KR102195870B1 - Chaga fungus and its application - Google Patents

Abstract

The present invention is preserved in the China Normal Microbial Species Conservation Management Center, and the conservation number is CGMCC No. 14549 chaga mushroom ( Inonotus obliquus ) is provided. The present invention also provides a deep fermentation of a strain that obtains a seed liquid through seedling cultivation, shaking culture, and seed cultivation of the strain, deep fermentation of the seed liquid to obtain a fermentation broth, and sedimentation and concentration steps to obtain a fermentation product. It further provides a method of obtaining fermentation products with a furnace. The present invention further provides an application of the fermented product of Chaga fungi as a poultry feed additive and an immunity enhancer. Chaga fungus strains selected and obtained by the present invention are suitable for deep fermentation due to their stable genetic performance, high growth rate, and high production volume. When the fermentation product obtained from the above species is added to the daily feed of poultry, the productivity of the organism can be remarkably enhanced, the growth of the organism's immune system, the non-specific immune response and the specific immune response can be remarkably enhanced, and additives such as hormones. It can effectively reduce or even replace the use of and enhance poultry disease resistance.

Description

Chaga fungus and its application

The present invention belongs to the field of biotechnology and biotechnology, and specifically relates to the fermentation technology of the fungus chaga fungi and the application of the fermentation product to the production of poultry and the enhancement of immune performance.

With the improvement of people's living standards, demands for the quality of livestock products are increasing day by day, and food safety problems are constantly occurring in recent years, so the interest in zoo food safety has never been higher in the whole society. Under the background of consistently high outbreaks of poultry plague, how to reduce or even eradicate the use of antibiotics, reduce drug resistance and other toxic side effects of poultry, to realize eco-friendly and healthy poultry farming and food safety, safe, Whether to replace drugs with high-efficiency, eco-friendly new feed additives and immune enhancing agents has become the most important task in the development of aquaculture industry. Medicinal fungi have become potential research targets for new feed additives and immune enhancing agents due to their unique effects, and related studies have already shown that fungal extracts or preparations can effectively promote animal production and immune performance.

Chaga ( Inonotus obliquus ) is a kind of drug fungus, and contains abundant active ingredients such as polysaccharides, triterpenes, sterols, and total phenols, so it has been applied to diseases such as stomach cancer, colon cancer, heart disease, and diabetes by humans early on. In research, its fruiting bodies and extracts have been found to have unique therapeutic effects in human antitumor, antioxidant, immunomodulatory, hypoglycemic, antiviral, antibacterial, and antiparasite aspects. However, cultivars of Chaga fungus rarely exist and have very little fruiting body formation, so wild resources are very limited. Selection and cultivation of fungal strains and artificial cultivation are important means of acquiring high-quality Chaga fungi, but even after long-term exploration, innovative progress has not been achieved. Advances in fermentation technology have made it possible to solve resource challenges. Fermentation of fungi generally uses deep fermentation technology, which is a method of acquiring a large amount of mycelium and other metabolites by culturing microbial cells in a liquid substrate based on the improvement of aeration process technology. Fungi suitable for deep fermentation should have the following characteristics: (1) rich in mycelial protein content and capable of adapting to cultivation under liquid aeration conditions; (2) the growth rate is fast and the production rate is high; (3) It has stable dielectric characteristics and distinguishable shape characteristics. At the same time, since different strains of homologous fungi have differences in the adaptability of deep fermentation culture, the first problem to be solved in order to conduct in-depth research and product development of fungi is the selection of suitable strains.

Chaga fungi are excellent, but it is not yet clear whether suitable strains can be selected and whether the fermented products can improve poultry production and immune performance for the development of new feed additives and immune enhancing agents.

With respect to problems such as the scarcity of strains of chaga fungi suitable for deep fermentation and lack of safety, high efficiency, and eco-friendly new feed additives for poultry farming, the first object of the present invention is to provide chaga fungi suitable for deep fermentation. There is; A second object of the present invention is to provide a method for preparing the fermented product of Chaga fungus; A third object of the present invention is to provide an application of a fermented product of Chaga fungus to enhancing poultry productivity; A fourth object of the present invention is to provide an application of a fermented product of Chaga fungi as an immune enhancing agent to enhancing the immune performance of poultry.

In order to achieve the above object, the present invention has adopted the following technical solutions.

Chaga ( Inonotus obliquus ) YU, is preserved in China's Common Microbial Species Conservation Management Center, and the conservation number is CGMCC No. 14549; See SEQ No. 1 for the ITS sequence.

The method of obtaining the fermented product of Chaga mushroom includes the following steps.

(1) seedling cultivation: obtaining a seedling by inoculating and culturing chaga fungi on the slopes of a test tube;

(2) shaking culture: obtaining an inoculum solution by inoculating seedlings in a liquid medium;

(3) seed culture: inoculating the inoculum into a liquid medium in a seed tank, and fermenting with aeration stirred to obtain a seed liquid;

(4) deep fermentation: inoculating the seed liquid into the liquid medium of the fermentation tank, and performing aeration stirring fermentation;

(5) Precipitation: transferring the fermentation broth to a sedimentation tank, adding a coagulant, and filtering after precipitation to obtain a supernatant;

(6) Concentration: A step of obtaining a fermentation product by transferring the supernatant to a vacuum concentration tank and then concentrating it to a certain density.

The liquid medium contains the following ingredients (g/L): 10 starch, 10 peptone, 15 glucose, 1 potassium dihydrogen phosphate, 0.5 magnesium sulfate, 0.1 vitamin B1, and 0.2 soybean oil; Optionally, the pH of the liquid medium is 6.8-7.4.

Optionally, in step (1), the slope is potato glucose agar medium (PDA), the culture temperature is 25-28° C., and the culture time is 5-7 days.

Optionally, in step (2), the inoculation is a seedling mycelium or spore suspension; It is preferably a mycelium.

Optionally, the incubation temperature is 25-28°C; Incubation time is 3-10 days; Shaking speed is 150-200r/min.

Optionally, in step (2), the seedlings are subjected to multi-stage shaking culture to obtain an inoculum; Shake culture inoculation amount of 2 or more stages is 8-15%; It is preferable that the seedlings undergo a two-step culture to obtain an inoculum.

Optionally, in steps (3) and (4), the inoculum is 8-15%; The total volume of liquid in the tank is 50-80% of the capacity of the fermentor; Incubation temperature is 25-28°C; Incubation time is 7-15 days; The stirring speed is 100-200r/min; The aeration volume is 0.1-0.5vvm.

Optionally, in step (3), the inoculum is subjected to multi-stage seed culture to obtain a seed solution; It is preferable that the inoculum is cultured in two stages to obtain a seed solution.

In step (5), the coagulant is chitosan, and the preferred amount is 0.05-0.2% of the weight of the fermentation broth.

Preferably, the biomass of the fermentation broth in step (5) is at least 20 g/L.

As a preferred method, it is heated before precipitation and maintained for a certain period of time; More preferably, the heating temperature is 70-95°C; The warming time is 4-6h.

Optionally, in step (6) it is concentrated to reach a relative density of 1.035-1.065.

Preferably, it further comprises the step of drying the concentrate to a solid after step (6).

Application of the fermented product of Chaga fungi prepared by the above method as a poultry feed additive and an immunity enhancer.

Optionally, the amount of the fermentation product of Chaga fungus added to the poultry feed is 0.2-2 wt%; It is most preferably 0.8 wt%.

Optionally, the amount of the fermentation product of Chaga fungus added to the poultry drinking water is 0.1-5 wt%, preferably 0.5-2.0 wt%.

Poultry feed and immunity enhancer containing the fermented product of Chaga fungi prepared by the above method.

The chaga fungus YU strain selected and obtained in the present invention is suitable for deep fermentation with stable genetic performance, high growth rate, and high production, and can be used as a deep fermentation strain. When the fermentation product obtained from the above species is added to the poultry feed, the production performance of the organism can be remarkably enhanced, the average daily weight gain of the poultry can be effectively improved, and the feed consumption rate and the feed requirement rate can be reduced. The fermentation product provided by the present invention can realize a high-efficiency farming of poultry and reduce production cost; It can effectively reduce or even replace the use of additives such as hormones and antibiotics. At the same time, the improvement of non-specific immunity-related indicators, including improvement of the immune system index, enhancement of peripheral blood lymphocyte proliferation and differentiation ability, increase of antibody and neutralizing antibody titers, improvement of cell factor content and improvement of the protection rate of attack virus, It can remarkably enhance the growth of immune organs of an organism, non-specific immune response and specific immune response.

1 is an effect of breeding of fermented chaga fungi on the daily weight gain of chickens.
Figure 2 is the effect of the breeding of fermented chaga fungi on the feed requirement rate of chickens.
Figure 3 is the effect of breeding of fermented products of Astragalus polysaccharide and Chaga fungi on the daily weight gain of chickens.
Figure 4 is the effect of breeding of fermented products of Astragalus polysaccharide and Chaga fungi on the feed requirement rate of chickens.
Figure 5 is the effect of the fermented product of Chaga mushroom on the immune system index (21st).
6 is the effect of the fermented product of Chaga mushroom on the immune system index (42 days).
7 is the effect of the fermented product of Chaga mushroom on the total antioxidant capacity.
Figure 8 is the effect of the fermented product of Chaga fungi on peroxide dismutase.
9 is the effect of the fermented product of Chaga mushroom on serum lysozyme.
10 is a result of HI antibody detection.
11 is a result of detection of neutralizing antibodies.
12 is a result of detection of IL-2.
13 shows the results of IL-4 detection.
14 shows IFN-γ detection results.
15 shows the results of IFN-γ/IL-4 detection.
Species conservation information
Chaga fungus ( Inonotus obliquus ) was preserved in China's Common Microbial Species Conservation and Management Center on September 5, 2017, and its conservation address is No. 3, No. 1, Beicheon City, Chaoyang District, Beijing. It is the Microbiological Research Institute of the Chinese Academy of Sciences, Beijing, China, and the conservation number is CGMCC No. It is 14549.

The present invention is described in more detail by combining the following examples and the accompanying drawings, provided that the present invention is not limited by the following examples.

Example 1: Isolation and identification of Chaga fungi

Chaga fungus JX strain was introduced from the Biological Research Institute of Hebei Provincial Science Institute, and has already been evaluated as chaga fungi. Chaga fungus YU strain is a wild strain, and was collected in Dali City, Yunnan Province. During collection, fruiting bodies without pests and pests were collected from the surface of the tree to a depth of 1-3 cm from the surface layer of the tree, placed in a sample box, and returned to the laboratory for the next step of separation and purification. To isolate the fungus, the agaric separation method is used to first remove wood debris and foreign matter on the surface of the fruiting body with distilled water, then disinfect the surface with 75% ethanol, transfer to a super clean bench, and split the fruiting body to remove the deep tissue. Taken as aseptic, then quickly put in Rose Bengal solid medium, incubated for 3 days in a constant temperature incubator (28 ℃), the purified bacteria were transferred to the PDA solid medium, and the growth conditions of the colonies were observed daily. Afterwards, using the chaga genome extracted by the improved CTAB method as a template, PCR amplification was performed using ITS-rDNA universal primers ITS1: 5'TCCGTAGGTGAACCTGCGG3' and ITS2: 5'TCCTCCGCTTATTGATATGC3' as specific primers, and the strain was identified. I did. The ITS sequence obtained by amplification is the same as SEQ No. 1, which has more than 99% mobilization with the Chaga fungus (DQ103883) ITS-rDNA sequence in GeneBank, and the isolated wild fungus is determined as Chaga fungus and is called YU strain. Ordered. The strain was preserved at the China Common Microbial Species Conservation Management Center on September 5, 2017, and the conservation number is CGMCC No.:14549.

Example 2 : Acquisition of fermented product of Chaga mushroom

Preparation of liquid medium: Depending on the volume of the liquid medium, each of the following components (g/L): peptone 10, glucose 15, potassium dihydrogen phosphate 1, magnesium sulfate 0.5 vitamin B ₁ 0.1, soybean oil 0.2, and sterile water required Adjust the pH to 7.0 by replenishing it by volume, and sterilize it at 121°C for 30 min.

(1) Cultivation of seedlings: The strains in which the chaga fungus is preserved in Example 1 were transferred and inoculated twice on potato glucose agar medium (PDA) on the slope of the test tube, and activated for 7 days under 25°C conditions each time ( It is prepared as 母種).

(2) Shaking culture: Transfer the parent bacteria to 500 mL of first-class culture medium and incubate for 10 days, then transfer to second-class culture medium and continue incubating for 5 days, the temperature of the shaker is 28°C, and the rotation speed is 180r/min. After the culture is completed, a small amount of culture is taken, and if there are no bacteria after microscopic examination, the next step is entered.

(3) Seed cultivation: According to the amount of 10%, liquid seeds are inoculated into 7L of liquid medium, loaded into a 10L fermentation tank, and cultured under aeration at 25℃ for 10 days, and then this is a 100L fermentation tank containing 70L of liquid medium. Transfer to and incubate with aeration for 10 days at 25°C.

(4) In-depth fermentation: Transfer the fermented product to a 1000 kg fermentation tank containing 700 kg of liquid medium, and culture with aeration at 25°C for 10 days.

(5) Sedimentation: When the amount of biomass in the fermentation tank is detected as 20 g/L, fermentation is stopped, the fermentation tank is heated to 90 degrees to keep warm for 4 hours, and then the fermentation broth is transferred to the precipitation tank, and the weight of the fermentation broth is 0.1%. Chitosan was added to precipitate for 48 hours, and the supernatant was filtered using a plate frame filter.

(6) Concentration: The supernatant is transferred to a vacuum concentration tank and concentrated. When the relative density is measured to be 1.035, the fermentation product has been prepared, and the product is separated and packaged.

Example 3: In-depth fermentation performance of Chaga mushroom

The chaga fungi YU and JX strains in Example 1 were subjected to in-depth fermentation according to steps (1)-(4) in Example 2, each 100 mL of fermentation broth was taken and centrifuged, and the precipitate was collected, and ions After washing with the removed water, centrifugation was performed again, and after repeating three times, the precipitate was collected, dried under 105°C, and weighed to measure the biomass. The results are shown in Table 1, and as can be seen from the data in Table 1, the fermentation index of strain YU is the best, the hyphae form is excellent, the growth activity is strong, and the biomass increase is clear; JX strain was found to be unsuitable for deep fermentation as it showed little growth.

Liquid culture results of different strains Strain Presence or absence of various bacteria Hyphae ?荇薰?（g/L） YU radish The hyphae is thick and the inside is substantial 28.43 JX radish The hyphae are relatively thin. 2.15

Example 4: Enhancement of Poultry Production Performance of Fermented Chaga Mushrooms

4.1 Effects of Fermented Products of Chaga Mushrooms with Different Additions on Daily Weight Gain and Feed Demand in Chickens

40 1-day-old SPF chickens were divided into groups Ⅰ, Ⅱ, Ⅲ, Ⅳ, and Ⅴ, of which groups Ⅰ-Ⅳ contained 0.2%, 0.4%, 0.8%, and 2% of the fermented product of chaga fungi in Example 2. Each was added to the feed at the added amount of, and the remaining groups were used as a control, and the fermented product of Chaga fungus was not added to the daily feed. Each was bred for 42 days in a quarantine device and freely fed during the breeding period. Chickens were weighed on days 7, 14, 21, 28, 35, and 42, respectively, and fasted for 12 h before the weight measurement. The weight gain and consumed feed amount of chickens were calculated to obtain the average daily weight gain, average daily intake and feed demand at different times, and the calculation method is as follows:

Average daily weight gain (ADG) = (weight at the end of the period-weight at the beginning of the period) / number of breeding days

Average Daily Intake (ADFI) = Total Feed Consumption per Period/Number of Breeding Days

Feed conversion rate (F/G) = average daily consumption/average daily weight gain

Fig. 1 was produced using the measurement time as the abscissa and the weight gain as the ordinate; Fig. 2 was produced using the measurement time as the abscissa and the feed requirement rate as the ordinate. The results show that in the mean body weight gain index, compared with the control group, before 21 days, the fermented products of Chaga fungi with different concentrations had an accelerating effect on the weight gain of chickens; After 21 days, the weight gain effect of the other groups except group II was still higher than that of the control group. In terms of the feed conversion index, the feed conversion rates of each group were all lower than that of the control group, indicating that the Chaga fungus additive can effectively increase feed efficiency. In conclusion, the fermented product of Chaga fungus of the present invention can enhance the productivity of poultry, and the effect of the added concentration of 0.8% is most preferable.

4.2 Effects of Fermented Chaga Fungus Products and Astragalus Polysaccharides on Daily Weight Gain and Feed Demand in Chickens

Astragalus polysaccharide is an important polysaccharide immune enhancer that is currently being studied in relatively in-depth and has a relatively wide range of uses. Studies have shown that adding Astragalus polysaccharides at an appropriate concentration to feed can enhance poultry productivity. In order to more intuitively realize the effect of chaga fungi in enhancing the productivity of poultry, a comparative study of both was conducted with reference to Astragalus polysaccharides.

The experimental group was set up in two groups (I and II) and one control group (III) of 20 1-day-old SPF chickens per group. Group I added 0.8% of the fermented product of chaga fungi to the feed, and Group II added Astragalus polysaccharide (Beijing CENTRE Science and Technology Co., Ltd., recommended feed amount 0.2%) to the feed. The experimental method was as described in 4.2, and FIG. 3 was produced with the measurement time as the abscissa and the weight gain as the ordinate; Fig. 4 was produced using the measurement time as the abscissa and the feed requirement rate as the ordinate. The results showed that both additives could promote average weight gain during each experiment period and reduce feed consumption and feed demand. However, compared to each other, the effect of Chaga fungi was more pronounced. Within the experimental period of, the average weight gain of the fermented Chaga fungus group was 9.67mg higher than that of the Astragalus polysaccharide group, and the average feed conversion rate decreased by 0.156.

Example 5: Effect of Fermented Chaga Mushrooms on Immunity Enhancement of Poultry

Astragalus polysaccharides can significantly improve the immunity of animals. In order to better compare the effect of enhancing the immune performance of poultry from fermented Chaga fungi, Astragalus polysaccharide was selected as a positive control group, and the effect of the two formulations was compared. Animal experiments were divided into 7 groups (I-VII) of 20 1-day-old SPF chickens per group, and reared in isolation devices. Groups I-V were fed 0.2%, 0.4%, 0.8%, 1%, and 2% of feed containing the fermented product of Chaga fungus in Example 2, respectively, and group VI was a non-treatment group (immune enhancer in feed Was not added), and Group VII was supplied with a feed containing 0.2% Astragalus polysaccharide (Beijing CENTER Science and Technology Co., Ltd., recommended feed addition amount 0.2%). The breeding period was 24 days, and during the period, they were allowed to eat freely.

Immune organs (thyme, spleen and Fabrizius cyst) were measured on the 21st and 42nd day of breeding, respectively: After weighing the chickens, 3 animals were slaughtered in each group, and the thymus, spleen and Fabrizius cyst were collected respectively. After measuring the weight, the immune organ index was obtained according to the calculation formula of immune organ index (%) = immune organ mass/living mass × 100%. The histograms of the thymus, spleen, and Fabrizius sac of the two experimental groups were produced using the immune system index as the ordinate. The results on the 21st day are shown in Fig. 5, and the results on the 42nd day are shown in Fig. 6. In addition, on days 7, 14, 21, 28, 35 and 42, peripheral blood was separated by 5 per each experimental group, and the serum was separated by centrifugation at 3000r/min for 10min, total antioxidant capacity (T-AOC), peroxide Dismutase (SOD) and serum lysozyme (LSZ) were measured, and as shown in FIG. 7, a bar graph of T-AOC was prepared using the number of T-AOC units in serum per milliliter as the ordinate; As shown in FIGS. 8 and 9, a bar graph of SOD and LSZ was prepared using the enzyme content in serum per milliliter as the ordinate.

The results showed that at 21 days of age, different concentrations of fermented products of chaga fungi can significantly promote the development of immune organs. In the thymus index, except for group V, which was lower than the negative control group and higher than the positive control group, the remaining groups were all higher than the positive and negative control groups; The spleen index of each experimental group was significantly higher than that of both positive and negative controls; The Fabrizius cyst index is similar to the spleen index, and the difference is that the positive control group is higher than the negative control group. Comparing in the lateral direction, the indexes of each immune organ in group II were the highest, and the promotion of organ development was most remarkable at this time. At 42 days of age, the thymus index of the II-V group reached 52%, 51%, 51% and 43%, respectively, and the difference from other groups was clear (P<0.05); The spleen index of II and IV was significantly higher than that of other groups; In the Fabrizius cyst index, group III reached 0.7, which was distinct from other groups (P<0.05). Overall, except for the fact that the index of group I was slightly higher than that of the negative control group, the other added concentration groups not only had a remarkable effect of promoting the development of immune organs, but also superior to the positive control group.

Total antioxidant capacity in organ tissues is one of the important indicators reflecting the antioxidant activity of the organism, and peroxide dismutase is a key antioxidant enzyme of the organism, and plays an important role in the balance of oxidation and antioxidant in the body of the organism. Measurements of these two indicators can, to some extent, reflect changes in the nonspecific immunity of the organism. Since lysozyme in the body is mainly produced from neutrophils, monocytes and macrophage lysosomes, when the relevant cells are activated, the content of lysozyme can be correspondingly increased. As a result of the measurement of T-AOC, SOD and LSZ, when the concentration of fermented Chaga fungi was less than 0.8% (group I-III), the T-AOC value showed a tendency to increase with the breeding time, and the higher the concentration, the greater the change. Appeared to be distinct. As the added concentration of the fermented Chaga fungus continued to increase (groups Ⅳ and Ⅴ), the T-AOC value decreased, and the T-AOC value at day 42 was lower than that at day 21. This explains that when the fermented product of Chaga fungus is added at a low concentration (0.8%), the total antioxidant capacity in the chicken body has a positive correlation with the concentration, and the effect is inferior when the added amount exceeds 1%. Compared with the negative control group, the SOD of each group to which the fermented Chaga fungus was added was significantly increased; Compared with the positive control group, the effect of group Ⅲ, group Ⅳ, and group Ⅴ was higher, of which group Ⅲ was the most excellent. In the longitudinal comparison, the SOD at day 21 was higher than at day 42, and the trend of each group was the same. At different time points, the LSZ of the group to which the fermented Chaga fungus was added was higher than that of the negative control group. When the concentration of chaga fermentation product was 0.8% or less, LSZ increased with increasing drug concentration; When the drug concentration was 0.8% or more, it decreased as the drug concentration increased. The longitudinal comparison is likewise higher on day 21 than on day 42.

When the immune system index and the non-specific immunity index are combined, the concentration of 0.8% Chaga fungus fermented product is the optimal working concentration, and at the same time, it is remarkably superior to the working effect of Astragalus polysaccharide.

Then, the effect on the proliferation and differentiation effect of the peripheral blood mononuclear cells (PBMC) of the organism was measured using the optimal working concentration of the selected fermented Chaga fungus. Twenty one-day-old SPF chickens were divided into 3 groups, one of which added 0.8% of the fermented product of Chaga fungus to the feed (group H), and one group added 0.2% of Astragalus polysaccharide. (Group Q), the third group was a control group, and no drugs were added to the daily diet. Each was bred in a separate device, and the breeding period was 42 days, and during the period, they were allowed to eat freely. Peripheral blood of 3 groups of chickens was collected on days 21 and 42, respectively, and lymphocytes were isolated, the PBMC density was adjusted to 10 ⁷ cells/mL, and then 100 μL per well was added to a 96-well plate. Then, 10 μL of ConA having an working concentration of 2 μg/mL was added to each well, mixed evenly, and cultured in a 37°C, 5% CO ₂ thermostat, followed by negative control wells (equivalent amount of PBS added) and cell-free treatment. Control wells were installed, and 6 wells were duplicated for each sample. Finally, the OD ₄₉₀ value was read with an ELISA analyzer to calculate the average value, and the stimulation index (SI) was calculated according to the following formula:

SI=（OD _{experiment group} -OD _{untreated control group} ）/（OD _{negative control group} -OD _{untreated control group} ）

As shown in Tables 2 and 3, at two time points, the stimulation index of the experimental group reached 3.48, which was significantly higher than that of the control group, indicating that the fermentation product can effectively promote the proliferation and activation of lymphocytes.

Stimulation index of 21-day-old PBMC H group Q group Control voice No treatment OD ₄₉₀ 1.306 1.169 0.862 0.862 0.683 SI 3.480 2.7151 1.000 \ \

Stimulation index of 42-day-old PBMC H group Q group Control voice No treatment OD ₄₉₀ 3.765 2.553 1.507 1.507 0.437 SI 3.110 1.9776 1.000 \ \

Subsequently, by combining the immunity of the vaccine, we compared the immunity-enhancing effects of the Chaga fungus fermented product and Astragalus polysaccharide vaccine. For example, Newcastle disease inactivation vaccines include 10 21-day-old SPF chickens per group, a group with added chaga fermented product + vaccine immunity to daily feed (group H+V), and a vaccine without added chaga fermented product. It was divided into three groups: an immunization group (group V) and a group without immunization and no addition of the fermented product of chaga fungus (group C). The 21-day-old was first immunized with the NDV inactivation vaccine, and the immunity was further strengthened once every 3 weeks, and 0.2 mL per head was injected subcutaneously. After the primary immunization, peripheral blood was collected at 3d, 7d, 14d, 21d, 28d, and 35d, and the serum was isolated, and then antibody titer (HI) was measured using a blood coagulation inhibition experiment, and the serum was diluted with a fixed virus. The neutralizing antibody titers of 7d, 14d, 21d, 28d, and 35d were measured using the method. The expression level of cell factors (IL-2, IL-4, IFN-γ) was measured using an ELISA kit, and the measurement method was performed according to the kit instructions. See FIG. 10 for HI detection results and FIG. 11 for neutralizing antibody detection results. The detection results of IL-2, IL-4, IFN-γ and IFN-γ/IL-4 are shown in FIGS. 12-15.

As a result, compared with the C and V groups, the antibody of the group raised with Chaga fungus had a higher titer of 2-3 at each measurement time point, and the Astragalus polysaccharide group (Q+V group, immune and Astragalus polysaccharide rearing ), the titers of 1-2 were higher. In the case of the neutralizing antibody titer, the strong and weak distinction between the H+V group and the Q+V group was more pronounced. The neutralizing antibody of the Q+V group was generally consistent with the V group, but the neutralizing antibody of the H+V group rose earlier and also It was significantly higher than the other groups. This indicates that the effect of improving the humoral immunity of the fermented product of Chaga fungus is more remarkable than that of commercially available products.

Cellular factors have functions of regulating cell growth differentiation, immune function, inflammatory response and wound union, and cell factors can be classified into Th1 type and Th2 type according to the type of immune response. Th1 type contains IL-2, IFN-γ, tumor necrosis factor (TNF), and the like, and is mainly produced by cell-induced immune responses. Th2 includes cellular factors produced in the process of activating B cells, such as IL-4, IL-5, IL-6, and IL-12. In the process of immune response, IL-2 is an important indicator of cellular immunity, which stimulates Thp cells to differentiate into Th0 cells, and Th0 also secretes cellular factors such as IL-2, IL-4 and IFN-γ. Therefore, in general, IL-2 is used to determine the response intensity of Th, IL-4 is used to determine the level of immunity in body fluids, and IFN-γ is used to determine the cellular immunity level, and at the same time, the ratio of IFN-γ/IL-4 It reflects the balance state of Th1/Th2 cells. As can be seen from the results, both fermented Chaga fungi and Astragalus polysaccharides can promote the expression of IL-2, IL-4 and IFN-γ and the ratio of IFN-γ/IL04, but the difference between the two is not significant. However, the H+V group is slightly higher. Under the premise that it can promote the immunity of body fluids well, the effect of strengthening cell immunity of the fermented Chaga fungus is more remarkable, and it can effectively promote the conversion of cellular immunity from Th2 type to Th1 type at the end of the experiment. It explains that it is more excellent than the effect of Astragalus polysaccharides, and can serve as a more comprehensive immune booster.

On the 35th day, virus attack was performed with NDV virulent virus, and the protective power of each group of vaccines was measured. Three days after the virus attack, the chickens of group C had anorexia, plump feathers, and mental confusion, and all died (5/5); After 5 days, 2 died in group V (2/5), 1 died in group Q+V (1/5), and no death in group H+V (0/5). Therefore, it can be seen that the Chaga fungus immunity enhancer effectively improved the immune effect of the vaccine, and was able to completely protect the experimental animals, and its action effect was remarkable, and was superior to Astragalus polysaccharides.

<110> Institute of Animal Science and Veterinary Medicine Shandong Academy of Agriculture Science <120> Strainm of Inonotus obliquues and its use <130> PI180058CN <150> CN 2017109902921 <151> 2017-10-23 <150> CN 2017109904221 <151> 2017-10-23 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 798 <212> DNA <213> Unknown <220> <223> Inonotus obliquus <400> 1 tccgtaggtg aacctgcgga aggatcatta tcgagtttat tttgaaatcg aggggcctgt 60 gctggcacgg aaacgtttgc atgtgcacgg cctttcgtgc tcaaatccaa ctctcaaacc 120 cctgtgcacc tatacaagtt gaaggtctta gtagtttctg taatcgaacg gcaagtcaag 180 tacgtcgagt aatcaagtac gagggtttcg gcccttggaa agtgtgaaag atggaaaggc 240 aagcttcaga gacaaggaga cgaaaagctt ttggcttcat tacaaacacc aatataattg 300 ttatgtgaat gaaatgctcc ttgtgggcga taataaatac aactttcaac aacggatctc 360 taggctctcg catcgatgaa gaacgcagcg aaatgcgata agtaatgtga attgcagaat 420 tcagtgaatc atcgaatctt tgaacgcacc ttgcgcccct tggtattccg aggggcatgc 480 ctgtttgagt gtcatgttaa tctcaaatcg ctcgtctatt cttaattgaa gtggctttcg 540 atttggactt ggaggttttg ctggcccggg cgactttggt tgcccttggt ttgtcggctc 600 ctctcaaata cattagctgg actttggttc gcgtttacgg tgtaataatg taatgttcac 660 taagacgctt gcctaacaag tctgcttcta atagtcctta agttggacaa ggatcccttc 720 gttgggcctt cttgacacct ttgacctcaa atcaggtagg attacccgct gaacttaagc 780 atatcaataa gcggagga 798

Claims (10)

The growth rate is fast, the production volume is high, and it is preserved in the China Normal Microbial Species Conservation Management Center, and the conservation number is CGMCC No. 14549 Chaga fungi ( Inonotus obliquus ). In the method for obtaining the fermentation product of the chaga fungus of claim 1,
(1) seedling cultivation: obtaining a seedling by inoculating and culturing chaga fungi on the slopes of a test tube;
(2) shaking culture: obtaining an inoculum solution by inoculating seedlings in a liquid medium;
(3) seed culture: inoculating the inoculum into a liquid medium in a seed tank, and fermenting with aeration stirred to obtain a seed liquid;
(4) deep fermentation: inoculating the seed liquid into the liquid medium of the fermentation tank, and performing aeration stirring fermentation;
(5) Precipitation: transferring the fermentation broth to a sedimentation tank, adding a coagulant, and filtering after precipitation to obtain a supernatant;
(6) Concentration: A method for obtaining a fermented product of Chaga fungi, comprising the step of transferring the supernatant to a vacuum concentration tank and then concentrating to a certain density to obtain a fermentation product. The method of claim 2,
In steps (3) and (4), the inoculum is 8-15%; The production method, characterized in that the ventilation amount is 0.1-0.5vvm. The method of claim 2,
In the above steps (2)-(4), the liquid medium contains the following ingredients (g/L): starch 10, peptone 10, glucose 15, potassium dihydrogen phosphate 1, magnesium sulfate 0.5 vitamin B ₁ 0.1, soybean oil 0.2, ; The manufacturing method, characterized in that the pH is 6.8-7.4. The method of claim 2,
The production method, characterized in that the biomass of the fermentation broth in step (5) is 20 g/L or more. The method of claim 2,
The method characterized in that the flocculant in step (5) is chitosan. The method of claim 2,
In step (5), the fermentation broth heating process before precipitation is further included, and the heating temperature is 70-95°C; The warming time is 4-6h;
The method further comprising the step of drying the concentrate to a solid after step (6). A poultry feed additive containing a fermented product of Chaga fungi prepared by any one of claims 2 to 7. The method of claim 8,
Poultry feed additive, characterized in that the amount of the fermentation product of Chaga fungus added to the poultry feed is 0.2-2wt%. An immunity enhancing agent containing a fermented product of Chaga fungi prepared by any one of claims 2 to 7.

Images