 작아지며, 점진적으로 황화, 조기낙엽 등의 증상을 나타낸다. 또한, 꽃이 많이 피고 과실이 작아지며, 줄기를 가로로 잘라보면 방사상으로 고랑이 진 나이테를 볼 수 있다.In the present invention, the term "Apple stem pitting virus (ASPV)" is one of the causative bacteria of pear virus disease (high fever), and trees infected with ASPV exhibit general debilitating symptoms and have smaller leaves, gradually yellowing, early It shows symptoms such as fallen leaves. In addition, a lot of flowers bloom and the fruits become smaller, and if you cut the stem horizontally, you can see the rings with radial furrows.

상기 ASPV는 본 발명의 제1 프라이머 세트에 의해 증폭되어 146 bp의 증폭산물을 나타내며, 상기 증폭산물을 통해 검출될 수 있다.The ASPV is amplified by the first primer set of the present invention to represent an amplification product of 146 bp, and can be detected through the amplification product.

상기 제2 프라이머 세트는 사과 줄기 홈 바이러스(Apple stem grooving virus; ASGV) 검출용 프라이머 세트일 수 있다.The second primer set may be a primer set for detecting apple stem grooving virus (ASGV).

본 발명에서 용어 "사과 줄기 홈 바이러스(Apple stem grooving virus; ASGV)"는 배 바이러스병(배잎검은점병)의 원인균 중 하나로, ASGV에 감염된 나무는 잎에 흑갈색의 작은 반점이 형성되고, 점차 진전되면서 원형 또는 불규칙한 병반이 형성된다. 병반이 오래되면 회색으로 변하고, 간혹 찢어져 지저분하게 되며, 생육 후기에는 여러 가지 점무늬병 또는 검은무늬병과 혼합 발생하여 구분하기가 매우 어렵다.In the present invention, the term "Apple stem grooving virus (ASGV)" is one of the causative bacteria of pear virus disease (pear leaf black spot), and as a tree infected with ASGV forms small dark brown spots on the leaves, it gradually progresses. A circular or irregular lesion is formed. When the lesion is old, it turns gray, sometimes torn and becomes dirty, and it is very difficult to distinguish due to the occurrence of mixed with various spots or black spots in late growth.

상기 ASGV는 본 발명의 제2 프라이머 세트에 의해 증폭되어 143 bp의 증폭산물을 나타내며, 상기 증폭산물을 통해 검출될 수 있다.The ASGV is amplified by the second primer set of the present invention to represent an amplification product of 143 bp, and can be detected through the amplification product.

상기 증폭은 당업계에서 증폭 대상(유전자 등)을 증폭하기 위하여 이용되는 어떠한 방법에 의해서도 수행될 수 있고, 예를 들어, 재조합-중합효소 증폭법(Recombinase polymerase amplification; RPA)에 의해 수행될 수 있으나, 이에 제한되는 것은 아니다.The amplification may be performed by any method used to amplify an amplification target (gene, etc.) in the art, for example, by recombinant-polymerase amplification (RPA), but , But is not limited thereto.

상기 증폭산물은 예를 들어, 앰플리콘(amplicon)일 수 있으나, 이에 제한되는 것은 아니다.The amplification product may be, for example, an amplicon, but is not limited thereto.

본 명세서에서 용어 "재조합-중합효소 증폭법"은 DNA 및 RNA 증폭을 확인 할 수 있는 기술을 의미하며, 기존 PCR 과는 다르게 DNA 결합 단백질과 재조합효소(recombinase)를 이용하여 빠르고 정확하게 타겟 서열(target sequence)을 증폭시킬 수 있는 기술이다. RPA 방법은 중온성 중합효소(mesophilic polymerase)를 이용하여 등온 조건에서도 증폭이 가능하므로, 특별한 장비 없이 등온 장치만 있으면 단 시간 안에 바이러스를 검출 및 진단 할 수 있는 장점이 있다.In the present specification, the term "recombinant-polymerase amplification method" refers to a technology that can confirm DNA and RNA amplification, and unlike conventional PCR, a target sequence (target sequence) using a DNA-binding protein and a recombinase is used. It is a technology that can amplify the sequence). Since the RPA method can be amplified even under isothermal conditions using mesophilic polymerase, it has the advantage of detecting and diagnosing viruses in a short time with only an isothermal device without special equipment.

본 발명의 다른 일 양태는 서열번호 1의 염기서열로 이루어진 정방향 프라이머 및 서열번호 2의 염기서열로 이루어진 역방향 프라이머로 이루어진 제1 프라이머 세트 또는 서열번호 3의 염기서열로 이루어진 정방향 프라이머 및 서열번호 4의 염기서열로 이루어진 역방향 프라이머로 이루어진 제2 프라이머 세트를 포함하는 배 바이러스 검출용 조성물을 포함하는 배 바이러스병 진단용 키트에 관한 것이다.Another aspect of the present invention is a first primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 2 or a forward primer consisting of the nucleotide sequence of SEQ ID NO: It relates to a kit for diagnosing embryo virus disease comprising a composition for detecting embryo virus comprising a second primer set consisting of a reverse primer consisting of a base sequence.

본 발명에서 용어 "배 바이러스병"은 바이러스의 감염에 의해서 배에서 발생하는 질병을 의미하며, 구체적으로는 고접병(stem pitting) 및 배잎검은점병(black necrotic leaf spot)으로 이루어진 군에서 선택된 1 종 이상일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the term "pear viral disease" refers to a disease that occurs in the stomach due to virus infection, and specifically, at least one selected from the group consisting of stem pitting and black necrotic leaf spot However, it is not limited thereto.

상기 제1 프라이머 세트를 포함하는 배 바이러스 검출용 조성물은 고접병을 진단하기 위해 사용될 수 있다.The composition for detecting pear virus comprising the first primer set may be used to diagnose hyperplasia.

상기 제2 프라이머 세트를 포함하는 배 바이러스 검출용 조성물은 배잎검은점병을 진단하기 위해 사용될 수 있다.The composition for detecting pear virus including the second primer set may be used to diagnose pear leaf black spot.

상기 혼합물을 포함하는 배 바이러스 검출용 조성물은 고접병 또는 배잎검은점병을 진단하기 위해 사용될 수 있다.The composition for detecting a pear virus comprising the mixture may be used to diagnose hyperplasia or black spot of pear leaf.

상기 키트는 시료로부터 배 바이러스를 검출하는데 사용될 수 있는데, 특별히 제한되지 않으나, 상기 제1 프라이머 세트 및/또는 제2 프라이머 세트뿐만 아니라 분석방법에 적합한 한 종류 또는 그 이상의 다른 구성 성분 조성물, 용액 또는 장치가 포함될 수도 있다.The kit may be used to detect embryonic virus from a sample, but is not particularly limited, but not only the first primer set and/or the second primer set, but also one or more other component compositions, solutions, or devices suitable for the assay method. May be included.

상기 시료는 예를 들어, 배 나무(묘목)의 껍질, 잎, 열매, 줄기 또는 뿌리 등이 사용될 수 있으나, 이에 제한되는 것은 아니다.The sample may be, for example, a bark, leaf, fruit, stem, or root of a pear tree (seedling), but is not limited thereto.

구체적으로, 상기 키트는 RPA 분석을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있고, 상기 각각의 프라이머 세트 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드(dNTPs), Taq-폴리머라아제와 같은 효소, DNase, RNAse 억제제, DEPC-수(DEPCwater) 및 멸균수 등을 포함할 수 있다.Specifically, the kit may be a kit containing the essential elements necessary to perform the RPA analysis, and in addition to each of the primer sets, a test tube or other suitable container, a reaction buffer (various pH and magnesium concentration), deoxynucleotide (dNTPs), enzymes such as Taq-polymerase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like.

상기 키트가 RPA 분석에 사용되는 경우, 별도로 cDNA를 수득할 필요 없이 시료로부터 바로 RPA 증폭산물을 수득하여 아가로오스 겔 전기영동(agarose gel electrophoresis) 등의 방법으로 분리할 수 있으며, 사용된 프라이머 세트에 의해 중합된 DNA에 해당하는 길이를 갖는 DNA의 존재를 확인하여 배 바이러스병을 진단할 수 있다.When the kit is used for RPA analysis, the RPA amplification product can be obtained directly from the sample without the need to separately obtain cDNA, and can be separated by a method such as agarose gel electrophoresis, and the primer set used By confirming the presence of a DNA having a length corresponding to the DNA polymerized by, embryo virus disease can be diagnosed.

특히 2 개 이상의 프라이머 세트를 포함하는 진단용 키트의 경우, 각각의 프라이머 세트를 사용하는 진단이 별도로 수행될 수도 있고, 다수의 프라이머 세트를 하나의 반응에 혼합 사용하여 진단이 수행될 수도 있다.In particular, in the case of a diagnostic kit including two or more primer sets, diagnosis using each primer set may be performed separately, or diagnosis may be performed by mixing a plurality of primer sets in one reaction.

상기 키트는 특정한 형태로 한정되는 것은 아니며, 다양한 형태로 구현될 수 있다. 예를 들어, 상기 키트는 용기(예컨대, 일회용 RPA 튜브 등)에 담겨 있는 동결 건조된(lyophilized) 프라이머 세트를 포함할 수 있다. 2 개 이상의 프라이머 세트를 포함하는 경우 다수의 프라이머 세트가 혼합되어 RPA 튜브에 담겨 있을 수도 있고, 각각의 프라이머 세트가 개별적으로 각각의 RPA 튜브에 담겨 있을 수도 있다.The kit is not limited to a specific form, and may be implemented in various forms. For example, the kit may include a lyophilized primer set contained in a container (eg, disposable RPA tube, etc.). When two or more primer sets are included, a plurality of primer sets may be mixed and contained in an RPA tube, or each primer set may be individually contained in each RPA tube.

즉, 2 개의 프라이머 세트를 포함하는 진단용 키트의 경우, 제1 프라이머 세트 또는 제2 프라이머 세트 중 어느 하나의 프라이머 세트가 동결 건조 분말 형태로 담겨 있는 일회용 RPA 튜브가 진단용 키트에 포함될 수 있고, 제1 프라이머 세트 및 제2 프라이머 세트가 동결 건조 분말 형태로 혼합되어 담겨 있는 일회용 RPA 튜브가 진단용 키트에 포함될 수도 있다.That is, in the case of a diagnostic kit including two primer sets, a disposable RPA tube in which one of the first primer set or the second primer set is contained in the form of freeze-dried powder may be included in the diagnostic kit, and the first A disposable RPA tube in which the primer set and the second primer set are mixed in a freeze-dried powder form may be included in the diagnostic kit.

본 발명의 다른 일 양태는 하기의 단계를 포함하는 배 바이러스병의 진단방법에 관한 것이다.Another aspect of the present invention relates to a method for diagnosing embryonic virus disease comprising the following steps.

제 1 항의 조성물을 이용하여 시료로부터 재조합-중합효소 증폭법(Recombinase polymerase amplification; RPA) 증폭산물을 수득하는 증폭 단계; 및An amplification step of obtaining a recombinase polymerase amplification (RPA) amplification product from the sample using the composition of claim 1; And

RPA 증폭산물을 분석하는 분석 단계.Analysis step to analyze the RPA amplification product.

본 명세서에서 용어 "재조합-중합효소 증폭법"은 DNA 및 RNA 증폭을 확인 할 수 있는 기술을 의미하며, 기존 PCR 과는 다르게 DNA 결합 단백질과 재조합효소(recombinase)를 이용하여 빠르고 정확하게 타겟 서열(target sequence)을 증폭시킬 수 있는 기술이다. RPA 방법은 중온성 중합효소(mesophilic polymerase)를 이용하여 등온 조건에서도 증폭이 가능하므로, 특별한 장비 없이 등온 장치만 있으면 단 시간 안에 바이러스를 검출 및 진단 할 수 있는 장점이 있다.In the present specification, the term "recombinant-polymerase amplification method" refers to a technology that can confirm DNA and RNA amplification, and unlike conventional PCR, a target sequence (target sequence) using a DNA-binding protein and a recombinase is used. It is a technology that can amplify the sequence). Since the RPA method can be amplified even under isothermal conditions using mesophilic polymerase, it has the advantage of detecting and diagnosing viruses in a short time with only an isothermal device without special equipment.

상기 분석 단계에서 146 bp의 증폭산물을 수득한 경우 시료에 ASPV가 감염되었다고 판정할 수 있고, 143 bp의 증폭산물을 수득한 경우 시료에 ASGV가 감염되었다고 판정할 수 있다.In the above analysis step, when a 146 bp amplification product is obtained, it may be determined that the sample is infected with ASPV, and when a 143 bp amplification product is obtained, it may be determined that the sample is infected with ASGV.

상기 시료는 예를 들어, 배 나무(묘목)의 껍질, 잎, 열매, 줄기 또는 뿌리 등이 사용될 수 있으나, 이에 제한되는 것은 아니다.The sample may be, for example, a bark, leaf, fruit, stem, or root of a pear tree (seedling), but is not limited thereto.

상기 증폭산물은 예를 들어, 앰플리콘(amplicon)일 수 있으나, 이에 제한되는 것은 아니다.The amplification product may be, for example, an amplicon, but is not limited thereto.

상기 제1 프라이머 세트 또는 제2 프라이머 세트를 포함하는 배 바이러스 검출용 조성물 및 이를 포함한 배 바이러스 진단용 키트의 중복되는 내용은 본 명세서의 복잡성을 고려하여 생락한다.The overlapping contents of the composition for detecting embryo virus including the first primer set or the second primer set and the kit for diagnosing embryo virus including the same are omitted in consideration of the complexity of the present specification.

한편, 감염된 배 조직에는 페놀 화합물, 탄수화물, 안료 및 기타 알려지지 않은 화합물이 풍부하기 때문에, 이로부터 RNA를 분리하는 것은 매우 까다롭다.On the other hand, because infected embryonic tissues are rich in phenolic compounds, carbohydrates, pigments and other unknown compounds, it is very difficult to isolate RNA from them.

하지만, 본 발명의 프라이머 세트를 이용한 RT-RPA의 방법은 기존의 까다롭고 오랜 시간이 소요되는 RNA 추출 과정 없이도 바로 RNA의 증폭이 가능하므로, 식물 잎에서 즙(액)을 내어 바로 반응을 진행함으로써, 보다 간편하고 신속하게 바이러스를 검출하는 용도로 유용하게 사용될 수 있다.However, since the RT-RPA method using the primer set of the present invention can amplify RNA directly without the existing difficult and time-consuming RNA extraction process, the reaction proceeds directly by extracting juice (liquid) from plant leaves. , It can be usefully used for detecting viruses more simply and quickly.

본 발명은 배 바이러스 검출용 조성물, 이를 포함한 진단용 키트 및 이를 이용한 배 바이러스병 진단방법에 관한 것으로, 구체적으로는 서열번호 1의 염기서열로 이루어진 정방향 프라이머 및 서열번호 2의 염기서열로 이루어진 역방향 프라이머로 이루어진 제1 프라이머 세트 또는 서열번호 3의 염기서열로 이루어진 정방향 프라이머 및 서열번호 4의 염기서열로 이루어진 역방향 프라이머로 이루어진 제2 프라이머 세트를 포함하는 배 바이러스 검출용 조성물, 이를 포함하는 진단용 키트 및 이를 이용한 배 바이러스병 진단방법에 관한 것이다.The present invention relates to a composition for detecting pear virus, a diagnostic kit including the same, and a method for diagnosing pear virus disease using the same, specifically, a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2 A composition for detecting a embryo virus comprising a first primer set or a second primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 3 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 4, a diagnostic kit containing the same, and It relates to a method for diagnosing pear virus disease.

본 발명의 프라이머 세트를 이용한 RT-RPA의 방법은 기존의 까다롭고 오랜 시간이 소요되는 RNA 추출 과정 없이도 바로 RNA의 증폭이 가능하므로, 식물 잎에서 즙(액)을 내어 바로 반응을 진행함으로써, 보다 간편하고 신속하게 바이러스를 검출하는 용도로 유용하게 사용될 수 있다.The RT-RPA method using the primer set of the present invention enables the amplification of RNA directly without the existing difficult and time-consuming RNA extraction process, so by taking the juice (liquid) from the plant leaf and proceeding the reaction directly, It can be usefully used for simple and rapid virus detection.

도 1a는 사과 줄기 구멍 바이러스(ASPV)의 외피 단백질(CP)의 다중서열배치(multiple sequence alignment)를 나타내는 그래프이다.
도 1b는 사과 줄기 홈 바이러스(ASGV)의 외피 단백질(CP)의 다중서열배치(multiple sequence alignment)를 나타내는 그래프이다.
도 2a는 ASPV(왼쪽) 및 ASGV(오른쪽)에 감염된 배 잎의 사진이다.
도 2b는 본 발명의 일 실시예에 따른 ASPV1F/R 및 ASGV1F/R 프라이머를 이용한 RT-RPA 반응 결과를 확인한 도이다.
도 3은 본 발명의 일 실시예에 따른 ASPV2F/R, ASGV2F/R 및 ASGV3F/R 프라이머를 이용한 RT-RPA 반응 결과를 확인한 도이다.
도 4a는 본 발명의 일 실시예에 따른 ASPV1F/R 프라이머를 이용하여, 시간 경과(1, 3, 5, 10, 15, 20 및 30 분)에 따라 RT-RPA 반응 결과를 확인한 도이다.
도 4b는 본 발명의 일 실시예에 따른 ASGV1F/R 프라이머를 이용하여, 시간 경과(1, 3, 5, 10, 15, 20 및 30 분)에 따라 RT-RPA 반응 결과를 확인한 도이다.
도 5a는 본 발명의 일 실시예에 따른 ASPV1F/R 프라이머를 이용한 RT-RPA 반응 증폭산물의 염기서열을 확인한 도이다.
도 5b는 본 발명의 일 실시예에 따른 ASGV1F/R 프라이머를 이용한 RT-RPA 반응 증폭산물의 염기서열을 확인한 도이다.
도 6은 본 발명의 일 실시예에 따른 ASPV1F/R 및 ASGV1F/R 프라이머를 이용한 RT-RPA 반응 및 RT-PCR 반응 결과를 비교한 도이다.
도 7a는 본 발명의 일 실시예에 따른 ASPV1F/R 프라이머를 이용하여, 배 잎의 즙(액)에서 RT-RPA 반응 결과를 확인한 도이다.
도 7b는 본 발명의 일 실시예에 따른 ASPV1F/R 프라이머 및 ASGV1F/R 프라이머를 이용하여, 배 나무(묘목) 껍질의 즙(액)에서 RT-RPA 반응 결과를 확인한 도이다.
도 8a는 본 발명의 일 실시예에 따른 ASPV1F/R 프라이머를 이용한 RT-RPA 반응 증폭산물의 염기서열을 확인한 도이다.
도 8b는 본 발명의 일 실시예에 따른 ASGV1F/R 프라이머를 이용한 RT-RPA 반응 증폭산물의 염기서열을 확인한 도이다.
1A is a graph showing multiple sequence alignment of envelope proteins (CP) of apple stem pore virus (ASPV).
1B is a graph showing multiple sequence alignment of envelope proteins (CP) of apple stem home virus (ASGV).
2A is a photograph of pear leaves infected with ASPV (left) and ASGV (right).
Figure 2b is a diagram confirming the RT-RPA reaction results using the ASPV1F / R and ASGV1F / R primers according to an embodiment of the present invention.
Figure 3 is a diagram confirming the RT-RPA reaction results using the ASPV2F / R, ASGV2F / R and ASGV3F / R primers according to an embodiment of the present invention.
Figure 4a is a diagram confirming the RT-RPA reaction results over time (1, 3, 5, 10, 15, 20 and 30 minutes) using the ASPV1F / R primer according to an embodiment of the present invention.
Figure 4b is a diagram confirming the RT-RPA reaction results over time (1, 3, 5, 10, 15, 20 and 30 minutes) using the ASGV1F / R primer according to an embodiment of the present invention.
5A is a diagram illustrating the nucleotide sequence of an RT-RPA reaction amplification product using an ASPV1F/R primer according to an embodiment of the present invention.
5B is a diagram illustrating the nucleotide sequence of an RT-RPA reaction amplification product using an ASGV1F/R primer according to an embodiment of the present invention.
6 is a diagram comparing RT-RPA reaction and RT-PCR reaction results using ASPV1F/R and ASGV1F/R primers according to an embodiment of the present invention.
Figure 7a is a diagram confirming the RT-RPA reaction result in the juice (liquid) of pear leaf using the ASPV1F / R primer according to an embodiment of the present invention.
Figure 7b is a diagram confirming the RT-RPA reaction results in the juice (liquid) of pear tree (seedling) bark using the ASPV1F / R primer and the ASGV1F / R primer according to an embodiment of the present invention.
8A is a diagram illustrating the nucleotide sequence of an RT-RPA reaction amplification product using an ASPV1F/R primer according to an embodiment of the present invention.
8B is a diagram illustrating the nucleotide sequence of an RT-RPA reaction amplification product using an ASGV1F/R primer according to an embodiment of the present invention.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

제조예. 프라이머 세트의 제조Manufacturing example. Preparation of primer set

우리나라 배 주산지 5 지역(전남 나주, 충남 천안, 경북 상주, 경남 울산 및 경기도 남양주)을 선발하고, 잎 황백화(leaf chlorosis) 및 괴사성 반점(necrotic spots) 등 전형적인 배 바이러스병 증상을 보이는 158 개의 잎 샘플을 채취하였다.5 areas of pear production in Korea (Naju, Chungnam, Sangju, Gyeongbuk, Ulsan, Gyeongnam, and Namyangju, Gyeonggi) were selected, and 158 pear viral symptoms such as leaf chlorosis and necrotic spots were selected. Leaf samples were taken.

IQeasy+ 식물 RNA 추출 미니 키트(iNtRON, Korea)를 사용하여 잎 조직에서 Total RNA를 추출하였다. 단일 사과 줄기 홈 바이러스(Apple stem grooving virus; ASGV) 또는 사과 줄기 구멍 바이러스(Apple stem pitting virus; ASPV) 감염에 대해 양성인 샘플을 선택하여 RT-RPA 분석 템플릿으로 사용하기 위해 -80 ℃에서 보관하였다.Total RNA was extracted from leaf tissue using an IQeasy+ plant RNA extraction mini kit (iNtRON, Korea). Samples positive for single apple stem grooving virus (ASGV) or apple stem pitting virus (ASPV) infection were selected and stored at -80°C for use as an RT-RPA assay template.

다음으로, 상기 5 지역별로 분리된 5 개의 ASGV 분리주와 3 개의 ASPV 분리주의 서열(sequence)을 확보하였다. 확보한 ASGV 및 ASPV의 염기서열을 바탕으로, 보존되어 있는 염기서열 부분을 확인하였다.Next, a sequence of 5 ASGV isolates and 3 ASPV isolates separated for each of the 5 regions was obtained. Based on the obtained nucleotide sequences of ASGV and ASPV, the preserved nucleotide sequence portion was confirmed.

보다 구체적으로, ASPV의 외피 단백질(coat protein; CP)의 염기서열(GenBank LC367338, LC367340, LC367341, AF345893, D21829 및 KF915809)의 다중서열배치(multiple sequence alignment, 도 1a) 및 ASGV의 외피 단백질의 염기서열(MG682506, MG682507, MG682508, MG682509, MG682510, JN792471, LC084659, KX955001, KF735124, LC184610, LC143387, KR185346, KU198289, LC184611, AB004603, KJ579253 및 GQ330294)의 다중서열배치(도 1b)에서, 고도로 보존된 영역을 선택하고, 이를 이용하여 RT-RPA를 위한 프라이머 세트를 제작하였다.More specifically, multiple sequence alignment of the nucleotide sequence (GenBank LC367338, LC367340, LC367341, AF345893, D21829 and KF915809) of the coat protein (CP) of ASPV and base of the coat protein of ASGV Multisequencing of the sequences (MG682506, MG682507, MG682508, MG682509, MG682510, JN792471, LC084659, KX955001, KF735124, LC184610, LC143387, KR185346, KU198289, LC184611, AB004603, KJ579253 and GQ330294), in highly conserved regions (Figure 1b). Was selected, and a primer set for RT-RPA was prepared using this.

제작한 프라이머 세트는 하기 표 1에 나타내었다.The prepared primer set is shown in Table 1 below.

서열번호Sequence number 명명denomination 염기서열(5’-3’)Base sequence (5’-3’) 예상 앰플리콘 길이
(Expected amplicon length, nt)
Expected amplicon length
(Expected amplicon length, nt)
바이러스virus
1One ASPV1FASPV1F TCAATGGAGGGTACCCAGGCTGTTAATTTTTCAATGGAGGGTACCCAGGCTGTTAATTTT 146146 ASPVASPV 22 ASPV1RASPV1R TCAACTTTACTAAAAAGCATAAGTACTGAATCAACTTTACTAAAAAGCATAAGTACTGAA 55 ASPV2FASPV2F CAAAGAGTTTAAGTTTGAAACAAGGTATGCCAAAGAGTTTAAGTTTGAAACAAGGTATGC 258258 66 ASPV2RASPV2R TTAATCAATTATTTCCTAATGGATAGAACATTAATCAATTATTTCCTAATGGATAGAACA 33 ASGV1FASGV1F GTAGGAGTGTATCTCTGGAAGACTCACATAGACCCGTAGGAGTGTATCTCTGGAAGACTCACATAGACCC 143143 ASGVASGV 44 ASGV1RASGV1R AAATATTTACAATAGTGATTGCAGAGAAGAAGGTAAAATATTTACAATAGTGATTGCAGAGAAGAAGGTA 77 ASGV2FASGV2F AGCTTTACCTTCTTCTCTGCAATCACTATTGTAGCTTTACCTTCTTCTCTGCAATCACTATTGT 180180 88 ASGV2RASGV2R CTTCCCTGACTTTCTTCTCTTCTTCAGTTTCCCTTCCCTGACTTTCTTCTCTTCTTCAGTTTCC 99 ASGV3FASGV3F GTTTTGATACTCCACCAGTTCATTACAACTGTTTTGATACTCCACCAGTTCATTACAACT 199199 1010 ASGV3RASGV3R CGGAACGTACATTCGTTCAGAGAGTTCTGCCGGAACGTACATTCGTTCAGAGAGTTCTGC

실험예 1. RT-RPA 반응 가부 확인Experimental Example 1. Confirmation of RT-RPA reaction

상기 제조예에서 제작한 프라이머 세트를 사용하여 RT-RPA(Twist Amp basic RT kit, TwistDx Limited)를 진행하였다.RT-RPA (Twist Amp basic RT kit, TwistDx Limited) was performed using the primer set prepared in Preparation Example.

보다 구체적으로, 마이크로 튜브에 480 nM RT-RPA 프라이머 세트, 280 mM 마그네슘 아세테이트 및 주형가닥(ASPV: 192 ng/μL, ASGV: 47 ng/μL) 1 μL를 넣고(총 부피 50 μL), 42 ℃에서 30 분 동안 배양하였다. RPA 생성물은 에티듐 브로마이드(EtBr)를 함유하는 3 % 아가로오스 겔 상에 전기영동 하였다.More specifically, 1 μL of a 480 nM RT-RPA primer set, 280 mM magnesium acetate and a template strand (ASPV: 192 ng/μL, ASGV: 47 ng/μL) was added to a micro tube (total volume 50 μL), and 42° C. Incubated for 30 minutes. The RPA product was electrophoresed on a 3% agarose gel containing ethidium bromide (EtBr).

도 2에서 확인할 수 있듯이, ASPV1F/R 및 ASGV1F/R 프라이머 세트는 예상된 사이즈(ASPV: ~146bp, ASGV: ~143bp)에서 ASPV 및 ASGV가 모두 검출되었고, 음성 대조군에서는 증폭 결과물이 생성되지 않음을 확인할 수 있었다.As can be seen in Figure 2, ASPV1F / R and ASGV1F / R primer set was detected in both ASPV and ASGV at the expected size (ASPV: ~146bp, ASGV: ~143bp), in the negative control, the amplification result was not generated. I could confirm.

반면, 도 3에서 확인할 수 있듯이, ASPV2F/R, ASGV2F/R 및 ASGV3F/R 프라이머 세트는 양성 대조군뿐만 아니라 음성 대조군에서도 증폭되었고, 증폭하고자 하는 부분 이외 다른 부분까지 비특이적인 증폭 결과물이 생성되는 것을 확인할 수 있었다.On the other hand, as can be seen in Figure 3, ASPV2F / R, ASGV2F / R and ASGV3F / R primer set was amplified not only in the positive control but also in the negative control, it was confirmed that non-specific amplification results were generated in other parts than the part to be amplified. Could

실험예 2. RT-RPA 반응의 신속성 확인Experimental Example 2. Checking the rapidity of RT-RPA reaction

상기 실험예 1의 결과를 바탕으로, ASPV1F/R 및 ASGV1F/R 프라이머 세트에 대하여, 반응 시간을 1, 3, 5, 10, 15, 20 및 30 분(t)으로 설정하고, 상기 실험예 1의 방법과 동일하게 RT-RPA를 진행하였다.Based on the results of Experimental Example 1, for the ASPV1F/R and ASGV1F/R primer sets, reaction times were set to 1, 3, 5, 10, 15, 20 and 30 minutes (t), and Experimental Example 1 RT-RPA was performed in the same manner as in

도 4a 및 도 4b에서 확인할 수 있듯이, ASPV(도 4a) 및 ASGV(도 4b) 모두 1 분만 반응하였을 때에도 예상된 사이즈에서 증폭되는 것을 확인하였다.As can be seen in FIGS. 4A and 4B, it was confirmed that both ASPV (FIG. 4a) and ASGV (FIG. 4b) were amplified at the expected size even when reacted for only 1 minute.

또한, 추가적으로 이 증폭산물을 T-vector에 클로닝한 후 염기서열을 분석하여 그 결과를 도 5a 및 5b에 나타내었다.In addition, the amplification product was additionally cloned into a T-vector, followed by nucleotide sequence analysis, and the results are shown in FIGS. 5A and 5B.

도 5a 및 5b에서 확인할 수 있듯이, ASPV 1F/R 프라이머 세트로 증폭한 증폭산물은 ASPV의 다른 분리주(isolate)들과 96 %의 상동성을 보이는 것을 확인하였으며, ASGV 1F/R 프라이머 세트로 증폭한 증폭산물은 다른 분리주들과 97 %의 상동성을 보이는 것을 확인하여, ASPV 및 ASGV 바이러스가 맞음을 확인하였다.As can be seen in Figures 5a and 5b, it was confirmed that the amplified product amplified with the ASPV 1F/R primer set showed 96% homology with other isolates of ASPV, and amplified with the ASGV 1F/R primer set. It was confirmed that the amplification product showed 97% homology with other isolates, confirming that the ASPV and ASGV viruses were correct.

실험예 3. RT-RPA 반응의 민감성 확인Experimental Example 3. Confirmation of sensitivity of RT-RPA reaction

ASPV1F/R 및 ASGV1F/R 프라이머 세트에 대하여, 기존의 PCR 방법과 RPA 방법을 비교하였다.For the ASPV1F/R and ASGV1F/R primer sets, the conventional PCR method and the RPA method were compared.

보다 구체적으로, ASPV 및 ASGV가 감염된 배 잎에서 Total RNA를 추출하고, 각각 10 배씩 차례대로 희석하여(ASPV: 192 ng/μL(1), 19.2 ng/μL(2), 1.92 ng/μL(3), 192 pg/μL(4) 및 19.2 pg/μL(5), ASGV: 47 ng/μL(1), 4.7 ng/μL(2), 0.47 ng/μL(3), 47 pg/μL(4) 및 4.7 pg/μL(5)) RT-PCR 및 RT-RPA 반응을 진행하였다. RT-RPA 반응은 상기 실험예 1의 방법과 동일하게 진행하였으며, RT-PCR은 다음과 같이 진행되었다: More specifically, Total RNA was extracted from pear leaves infected with ASPV and ASGV, and diluted 10 times each (ASPV: 192 ng/μL(1), 19.2 ng/μL(2), 1.92 ng/μL(3)). ), 192 pg/μL(4) and 19.2 pg/μL(5), ASGV: 47 ng/μL(1), 4.7 ng/μL(2), 0.47 ng/μL(3), 47 pg/μL(4 ) And 4.7 pg/μL (5)) RT-PCR and RT-RPA reactions were performed. RT-RPA reaction was carried out in the same manner as in Experimental Example 1, and RT-PCR was carried out as follows:

단계 1, 50 ℃에서 30 분; Step 1, 30 minutes at 50° C.;

단계 2, 95 ℃에서 5 분; Step 2, 5 min at 95° C.;

단계 3, 30 초 동안 95 ℃, 30 초 동안 56 ℃, 40 초 동안 72 ℃의 35 사이클; Step 3, 35 cycles of 95° C. for 30 seconds, 56° C. for 30 seconds, and 72° C. for 40 seconds;

단계 4, 72 ℃에서 5 분.Step 4, 5 min at 72 °C.

도 6에서 확인할 수 있듯이, RT-RPA 반응은 적어도 192 pg/μL의 RNA(10-4 배 희석)를 함유한 ASPV 감염 샘플 및 적어도 4.7 ng/μL의 RNA(10-2 배 희석)를 함유한 ASPV 감염 샘플에서 일관된 양성 결과가 나타났다. As can be seen in Figure 6, the RT-RPA reaction is an ASPV infection sample containing at least 192 pg/μL of RNA (10 -4 fold dilution) and at least 4.7 ng/μL of RNA (10 -2 fold dilution). Consistent positive results were found in ASPV infected samples.

반면, RT-PCR 반응은 적어도 1.92 ng/μL의 RNA(10-3 배 희석)를 함유한 ASPV 감염 샘플 및 적어도 4.7 ng/μL의 RNA(10-2 배 희석)를 함유한 ASGV 감염 샘플에서 일관된 양성 결과가 나타났다.In contrast, RT-PCR responses were consistent in ASPV infected samples containing at least 1.92 ng/μL of RNA (10 -3 fold dilution) and ASGV infected samples containing at least 4.7 ng/μL of RNA (10 -2 fold dilution). A positive result was found.

이러한 결과는, 특히 ASPV 검출에 있어서, RT-PCR 방법에 비해 RT-RPA 방법의 민감도가 10 배 더 높음을 의미한다.These results mean that the sensitivity of the RT-RPA method is 10 times higher than that of the RT-PCR method, especially in the detection of ASPV.

실험예 4. 식물 잎 및 묘목(껍질)의 즙(액)에서 RT-RPA 반응 가부 확인Experimental Example 4. Confirmation of RT-RPA reaction in the juice (liquid) of plant leaves and seedlings (shell)

상기 실험예 4의 결과를 바탕으로, ASPV1F/R 및 ASGV1F/R 프라이머 세트에 대하여, 바이러스에 감염된 식물 잎 및 묘목(껍질)에서 즙을 내어 바로 RPA 반응을 진행하여 RT-RPA 반응 가부를 확인하고, 그 결과를 도 7a 및 7b에 나타내었다.Based on the results of Experimental Example 4, with respect to the ASPV1F/R and ASGV1F/R primer sets, extract juice from virus-infected plant leaves and seedlings (shells) and immediately proceed with the RPA reaction to confirm the RT-RPA reaction. , The results are shown in Figs. 7a and 7b.

도 7a 및 7b에서 확인할 수 있듯이, 식물 잎(도 7a, ASPV1F/R 프라이머 세트 한정) 및 껍질(도 7b) 모두에서 기존의 복잡하고 시간이 오래 소요되는 RNA 추출 과정 없이도 예상된 사이즈에서 증폭되는 것을 확인하였다.As can be seen in Figs. 7a and 7b, both plant leaves (Fig. 7a, ASPV1F/R primer set only) and shells (Fig. 7b) are amplified at the expected size without the existing complicated and time-consuming RNA extraction process. Confirmed.

이 증폭산물 또한 상기 실험예 2와 동일한 방법으로 T-vector에 클로닝한 후 염기서열을 확인해본 결과, 각각 다른 분리주들과 96 및 97 %의 상동성을 보이는 것을 확인하여, ASPV 및 ASGV 바이러스가 맞음을 확인하였다(도 8a 및 도 8b 참조).This amplification product was also cloned into a T-vector in the same manner as in Experimental Example 2, and as a result of checking the nucleotide sequence, it was confirmed that it showed 96 and 97% homology with the other isolates, so that ASPV and ASGV viruses are correct. Was confirmed (see FIGS. 8A and 8B).

소결Sintering

상기 내용을 종합한 결과, 본 발명의 프라이머 쌍을 이용한 RT-RPA 방법은 RT-PCR 방법과 비교하여, ASPV 및 ASGV의 검출에 대한 높은 민감도와 특이성을 나타낸다.As a result of synthesizing the above, the RT-RPA method using the primer pair of the present invention exhibits high sensitivity and specificity for detection of ASPV and ASGV as compared to the RT-PCR method.

<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Primer composition for recombinase polymerase amplification <130> PN180139D <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ASPV1F <400> 1 tcaatggagg gtacccaggc tgttaatttt 30 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ASPV1R <400> 2 tcaactttac taaaaagcat aagtactgaa 30 <210> 3 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> ASGV1F <400> 3 gtaggagtgt atctctggaa gactcacata gaccc 35 <210> 4 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> ASGV1R <400> 4 aaatatttac aatagtgatt gcagagaaga aggta 35 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ASPV2F <400> 5 caaagagttt aagtttgaaa caaggtatgc 30 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ASPV2R <400> 6 ttaatcaatt atttcctaat ggatagaaca 30 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> ASGV2F <400> 7 agctttacct tcttctctgc aatcactatt gt 32 <210> 8 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> ASGV2R <400> 8 cttccctgac tttcttctct tcttcagttt cc 32 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ASGV3F <400> 9 gttttgatac tccaccagtt cattacaact 30 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ASGV3R <400> 10 cggaacgtac attcgttcag agagttctgc 30 <110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Primer composition for recombinase polymerase amplification <130> PN180139D <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ASPV1F <400> 1 tcaatggagg gtacccaggc tgttaatttt 30 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ASPV1R <400> 2 tcaactttac taaaaagcat aagtactgaa 30 <210> 3 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> ASGV1F <400> 3 gtaggagtgt atctctggaa gactcacata gaccc 35 <210> 4 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> ASGV1R <400> 4 aaatatttac aatagtgatt gcagagaaga aggta 35 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ASPV2F <400> 5 caaagagttt aagtttgaaa caaggtatgc 30 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ASPV2R <400> 6 ttaatcaatt atttcctaat ggatagaaca 30 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> ASGV2F <400> 7 agctttacct tcttctctgc aatcactatt gt 32 <210> 8 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> ASGV2R <400> 8 cttccctgac tttcttctct tcttcagttt cc 32 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ASGV3F <400> 9 gttttgatac tccaccagtt cattacaact 30 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ASGV3R <400> 10 cggaacgtac attcgttcag agagttctgc 30

Claims (9)

서열번호 1의 염기서열로 이루어진 정방향 프라이머 및 서열번호 2의 염기서열로 이루어진 역방향 프라이머로 이루어진 제1 RPA(Recombinase polymerase amplification) 프라이머 세트를 포함하는 사과 줄기 구멍 바이러스(Apple stem pitting virus; ASPV) 검출용 조성물.For detection of apple stem pitting virus (ASPV) comprising a first RPA (Recombinase polymerase amplification) primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 2 Composition. 제1항의 조성물을 포함하는 고접병(stem pitting) 진단용 키트.A kit for diagnosing stem pitting comprising the composition of claim 1. 하기의 단계를 포함하는 고접병(stem pitting)의 진단방법:
제1항의 조성물을 이용하여 시료로부터 재조합-중합효소 증폭법(Recombinase polymerase amplification; RPA) 증폭산물을 수득하는 증폭 단계; 및
RPA 증폭산물을 분석하는 분석 단계.
Diagnosis method of stem pitting comprising the following steps:
An amplification step of obtaining a recombinase polymerase amplification (RPA) amplification product from a sample using the composition of claim 1; And
Analysis step to analyze the RPA amplification product.
제3항에 있어서, 상기 분석 단계는 RPA 증폭산물 중 146 bp의 증폭산물의 포함여부를 확인하는 것인, 고접병의 진단방법.The method of claim 3, wherein the analyzing step is to confirm whether the amplification product of 146 bp is included in the RPA amplification product. 서열번호 3의 염기서열로 이루어진 정방향 프라이머 및 서열번호 4의 염기서열로 이루어진 역방향 프라이머로 이루어진 제2 RPA(Recombinase polymerase amplification) 프라이머 세트를 포함하는 사과 줄기 홈 바이러스(Apple stem grooving virus; ASGV) 검출용 조성물.For detection of apple stem grooving virus (ASGV) comprising a second RPA (Recombinase polymerase amplification) primer set consisting of a forward primer consisting of the nucleotide sequence of SEQ ID NO: 3 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 4 Composition. 제5항의 조성물을 포함하는 배잎검은점병(black necrotic leaf spot) 진단용 키트.A kit for diagnosing black necrotic leaf spot comprising the composition of claim 5. 하기의 단계를 포함하는 배잎검은점병(black necrotic leaf spot)의 진단방법:
제5항의 조성물을 이용하여 시료로부터 재조합-중합효소 증폭법(Recombinase polymerase amplification; RPA) 증폭산물을 수득하는 증폭 단계; 및
RPA 증폭산물을 분석하는 분석 단계.
Diagnosis method of black necrotic leaf spot comprising the following steps:
An amplification step of obtaining a Recombinase polymerase amplification (RPA) amplification product from a sample using the composition of claim 5; And
Analysis step to analyze the RPA amplification product.
제7항에 있어서, 상기 분석 단계는 RPA 증폭산물 중 143 bp의 증폭산물의 포함여부를 확인하는 것인, 배잎검은점병의 진단방법.The method of claim 7, wherein the analyzing step is to determine whether the RPA amplification product contains a 143 bp amplification product. 제3항 또는 제7항에 있어서, 상기 시료는 배 나무 또는 묘목의 껍질, 잎, 열매, 줄기 및 뿌리로 이루어진 군에서 선택된 1종 이상인 것인, 진단방법.The diagnostic method according to claim 3 or 7, wherein the sample is at least one selected from the group consisting of bark, leaves, fruits, stems and roots of pear trees or seedlings.
KR1020200046090A 2020-04-16 2020-04-16 Primer composition for recombinase polymerase amplification reaction for detecting pear viruses and use thereof KR102198421B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020200046090A KR102198421B1 (en) 2020-04-16 2020-04-16 Primer composition for recombinase polymerase amplification reaction for detecting pear viruses and use thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020200046090A KR102198421B1 (en) 2020-04-16 2020-04-16 Primer composition for recombinase polymerase amplification reaction for detecting pear viruses and use thereof

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
KR1020180063644A Division KR20190137448A (en) 2018-06-01 2018-06-01 Primer composition for recombinase polymerase amplification reaction for detecting pear viruses and use thereof

Publications (2)

Publication Number Publication Date
KR20200043345A KR20200043345A (en) 2020-04-27
KR102198421B1 true KR102198421B1 (en) 2021-01-06

Family

ID=70467671

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020200046090A KR102198421B1 (en) 2020-04-16 2020-04-16 Primer composition for recombinase polymerase amplification reaction for detecting pear viruses and use thereof

Country Status (1)

Country Link
KR (1) KR102198421B1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017532026A (en) * 2014-09-11 2017-11-02 アグロフレッシュ インコーポレイテッド Methods for pathogen detection and disease management on meat, plants or plant parts

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101678851B1 (en) 2015-04-24 2016-11-23 충남대학교산학협력단 Primer set for diagnosing or detecting Plantain mottle virus and uses thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2017532026A (en) * 2014-09-11 2017-11-02 アグロフレッシュ インコーポレイテッド Methods for pathogen detection and disease management on meat, plants or plant parts

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
국립원예특작과학원 보고서, 과수 바이러스 무병묘 생산 보급 및 안전관리 체계화 연구, (2014.02.28.)*
김대현, 과수 바이러스 주요특성 및 무병묘 생산기술, 농촌진흥청 발표자료, (2016.06.10.)*

Also Published As

Publication number Publication date
KR20200043345A (en) 2020-04-27

Similar Documents

Publication Publication Date Title
Ragozzino et al. Development of a one tube-one step RT-PCR protocol for the detection of seven viroids in four genera: Apscaviroid, Hostuviroid, Pelamoviroid and Pospiviroid
KR101771964B1 (en) PCR primer for multiplex diagnosing infectious 4 virus to Chinese cabbages and method for detecting virus using the same
KR102424329B1 (en) Primer Set for recombinase polymerase amplification reaction for detecting Tomato spotted wilt virus and Method for detecting Tomato spotted wilt virus using the same
Du et al. Quantitative detection and monitoring of Colletotrichum siamense in rubber trees using real-time PCR
KR101857684B1 (en) Primers and probe for detection of middle east respiratory syndrome coronavirus and detecting method for middle east respiratory syndrome coronavirus using the same
KR20200017196A (en) Primer set for multiple detection apple and pear viruses and viroid and method for detecting said viruses and viroid using the same
KR102198421B1 (en) Primer composition for recombinase polymerase amplification reaction for detecting pear viruses and use thereof
KR102146421B1 (en) Primer set for simultaneously diagnosing viruses of Ligusticum chuanxiong and Cnidium officinale, method for diagnosing viruses of Ligusticum chuanxiong and Cnidium officinale by using the same and kit using the same
KR101459616B1 (en) Primer set for detecting viruses in sweet potato and method for detecting simultaneously said viruses using the same
KR102144834B1 (en) Primer Set for recombinase polymerase amplification reaction and detecting Cucurbitaceae and Method for diagnosing Cucurbitaceae virus disease using the same
CN111850155A (en) Application of specific target primer in simultaneous and rapid identification of two pathogenic bacteria of strawberry infection
KR102468692B1 (en) Primer Set for recombinase polymerase amplification reaction for detecting Pooideae virus and Method for diagnosing Pooideae virus disease using the same
KR102318379B1 (en) Marker composition for rapid and simultaneous detecting Erwinia amylovora and Erwinia pyrifoliae
KR102175124B1 (en) Primers for multiple detection of the virus in Cucurbitaceae and detection method by using the same
KR20190137448A (en) Primer composition for recombinase polymerase amplification reaction for detecting pear viruses and use thereof
KR102212379B1 (en) Primer set for simultaneous detection of three viruses in Grapevine and method for detecting three viruses in Grapevine using the same
KR102228116B1 (en) Primer Set for detecting apple stem grooving virus and method for diagnosing apple stem grooving virus disease using the same
KR102429938B1 (en) Primer Set for recombinase polymerase amplification reaction for detecting stone fruits virus and Method for diagnosing stone fruits virus disease using the same
KR100943329B1 (en) Detecting Kit and Detecting Method for Diagnosis of Citrus viroid
KR101750837B1 (en) Primer set for multiple detection MNSV, SqMV, WMV, and CABYV and method for detecting said viruses using the same
KR102487657B1 (en) Primer set for detecting Mythimna loreyi and detection method using the same
KR20190072945A (en) Primer set for Multiplex RT-PCR of Proso millet or Foxtail millet Viruses and use thereof
KR101491776B1 (en) Specific primer pair for rapid detection of Fusarium verticillioides, a causal agent of corn ear rot, and method for detecting Fusarium verticillioides using the same
KR102121954B1 (en) Primer set for determining cucumber mosaic virus infection of Capsicum annuum
KR102239384B1 (en) A primer composition for detection of two kinds of Anguillid viruses and diagnostic kit comprising the same

Legal Events

Date Code Title Description
A107 Divisional application of patent
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant