KR102198421B1 - Primer composition for recombinase polymerase amplification reaction for detecting pear viruses and use thereof - Google Patents

Abstract

The present invention relates to a composition for detecting pear virus, a diagnostic kit including the same, and a method for diagnosing pear virus disease using the same.
In the case of using the composition, kit, and diagnostic method of the present invention, since RNA can be amplified immediately without the existing difficult and time-consuming RNA extraction process, it is more convenient and faster than the RT-PCR method. It can be usefully used for diagnosis of pear viral disease.

Description

Primer composition for recombinase polymerase amplification reaction for detecting pear viruses and use thereof

The present invention relates to a composition for detecting pear virus, a diagnostic kit including the same, and a method for diagnosing pear virus disease using the same, specifically, a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2 A composition for detecting a embryo virus comprising a first primer set or a second primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 3 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 4, a diagnostic kit containing the same, and It relates to a method for diagnosing pear virus disease.

Due to global warming, the emergence and damage of new viruses is increasing rapidly. Among them, unlike other plant diseases caused by fungi or bacteria, chemical control is impossible, and there are few environmentally friendly control methods, but the effect is not great. Therefore, it is important to reduce damage to crops and prevent the spread of the disease through rapid diagnosis rather than control of plant virus diseases.

The domestic fruit tree virus infection rate is as high as 30-60%, and its competitiveness is weak because the quality of fruit tree production decreases by 20-40%, sugar content decreases, and malformations occur due to infection (Rural Development Administration Institute of Horticultural Science). In particular, in a situation where openness is accelerating, fruit trees infected with viruses degrade the competitiveness of the fruit industry. Among them, the virus infection rate of ships is 29% (the lowest infection rate), and the damage is also increasing.

Meanwhile, major viruses that occur in Korean pears include Apple chlorotic leafspot virus (ACLSV), Apple stem pitting virus (ASPV), and Apple stem grooving virus (ASGV). have.

Previously, a polymerase chain reaction (PCR) technique was used to detect and diagnose these viruses. However, since PCR requires special equipment and takes a long time, an average of 90 minutes, it is difficult to detect and diagnose quickly.

Korean Patent Publication No. 10-2016-0126654

The present inventors have made intensive research efforts to develop a simpler and faster method for detecting and diagnosing pear virus. As a result, a first primer set consisting of a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2 or a forward primer consisting of the nucleotide sequence of SEQ ID NO: 3 and a nucleotide sequence of SEQ ID NO: 4 In the case of using the RT-RPA method using a second primer set consisting of reverse primers, it was found that RNA can be amplified immediately without the RNA extraction process, thereby completing the present invention.

Accordingly, an object of the present invention is a first primer set consisting of a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2 or a forward primer consisting of the nucleotide sequence of SEQ ID NO: 3, and the It is to provide a composition for detecting a embryo virus comprising a second primer set consisting of a reverse primer consisting of a base sequence.

Another object of the present invention is a first primer set consisting of a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2 or a forward primer consisting of the nucleotide sequence of SEQ ID NO: 3 and a base of SEQ ID NO: 4 It is to provide a kit for diagnosing embryo virus disease comprising a composition for detecting embryo virus comprising a second primer set consisting of a reverse primer consisting of a sequence.

Another object of the present invention is to provide a method for diagnosing pear virus disease.

The present inventors have made intensive research efforts to develop a simpler and faster method for detecting and diagnosing pear virus. As a result, a first primer set consisting of a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2 or a forward primer consisting of the nucleotide sequence of SEQ ID NO: 3 and a nucleotide sequence of SEQ ID NO: 4 In the case of using the RT-RPA method using a second primer set consisting of reverse primers, it was found that RNA can be amplified immediately without the RNA extraction process.

The present invention relates to a composition for detecting pear virus, a diagnostic kit including the same, and a method for diagnosing pear virus disease using the same, and a first consisting of a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2 A composition for detecting embryo virus comprising a primer set or a second primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 3 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 4, a diagnostic kit containing the same, and a pear virus disease using the same It is about the diagnosis method.

Hereinafter, the present invention will be described in more detail.

One aspect of the present invention is a first primer set consisting of a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2, or a forward primer consisting of the nucleotide sequence of SEQ ID NO: 3 and a base of SEQ ID NO: 4 It relates to a composition for detecting embryonic virus comprising a second primer set consisting of a reverse primer consisting of a sequence.

In the present invention, the term "primer" is a nucleic acid sequence having a short free 3'hydroxyl group and can form a base pair with a complementary template of a plant nucleic acid, and template strand copying is performed. It refers to a short nucleic acid sequence that functions as a starting point for.

The first primer set may be a primer set for detecting apple stem pitting virus (ASPV).

In the present invention, the term "Apple stem pitting virus (ASPV)" is one of the causative bacteria of pear virus disease (high fever), and trees infected with ASPV exhibit general debilitating symptoms and have smaller leaves, gradually yellowing, early It shows symptoms such as fallen leaves. In addition, a lot of flowers bloom and the fruits become smaller, and if you cut the stem horizontally, you can see the rings with radial furrows.

The ASPV is amplified by the first primer set of the present invention to represent an amplification product of 146 bp, and can be detected through the amplification product.

The second primer set may be a primer set for detecting apple stem grooving virus (ASGV).

In the present invention, the term "Apple stem grooving virus (ASGV)" is one of the causative bacteria of pear virus disease (pear leaf black spot), and as a tree infected with ASGV forms small dark brown spots on the leaves, it gradually progresses. A circular or irregular lesion is formed. When the lesion is old, it turns gray, sometimes torn and becomes dirty, and it is very difficult to distinguish due to the occurrence of mixed with various spots or black spots in late growth.

The ASGV is amplified by the second primer set of the present invention to represent an amplification product of 143 bp, and can be detected through the amplification product.

The amplification may be performed by any method used to amplify an amplification target (gene, etc.) in the art, for example, by recombinant-polymerase amplification (RPA), but , But is not limited thereto.

The amplification product may be, for example, an amplicon, but is not limited thereto.

In the present specification, the term "recombinant-polymerase amplification method" refers to a technology that can confirm DNA and RNA amplification, and unlike conventional PCR, a target sequence (target sequence) using a DNA-binding protein and a recombinase is used. It is a technology that can amplify the sequence). Since the RPA method can be amplified even under isothermal conditions using mesophilic polymerase, it has the advantage of detecting and diagnosing viruses in a short time with only an isothermal device without special equipment.

Another aspect of the present invention is a first primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 2 or a forward primer consisting of the nucleotide sequence of SEQ ID NO: It relates to a kit for diagnosing embryo virus disease comprising a composition for detecting embryo virus comprising a second primer set consisting of a reverse primer consisting of a base sequence.

In the present invention, the term "pear viral disease" refers to a disease that occurs in the stomach due to virus infection, and specifically, at least one selected from the group consisting of stem pitting and black necrotic leaf spot However, it is not limited thereto.

The composition for detecting pear virus comprising the first primer set may be used to diagnose hyperplasia.

The composition for detecting pear virus including the second primer set may be used to diagnose pear leaf black spot.

The composition for detecting a pear virus comprising the mixture may be used to diagnose hyperplasia or black spot of pear leaf.

The kit may be used to detect embryonic virus from a sample, but is not particularly limited, but not only the first primer set and/or the second primer set, but also one or more other component compositions, solutions, or devices suitable for the assay method. May be included.

The sample may be, for example, a bark, leaf, fruit, stem, or root of a pear tree (seedling), but is not limited thereto.

Specifically, the kit may be a kit containing the essential elements necessary to perform the RPA analysis, and in addition to each of the primer sets, a test tube or other suitable container, a reaction buffer (various pH and magnesium concentration), deoxynucleotide (dNTPs), enzymes such as Taq-polymerase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like.

When the kit is used for RPA analysis, the RPA amplification product can be obtained directly from the sample without the need to separately obtain cDNA, and can be separated by a method such as agarose gel electrophoresis, and the primer set used By confirming the presence of a DNA having a length corresponding to the DNA polymerized by, embryo virus disease can be diagnosed.

In particular, in the case of a diagnostic kit including two or more primer sets, diagnosis using each primer set may be performed separately, or diagnosis may be performed by mixing a plurality of primer sets in one reaction.

The kit is not limited to a specific form, and may be implemented in various forms. For example, the kit may include a lyophilized primer set contained in a container (eg, disposable RPA tube, etc.). When two or more primer sets are included, a plurality of primer sets may be mixed and contained in an RPA tube, or each primer set may be individually contained in each RPA tube.

That is, in the case of a diagnostic kit including two primer sets, a disposable RPA tube in which one of the first primer set or the second primer set is contained in the form of freeze-dried powder may be included in the diagnostic kit, and the first A disposable RPA tube in which the primer set and the second primer set are mixed in a freeze-dried powder form may be included in the diagnostic kit.

Another aspect of the present invention relates to a method for diagnosing embryonic virus disease comprising the following steps.

An amplification step of obtaining a recombinase polymerase amplification (RPA) amplification product from the sample using the composition of claim 1; And

Analysis step to analyze the RPA amplification product.

In the present specification, the term "recombinant-polymerase amplification method" refers to a technology that can confirm DNA and RNA amplification, and unlike conventional PCR, a target sequence (target sequence) using a DNA-binding protein and a recombinase is used. It is a technology that can amplify the sequence). Since the RPA method can be amplified even under isothermal conditions using mesophilic polymerase, it has the advantage of detecting and diagnosing viruses in a short time with only an isothermal device without special equipment.

In the above analysis step, when a 146 bp amplification product is obtained, it may be determined that the sample is infected with ASPV, and when a 143 bp amplification product is obtained, it may be determined that the sample is infected with ASGV.

The sample may be, for example, a bark, leaf, fruit, stem, or root of a pear tree (seedling), but is not limited thereto.

The amplification product may be, for example, an amplicon, but is not limited thereto.

The overlapping contents of the composition for detecting embryo virus including the first primer set or the second primer set and the kit for diagnosing embryo virus including the same are omitted in consideration of the complexity of the present specification.

On the other hand, because infected embryonic tissues are rich in phenolic compounds, carbohydrates, pigments and other unknown compounds, it is very difficult to isolate RNA from them.

However, since the RT-RPA method using the primer set of the present invention can amplify RNA directly without the existing difficult and time-consuming RNA extraction process, the reaction proceeds directly by extracting juice (liquid) from plant leaves. , It can be usefully used for detecting viruses more simply and quickly.

The present invention relates to a composition for detecting pear virus, a diagnostic kit including the same, and a method for diagnosing pear virus disease using the same, specifically, a forward primer consisting of the nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 2 A composition for detecting a embryo virus comprising a first primer set or a second primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 3 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 4, a diagnostic kit containing the same, and It relates to a method for diagnosing pear virus disease.

The RT-RPA method using the primer set of the present invention enables the amplification of RNA directly without the existing difficult and time-consuming RNA extraction process, so by taking the juice (liquid) from the plant leaf and proceeding the reaction directly, It can be usefully used for simple and rapid virus detection.

1A is a graph showing multiple sequence alignment of envelope proteins (CP) of apple stem pore virus (ASPV).
1B is a graph showing multiple sequence alignment of envelope proteins (CP) of apple stem home virus (ASGV).
2A is a photograph of pear leaves infected with ASPV (left) and ASGV (right).
Figure 2b is a diagram confirming the RT-RPA reaction results using the ASPV1F / R and ASGV1F / R primers according to an embodiment of the present invention.
Figure 3 is a diagram confirming the RT-RPA reaction results using the ASPV2F / R, ASGV2F / R and ASGV3F / R primers according to an embodiment of the present invention.
Figure 4a is a diagram confirming the RT-RPA reaction results over time (1, 3, 5, 10, 15, 20 and 30 minutes) using the ASPV1F / R primer according to an embodiment of the present invention.
Figure 4b is a diagram confirming the RT-RPA reaction results over time (1, 3, 5, 10, 15, 20 and 30 minutes) using the ASGV1F / R primer according to an embodiment of the present invention.
5A is a diagram illustrating the nucleotide sequence of an RT-RPA reaction amplification product using an ASPV1F/R primer according to an embodiment of the present invention.
5B is a diagram illustrating the nucleotide sequence of an RT-RPA reaction amplification product using an ASGV1F/R primer according to an embodiment of the present invention.
6 is a diagram comparing RT-RPA reaction and RT-PCR reaction results using ASPV1F/R and ASGV1F/R primers according to an embodiment of the present invention.
Figure 7a is a diagram confirming the RT-RPA reaction result in the juice (liquid) of pear leaf using the ASPV1F / R primer according to an embodiment of the present invention.
Figure 7b is a diagram confirming the RT-RPA reaction results in the juice (liquid) of pear tree (seedling) bark using the ASPV1F / R primer and the ASGV1F / R primer according to an embodiment of the present invention.
8A is a diagram illustrating the nucleotide sequence of an RT-RPA reaction amplification product using an ASPV1F/R primer according to an embodiment of the present invention.
8B is a diagram illustrating the nucleotide sequence of an RT-RPA reaction amplification product using an ASGV1F/R primer according to an embodiment of the present invention.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Manufacturing example. Preparation of primer set

5 areas of pear production in Korea (Naju, Chungnam, Sangju, Gyeongbuk, Ulsan, Gyeongnam, and Namyangju, Gyeonggi) were selected, and 158 pear viral symptoms such as leaf chlorosis and necrotic spots were selected. Leaf samples were taken.

Total RNA was extracted from leaf tissue using an IQeasy+ plant RNA extraction mini kit (iNtRON, Korea). Samples positive for single apple stem grooving virus (ASGV) or apple stem pitting virus (ASPV) infection were selected and stored at -80°C for use as an RT-RPA assay template.

Next, a sequence of 5 ASGV isolates and 3 ASPV isolates separated for each of the 5 regions was obtained. Based on the obtained nucleotide sequences of ASGV and ASPV, the preserved nucleotide sequence portion was confirmed.

More specifically, multiple sequence alignment of the nucleotide sequence (GenBank LC367338, LC367340, LC367341, AF345893, D21829 and KF915809) of the coat protein (CP) of ASPV and base of the coat protein of ASGV Multisequencing of the sequences (MG682506, MG682507, MG682508, MG682509, MG682510, JN792471, LC084659, KX955001, KF735124, LC184610, LC143387, KR185346, KU198289, LC184611, AB004603, KJ579253 and GQ330294), in highly conserved regions (Figure 1b). Was selected, and a primer set for RT-RPA was prepared using this.

The prepared primer set is shown in Table 1 below.

Sequence number denomination Base sequence (5’-3’) Expected amplicon length
(Expected amplicon length, nt) virus One ASPV1F TCAATGGAGGGTACCCAGGCTGTTAATTTT 146 ASPV 2 ASPV1R TCAACTTTACTAAAAAGCATAAGTACTGAA 5 ASPV2F CAAAGAGTTTAAGTTTGAAACAAGGTATGC 258 6 ASPV2R TTAATCAATTATTTCCTAATGGATAGAACA 3 ASGV1F GTAGGAGTGTATCTCTGGAAGACTCACATAGACCC 143 ASGV 4 ASGV1R AAATATTTACAATAGTGATTGCAGAGAAGAAGGTA 7 ASGV2F AGCTTTACCTTCTTCTCTGCAATCACTATTGT 180 8 ASGV2R CTTCCCTGACTTTCTTCTCTTCTTCAGTTTCC 9 ASGV3F GTTTTGATACTCCACCAGTTCATTACAACT 199 10 ASGV3R CGGAACGTACATTCGTTCAGAGAGTTCTGC

Experimental Example 1. Confirmation of RT-RPA reaction

RT-RPA (Twist Amp basic RT kit, TwistDx Limited) was performed using the primer set prepared in Preparation Example.

More specifically, 1 μL of a 480 nM RT-RPA primer set, 280 mM magnesium acetate and a template strand (ASPV: 192 ng/μL, ASGV: 47 ng/μL) was added to a micro tube (total volume 50 μL), and 42° C. Incubated for 30 minutes. The RPA product was electrophoresed on a 3% agarose gel containing ethidium bromide (EtBr).

As can be seen in Figure 2, ASPV1F / R and ASGV1F / R primer set was detected in both ASPV and ASGV at the expected size (ASPV: ~146bp, ASGV: ~143bp), in the negative control, the amplification result was not generated. I could confirm.

On the other hand, as can be seen in Figure 3, ASPV2F / R, ASGV2F / R and ASGV3F / R primer set was amplified not only in the positive control but also in the negative control, it was confirmed that non-specific amplification results were generated in other parts than the part to be amplified. Could

Experimental Example 2. Checking the rapidity of RT-RPA reaction

Based on the results of Experimental Example 1, for the ASPV1F/R and ASGV1F/R primer sets, reaction times were set to 1, 3, 5, 10, 15, 20 and 30 minutes (t), and Experimental Example 1 RT-RPA was performed in the same manner as in

As can be seen in FIGS. 4A and 4B, it was confirmed that both ASPV (FIG. 4a) and ASGV (FIG. 4b) were amplified at the expected size even when reacted for only 1 minute.

In addition, the amplification product was additionally cloned into a T-vector, followed by nucleotide sequence analysis, and the results are shown in FIGS. 5A and 5B.

As can be seen in Figures 5a and 5b, it was confirmed that the amplified product amplified with the ASPV 1F/R primer set showed 96% homology with other isolates of ASPV, and amplified with the ASGV 1F/R primer set. It was confirmed that the amplification product showed 97% homology with other isolates, confirming that the ASPV and ASGV viruses were correct.

Experimental Example 3. Confirmation of sensitivity of RT-RPA reaction

For the ASPV1F/R and ASGV1F/R primer sets, the conventional PCR method and the RPA method were compared.

More specifically, Total RNA was extracted from pear leaves infected with ASPV and ASGV, and diluted 10 times each (ASPV: 192 ng/μL(1), 19.2 ng/μL(2), 1.92 ng/μL(3)). ), 192 pg/μL(4) and 19.2 pg/μL(5), ASGV: 47 ng/μL(1), 4.7 ng/μL(2), 0.47 ng/μL(3), 47 pg/μL(4 ) And 4.7 pg/μL (5)) RT-PCR and RT-RPA reactions were performed. RT-RPA reaction was carried out in the same manner as in Experimental Example 1, and RT-PCR was carried out as follows:

Step 1, 30 minutes at 50° C.;

Step 2, 5 min at 95° C.;

Step 3, 35 cycles of 95° C. for 30 seconds, 56° C. for 30 seconds, and 72° C. for 40 seconds;

Step 4, 5 min at 72 °C.

As can be seen in Figure 6, the RT-RPA reaction is an ASPV infection sample containing at least 192 pg/μL of RNA (10 ^-4 fold dilution) and at least 4.7 ng/μL of RNA (10 ^-2 fold dilution). Consistent positive results were found in ASPV infected samples.

In contrast, RT-PCR responses were consistent in ASPV infected samples containing at least 1.92 ng/μL of RNA (10 ^-3 fold dilution) and ASGV infected samples containing at least 4.7 ng/μL of RNA (10 ^-2 fold dilution). A positive result was found.

These results mean that the sensitivity of the RT-RPA method is 10 times higher than that of the RT-PCR method, especially in the detection of ASPV.

Experimental Example 4. Confirmation of RT-RPA reaction in the juice (liquid) of plant leaves and seedlings (shell)

Based on the results of Experimental Example 4, with respect to the ASPV1F/R and ASGV1F/R primer sets, extract juice from virus-infected plant leaves and seedlings (shells) and immediately proceed with the RPA reaction to confirm the RT-RPA reaction. , The results are shown in Figs. 7a and 7b.

As can be seen in Figs. 7a and 7b, both plant leaves (Fig. 7a, ASPV1F/R primer set only) and shells (Fig. 7b) are amplified at the expected size without the existing complicated and time-consuming RNA extraction process. Confirmed.

This amplification product was also cloned into a T-vector in the same manner as in Experimental Example 2, and as a result of checking the nucleotide sequence, it was confirmed that it showed 96 and 97% homology with the other isolates, so that ASPV and ASGV viruses are correct. Was confirmed (see FIGS. 8A and 8B).

Sintering

As a result of synthesizing the above, the RT-RPA method using the primer pair of the present invention exhibits high sensitivity and specificity for detection of ASPV and ASGV as compared to the RT-PCR method.

<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Primer composition for recombinase polymerase amplification <130> PN180139D <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ASPV1F <400> 1 tcaatggagg gtacccaggc tgttaatttt 30 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ASPV1R <400> 2 tcaactttac taaaaagcat aagtactgaa 30 <210> 3 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> ASGV1F <400> 3 gtaggagtgt atctctggaa gactcacata gaccc 35 <210> 4 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> ASGV1R <400> 4 aaatatttac aatagtgatt gcagagaaga aggta 35 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ASPV2F <400> 5 caaagagttt aagtttgaaa caaggtatgc 30 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ASPV2R <400> 6 ttaatcaatt atttcctaat ggatagaaca 30 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> ASGV2F <400> 7 agctttacct tcttctctgc aatcactatt gt 32 <210> 8 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> ASGV2R <400> 8 cttccctgac tttcttctct tcttcagttt cc 32 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ASGV3F <400> 9 gttttgatac tccaccagtt cattacaact 30 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ASGV3R <400> 10 cggaacgtac attcgttcag agagttctgc 30

Claims (9)

For detection of apple stem pitting virus (ASPV) comprising a first RPA (Recombinase polymerase amplification) primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 2 Composition. A kit for diagnosing stem pitting comprising the composition of claim 1. Diagnosis method of stem pitting comprising the following steps:
An amplification step of obtaining a recombinase polymerase amplification (RPA) amplification product from a sample using the composition of claim 1; And
Analysis step to analyze the RPA amplification product. The method of claim 3, wherein the analyzing step is to confirm whether the amplification product of 146 bp is included in the RPA amplification product. For detection of apple stem grooving virus (ASGV) comprising a second RPA (Recombinase polymerase amplification) primer set consisting of a forward primer consisting of the nucleotide sequence of SEQ ID NO: 3 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 4 Composition. A kit for diagnosing black necrotic leaf spot comprising the composition of claim 5. Diagnosis method of black necrotic leaf spot comprising the following steps:
An amplification step of obtaining a Recombinase polymerase amplification (RPA) amplification product from a sample using the composition of claim 5; And
Analysis step to analyze the RPA amplification product. The method of claim 7, wherein the analyzing step is to determine whether the RPA amplification product contains a 143 bp amplification product. The diagnostic method according to claim 3 or 7, wherein the sample is at least one selected from the group consisting of bark, leaves, fruits, stems and roots of pear trees or seedlings.

Images