CN107550946B - Preparation and application of poultry immunopotentiator - Google Patents
Preparation and application of poultry immunopotentiator Download PDFInfo
- Publication number
- CN107550946B CN107550946B CN201710990422.1A CN201710990422A CN107550946B CN 107550946 B CN107550946 B CN 107550946B CN 201710990422 A CN201710990422 A CN 201710990422A CN 107550946 B CN107550946 B CN 107550946B
- Authority
- CN
- China
- Prior art keywords
- inonotus obliquus
- poultry
- fermentation product
- culture
- fermentation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention provides a poultry immunopotentiator, which comprises inonotus obliquus (Fuscoporia obliqua (Fr.))Inonotus obliquus) The fermentation product of the inonotus obliquus is preserved in China general microbiological culture collection center with the preservation number of CGMCC No. 14549. The addition amount of the inonotus obliquus fermentation product in the poultry feed is 0.2-2 wt%; the addition amount of the drinking water for poultry is 0.1-5 wt%. When the inonotus obliquus fermentation product is used for feeding poultry, the growth of immune organs, nonspecific immune reaction and specific immune reaction of organisms can be obviously enhanced, including the improvement of immune organ indexes, the improvement of nonspecific immune related indexes, the enhancement of peripheral blood lymphocyte proliferation and differentiation capacity, the increase of antibody and neutralizing antibody titer and the improvement of cytokine content, and a new tool is provided for the prevention and control of poultry epidemic diseases.
Description
Technical Field
The invention belongs to the field of bioengineering and biotechnology, and particularly relates to a fermentation technology of fungus inonotus obliquus and application of a fermentation product thereof in enhancing immunity of poultry.
Background
With the improvement of living standard of people, the quality requirement of animal products is increasingly strengthened, and the food safety problem is continuously shown in recent years, so that the importance of the whole society on the animal-derived food safety reaches unprecedented height. How to reduce or even stop the use of antibiotics and reduce the drug resistance and other toxic and side effects of the poultry under the background of continuous and high incidence of poultry epidemic diseases, green and healthy cultivation and food safety of the poultry are realized, and the development of safe, efficient and green novel feed additives and immunopotentiators instead of drugs is important for the development of the breeding industry. The medicinal fungi have unique efficacies and become potential research targets of novel immunopotentiators, and related researches show that the fungus extract or preparation can effectively promote the immunological performance of animals.
Inonotus obliquus (A) (B)Inonotus obliquus) As one kind of medicinal fungi, the fungus is rich in active ingredients such as polysaccharide, triterpene, sterol, total phenol and the like, has been applied to diseases such as gastric cancer, intestinal cancer, heart disease, diabetes and the like by human beings for a long time, and recent researches show that the fruiting body and the extract thereof also have unique curative effects on the aspects of human tumor resistance, oxidation resistance, immune regulation, blood sugar reduction, virus resistance, bacteria resistance, parasite resistance and the like. However, the variety of Inonotus obliquus has few existing varieties and the fruiting body is rarely formed, so that the wild resources are very limited. The strain breeding and artificial cultivation of the fungus are important means for obtaining high-quality inonotus obliquus, but the breakthrough progress can not be achieved all the time after long-term exploration. The progress of fermentation engineering technology makes the breaking of resource difficult problem possible. The fermentation of fungi generally adopts submerged fermentation technology, which is to culture microbial cells in a liquid substrate on the basis of improvement of aeration technology, so as to obtain a large amount of mycelium and other metabolites. Fungi suitable for submerged fermentation should have the following characteristics: (1) the protein content of the mycelium is rich and the mycelium is suitable for culture under the liquid aeration condition; (2) the growth speed is high and the yield is high; (3) has stable genetic characteristics and identifiable morphological characteristics. Meanwhile, different strains of the same kind of fungi have different adaptability to submerged fermentation culture, so that the problem to be solved firstly for deep research and product development of the fungi is screening of suitable strains.
The inonotus obliquus has obvious efficacy, but the fermentation product can be used as an immunopotentiator to improve the immunity of poultry, and related researches and reports of products are few or even blank.
Disclosure of Invention
Aiming at the problems of lack of safe, efficient and green novel immunopotentiators and the like at present, the invention aims to provide the application of the inonotus obliquus fermentation product as the immunopotentiator in enhancing the immunity of poultry.
In order to achieve the purpose, the invention adopts the following technical scheme.
An immunopotentiator for poultry comprises Fuscoporia obliqua (Fr.) Aoshima:)Inonotus obliquus) The fermentation product of the inonotus obliquus is preserved in China general microbiological culture collection center with the preservation number of CGMCC No. 14549.
The Fuscoporia obliqua (A), (B), (CInonotus obliquus) The fermentation product of (2) is prepared by the following method:
(1) mother seed cultivation: inoculating inonotus obliquus on a test tube slant for culture to obtain a mother strain;
(2) and (3) shake flask culture: inoculating the mother strain to a liquid culture medium for culture to obtain an inoculation liquid;
(3) seed culture: inoculating the inoculation liquid into a liquid culture medium in a seeding tank, ventilating, stirring and fermenting to obtain a seed liquid;
(4) deep fermentation: inoculating the seed liquid into a liquid culture medium of a fermentation tank, and ventilating, stirring and fermenting;
(5) and (3) precipitation: transferring the fermentation liquor into a precipitation tank, adding a flocculating agent, precipitating and filtering to obtain a supernatant;
(6) concentration: transferring the supernatant into a vacuum concentration tank, concentrating to a certain density, and discharging to obtain the fermentation product.
The relative density of the inonotus obliquus fermentation product is 1.035-1.065.
The liquid culture medium comprises the following components (g/L): starch 10, peptone 10, glucose 15, potassium dihydrogen phosphate 1, magnesium sulfate 0.5, vitamin B10.1, 0.2 of soybean oil; optionally, the liquid medium has a pH of 6.8-7.4.
Optionally, in step (1), the culture medium is potato dextrose agar culture medium, the culture temperature is 25-28 deg.C, and the culture time is 5-7 days.
Optionally, in step (2), inoculating a mycelium or spore suspension of the mother seed; preferably a mycelium.
Optionally, the culture temperature is 25-28 ℃; the culture time is 3-10 days; the rotating speed of the shaking table is 150-.
Optionally, in the step (2), the mother seeds are subjected to multistage shake flask culture to obtain inoculation liquid; the inoculation amount of the second-stage and above shake flask culture is 8-15%; preferably, the mother seed is subjected to secondary culture to obtain a inoculum.
Optionally, in the step (3) and the step (4), the inoculation amount is 8-15%; the total volume of the liquid in the tank is 50-80% of the capacity of the fermentation tank; the culture temperature is 25-28 ℃; the culture time is 7-15 days; the stirring speed is 100-200 r/min; the ventilation volume is 0.1-0.5 vvm.
Optionally, in the step (3), the inoculum solution is subjected to multi-stage seed culture to obtain a seed solution; preferably, the inoculum is subjected to secondary culture to obtain a seed solution.
In the step (5), the flocculant is chitosan, and the preferable addition amount is 0.05-0.2% of the weight of the fermentation liquor.
Preferably, the biomass of the fermentation broth in step (5) is 20g/L or more.
As an optimization, heating and keeping for a period of time before precipitation; more optimally, the heating temperature is 70-95 ℃; the heat preservation time is 4-6 h.
Optionally, step (6) is concentrated to a relative density of 1.035-1.065.
Preferably, step (6) is followed by the step of drying the concentrate to a solid.
An application of the fermentation product of Inonotus obliquus as poultry immunopotentiator is provided.
Optionally, the addition amount of the inonotus obliquus fermentation product in the poultry feed is 0.2-2 wt%; most preferably 0.8 wt%.
Optionally, the amount of the Inonotus obliquus fermentation product added in the drinking water of poultry is 0.1-5wt%, preferably 0.5-2.0 wt%.
The invention has the beneficial effects that: the inonotus obliquus fermentation product provided by the invention is fed to poultry, so that the growth of immune organs, nonspecific immune reaction and specific immune reaction of organisms can be obviously enhanced, including the improvement of immune organ indexes, the improvement of nonspecific immune related indexes, the enhancement of peripheral blood lymphocyte proliferation and differentiation capacity, the increase of antibody and neutralizing antibody titer and the improvement of cytokine content, and a new tool is provided for the prevention and control of poultry epidemic diseases.
Drawings
FIG. 1 shows the effect of Inonotus obliquus fermentation product on immune organ index (21 days);
FIG. 2 shows the effect of Inonotus obliquus fermentation product on immune organ index (42 days);
FIG. 3 is a graph of the effect of Inonotus obliquus fermentation products on total antioxidant capacity;
FIG. 4 shows the effect of Inonotus obliquus fermentation products on superoxide dismutase;
FIG. 5 shows the effect of Inonotus obliquus fermentation product on serum lysozyme;
FIG. 6 shows the HI antibody detection results;
FIG. 7 shows the results of detection of neutralizing antibodies;
FIG. 8 shows the results of IL-2 detection;
FIG. 9 shows the results of IL-4 detection;
FIG. 10 shows the results of IFN-. gamma.detection;
FIG. 11 shows the results of IFN-. gamma./IL-4 assay.
Strain preservation information
Inonotus obliquus (A) (B)Inonotus obliquus) And the strain is stored in the China general microbiological culture collection management center at 9 and 5 days in 2017, the storage address is the microbial research institute of China academy of sciences No. 3, West Lu No.1 on North Cheng of the Chaoyang region in Beijing, and the storage number is CGMCC number 14549.
Detailed Description
The present invention will be further described with reference to the following examples and drawings, but the present invention is not limited to the following examples.
Example 1 isolation and identification of Inonotus obliquus.
The inonotus obliquus YU strain is a wild strain and is collected from the big rational market in Yunnan province. When in collection, the fruiting bodies without diseases and insect pests are taken down from the surface of the tree, the collection depth is 1-3 cm of the surface layer of the tree, and the fruiting bodies are put into a specimen box and returned to a laboratory for next separation and purification. Separating strain by Agaricus campestris separation method, removing sawdust and impurities from fruiting body surface with distilled water, sterilizing surface with 75% ethanol, breaking fruiting body after transferring to super clean bench, aseptically dissecting deep tissue, and rapidly placingAdding into tiger red solid culture medium, culturing in constant temperature incubator (28 deg.C) for 3 days, transferring purified bacteria into PDA solid culture medium, and observing colony growth every day. Then taking the genome of the inonotus obliquus extracted by the improved CTAB method as a template, and carrying out an ITS-rDNA universal primer ITS 1: 5 'TCCGTAGGTGAACCTGCGG 3' and ITS 2: 5 'TCCTCCGCTTATTGATATGC 3' is used as a specific primer to carry out PCR amplification and identify the strain. The ITS sequence obtained by amplification is shown as SEQ number 1, the ITS sequence has more than 99% homology with the ITS-rDNA sequence of the inonotus obliquus (DQ 103883) in GeneBank, and the separated wild bacteria is judged to be the inonotus obliquus ((DQ 103883))Inonotus obliquus) And named Yu strain. The strain is preserved in the China general microbiological culture collection management center in 2017, 9 and 5 days, and the preservation number is CGMCC No. 14549.
Example 2 obtaining of fermentation product of Inonotus obliquus.
Preparing a liquid culture medium: the following components (g/L) were weighed out, respectively, according to the amount of the liquid medium: peptone 10, glucose 15, potassium dihydrogen phosphate 1, magnesium sulfate 0.5, vitamin B10.1, 0.2 of soybean oil, and sterile water to the required volume, adjusting the pH value to 7.0, and sterilizing at 121 ℃ for 30min for later use.
(1) Mother seed cultivation: inoculating the strain of Fuscoporia obliqua to test tube slant potato glucose agar culture medium (PDA), transferring for 2 times, and activating at 25 deg.C for 7 days each time to obtain mother strain;
(2) and (3) shake flask culture: transferring the mother bacteria into 500mL of primary culture solution, culturing for 10 days, transferring into secondary culture solution, continuously culturing for 5 days, wherein the temperature of a shaking table is 28 ℃, the rotating speed is 180 r/min, taking a small amount of culture for microscopic examination after the culture is finished, and performing the next step when no mixed bacteria exists;
(3) seed culture: inoculating 10% of liquid inoculum into 7L liquid culture medium, loading into 10L fermentation tank, performing aeration culture at 25 deg.C for 10 days, transferring into 100L fermentation tank containing 70L liquid culture medium, and performing aeration mixed culture at 25 deg.C for 10 days;
(4) deep fermentation: transferring the fermented product into 1000kg fermentation tank containing 700kg liquid culture medium, and performing aeration mixed culture at 25 deg.C for 10 days;
(5) terminating the culture: when the biomass in the fermentation tank is detected to reach 20g/L, stopping fermentation, heating the fermentation tank to 90 ℃, preserving the heat for 4 hours, and stopping fermentation;
(6) and (3) precipitation: transferring the fermentation liquor into a precipitation tank, adding chitosan, precipitating for 48 hours, and filtering supernatant with a half-frame filter;
(7) concentration: transferring the supernatant into vacuum concentrating tank, concentrating, detecting relative density of 1.035, completing fermentation product preparation, and packaging.
Example 3 immunopotentiating effect of Inonotus obliquus fermentation product on poultry.
Astragalus polysaccharides are traditional Chinese medicine extracts which are deeply researched and widely applied at present, and can obviously improve the immunity of animals. In order to better compare the effect of the inonotus obliquus fermentation product on enhancing the immunity of poultry, astragalus polysaccharide is selected as a positive control, and the effects of the two preparations are compared. The animal experiments were divided into 7 groups (I-VII), each of which contained 20 SPF-chickens 1 day old, which were individually housed in isolators. The I-V groups were fed with feeds containing 0.2%, 0.4%, 0.8%, 1%, 2% of the fermentation product of Inonotus obliquus of example 2, respectively, the VI group was a blank control group (no immune enhancer was added to the feed), and the VII group was fed with feeds containing 0.2% of Astragalus polysaccharides (purchased from Shengtaier, recommended addition of 0.2%). The breeding period is 42 days, during which the feed is taken freely.
Determination of immune organ (thymus, spleen and bursa of fabricius) index was performed on day 21 and 42 of feeding, respectively: weighing the chickens, then killing the chickens, collecting thymus, spleen and bursa of fabricius in 3 groups, weighing the chickens, and obtaining immune organ indexes according to a calculation formula of immune organ indexes (%) = mass of immune organs/mass of living bodies multiplied by 100%. The results of the two experimental groups, thymus, spleen and bursa of Fabricius, were plotted on the ordinate using the immune organ index (I.E.) in FIG. 1 for 21 days and FIG. 2 for 42 days. In addition, 5 chickens in each test group were subjected to peripheral blood separation on days 7, 14, 21, 28, 35 and 42, and serum was separated by centrifugation at 3000r/min for 10min for measurement of total antioxidant capacity (T-AOC), superoxide dismutase (SOD) and serum Lysozyme (LSZ), and a bar graph of T-AOC is plotted with the number of T-AOC units per ml of serum as ordinate, as shown in FIG. 3; the histogram of SOD and LSZ is shown in FIG. 4 and FIG. 5 with the enzyme content per ml of serum as ordinate.
The result shows that the inonotus obliquus fermentation products with different concentrations can obviously promote the development of immune organs at the age of 21 days. In thymus index, except
The group is lower than the negative control and higher than the positive control, and the rest groups are higher than the positive control and the negative control; spleen indexes of each test group are obviously higher than those of positive and negative controls; the bursa of Fabricius index is similar to the spleen index, except that the positive control is higher than the negative control. In transverse comparison, the indexes of all immune organs in the group II are the highest, and the promotion of organ development is the most obvious in the period. The thymus index of the II-V group reaches 52%, 51% and 43% respectively at 42 days of age, and is obviously different from other groups (P)<0.05); spleen indices of II and IV were significantly higher than those of the other groups; in the bursal index, the III group reaches 0.7, and the difference with other groups is obvious (P)<0.05). In general, except that the index of the group I is slightly higher than that of the negative control, the other groups with the added concentration have obvious effect of promoting the development of immune organs and are better than that of the positive control.
The total antioxidant capacity of organ and tissue is one of the important indexes reflecting the antioxidant function of organism, and superoxide dismutase as the key antioxidant enzyme of organism plays an important role in the balance of oxidation and antioxidation in organism. The measurement of the two indexes can reflect the change of the non-specific immunity of the body to a certain extent. In vivo lysozyme is mainly derived from neutrophils, monocytes and phagolysosomes, so when relevant cells are activated, the content of lysozyme is increased correspondingly. The results of the T-AOC, SOD and LSZ measurements show that when the concentration of Inonotus obliquus fermentation is less than 0.8% (groups I-III), the T-AOC value shows a tendency to increase with feeding time, and the change is more significant with higher concentration. As the addition concentration of inonotus obliquus fermentation continued to increase (groups IV and V), the T-AOC value decreased, and the T-AOC value at 42 days appeared to be lower than that at 21 days. The results show that when the inonotus obliquus fermentation product is added at low concentration (0.8%), the total oxidation resistance of the chicken is positively correlated with the concentration, and the effect is reduced when the addition amount exceeds 1%. Compared with negative control, the SOD of each group added with the inonotus obliquus fermentation product is obviously improved; group III, group IV and group V showed greater efficacy compared to the positive control, with group III showing the best efficacy. In longitudinal comparison, the SOD level was higher for 21 days than for 42 days, with the same trend for each group. The LSZ of the group with added inonotus obliquus fermentate was higher than the negative control at different time points. When the concentration of the inonotus obliquus fermentation product is not higher than 0.8%, the LSZ is increased along with the increase of the concentration of the medicine; when the drug concentration is higher than 0.8%, it decreases with increasing drug concentration. The longitudinal comparison also contained 21 days of more than 42 days.
By integrating immune organ indexes and nonspecific immune indexes, the addition concentration of 0.8% inonotus obliquus fermentation product is the optimal working concentration, and the action effect of the inonotus obliquus fermentation product is also obviously superior to that of astragalus polysaccharide.
Then, the influence of the screened inonotus obliquus fermentation product on the proliferation and differentiation effects of Peripheral blood lymphocytes (PBMC) of the organism is determined by utilizing the optimal working concentration of the screened inonotus obliquus fermentation product. 30 SPF chickens aged 1 day are divided into 3 groups, wherein one group is added with inonotus obliquus fermentation product (group H) in an amount of 0.8%, one group is added with astragalus polysaccharide (group Q) in an amount of 0.2%, the third group is a control group, and no medicine is added in daily ration. Respectively feeding in an isolator for 42 days during which the feed is taken freely. Peripheral blood of three groups of chickens was aseptically collected and lymphocytes were isolated at 21 and 42 days, respectively, and PBMC density was adjusted to 107Add one/mL later to a 96-well plate at 100. mu.L per well. Then 10. mu.L of ConA with working concentration of 2. mu.g/mL was added to each well, mixed well and placed at 37 ℃ in 5% CO2Incubators were incubated and negative control wells (with equal amounts of PBS) and cell-free blank control wells were set, 6 replicates per sample. Finally, the OD is read on a microplate reader490Values and mean values were calculated, and Stimulation Index (SI) was calculated as follows:
SI=（ODtest group-ODBlank control）/（ODNegative control-ODBlank control）
The results are shown in table 1 and table 2, the stimulation index of the test group is obviously higher than that of the control group at two time points and can reach 3.48, and the results show that the fermentation product can effectively promote the proliferation and the activation of the lymphocytes.
Stimulation index of Table 121 day-old PBMC
Stimulation index of Table 242 day old PBMC
Then, the contrast research of the vaccine immunity enhancing effect of the inonotus obliquus fermentation product and the astragalus polysaccharide is carried out by combining the immunity of the vaccine. Taking an inactivated vaccine of newcastle disease as an example, 21-day-old SPF chickens are divided into 3 groups, 10 each, of a group in which a inonotus obliquus fermentation product + vaccine immunization (H + V group), a group in which a inonotus obliquus fermentation product vaccine is not added (V group), and a group in which no inonotus obliquus fermentation product is not fed (C group) are added to a daily ration. The 21-day-old chicken is first immunized by NDV inactivated vaccine, and the immunization is strengthened once at intervals of 3 weeks, and the neck is injected subcutaneously, wherein 0.2mL of the vaccine is injected into each chicken. Collecting peripheral blood at 3d, 7d, 14d, 21d, 28d, and 35d after priming, separating serum, determining antibody titer (HI) by hemagglutination inhibition assay, and determining 7d, 14d, 21d, 28d, and 35d neutralizing antibody titer by fixing virus to dilute serum; the expression level of cytokines (IL-2, IL-4, IFN-. gamma.) was measured by ELISA kit according to the kit instructions. The HI assay results are shown in FIG. 6, and the neutralizing antibody assay results are shown in FIG. 7. The results of IL-2, IL-4, IFN- γ and IFN- γ/IL-4 assays are shown in FIGS. 8-11.
The results showed that the antibody titers in the inonotus obliquus fed group were 2-3 higher than those in groups C and V, and 1-2 higher than those in the astragalan group (Q + V group, immunized and fed with astragalan). For neutralizing antibody titer, the strength of the H + V group is more obviously distinguished from that of the Q + V group: neutralizing antibodies in the Q + V group were substantially identical to those in the V group, while neutralizing antibodies in the H + V group were raised early and significantly higher than those in the other groups. The result shows that the inonotus obliquus fermentation product has more obvious effect of improving humoral immunity than a marketized product.
Cytokines have functions of regulating cell growth differentiation, immune function, participating in inflammatory reaction and wound healing, and can be classified into Th1 type and Th2 type according to the type of immune response. Th1 type includes IL-2, IFN-gamma, Tumor Necrosis Factor (TNF), etc., and is mainly generated by cell-mediated immune response, and Th2 type includes cytokines generated during B cell activation such as IL-4, IL-5, IL-6, IL-12, etc. In the immune response process, IL-2 is an important index of cellular immunity, stimulates the differentiation of Thp cells to Th0 cells, Th0 secretes cytokines such as IL-2, IL-4 and IFN-gamma, so IL-2 is generally used for measuring the intensity of Th response, IL-4 is used for measuring the humoral immunity level, IFN-gamma is used for measuring the cellular immunity level, and the IFN-gamma/IL-4 ratio is used for reflecting the balance state of Th 1/Th 2 cells. The results show that the inonotus obliquus fermentation product and the astragalus polysaccharide can promote the expression of IL-2, IL-4 and IFN-gamma and the ratio of IFN-gamma/IL-4, the difference between the two is small, but the H + V group is slightly high, so that the inonotus obliquus fermentation product can also obviously enhance the effect of cellular immunity on the premise of well promoting humoral immunity, effectively promote the conversion of the cellular immunity from the Th2 type to the Th1 type in the later period of the test, and is an immunopotentiator with better effect and more comprehensive effect than the astragalus polysaccharide.
And (5) performing challenge by using NDV (Newcastle disease Virus) virulent virus at 35 days to determine the protective force of each group of vaccines. After 3 days of detoxification, the chickens in group C had obvious loss of appetite, loose feathers, listlessness, and all died (5/5); after 5 days, 2 chickens died in group V (2/5), 1 chicken died in group Q + V (1/5), and no death in group H + V (0/5). Therefore, the inonotus obliquus immunopotentiator can effectively improve the immune efficacy of the vaccine, provides complete protection for experimental animals, has obvious effect and is superior to astragalus polysaccharide.
<110> institute of zootechnics of academy of agricultural sciences of Shandong province
Qinhuang island high-pass Biotech Co Ltd
<120> preparation and application of poultry immunopotentiator
<130>20170915
<160>1
<170>PatentIn version 3.5
<210>1
<211>798
<212>DNA
<213>Inonotus obliquus
<400>1
tccgtaggtg aacctgcgga aggatcatta tcgagtttat tttgaaatcg aggggcctgt 60
gctggcacgg aaacgtttgc atgtgcacgg cctttcgtgc tcaaatccaa ctctcaaacc 120
cctgtgcacc tatacaagtt gaaggtctta gtagtttctg taatcgaacg gcaagtcaag 180
tacgtcgagt aatcaagtac gagggtttcg gcccttggaa agtgtgaaag atggaaaggc 240
aagcttcaga gacaaggaga cgaaaagctt ttggcttcat tacaaacacc aatataattg 300
ttatgtgaat gaaatgctcc ttgtgggcga taataaatac aactttcaac aacggatctc 360
taggctctcg catcgatgaa gaacgcagcg aaatgcgata agtaatgtga attgcagaat 420
tcagtgaatc atcgaatctt tgaacgcacc ttgcgcccct tggtattccg aggggcatgc 480
ctgtttgagt gtcatgttaa tctcaaatcg ctcgtctatt cttaattgaa gtggctttcg 540
atttggactt ggaggttttg ctggcccggg cgactttggt tgcccttggt ttgtcggctc 600
ctctcaaata cattagctgg actttggttc gcgtttacgg tgtaataatg taatgttcac 660
taagacgctt gcctaacaag tctgcttcta atagtcctta agttggacaa ggatcccttc 720
gttgggcctt cttgacacct ttgacctcaa atcaggtagg attacccgct gaacttaagc 780
atatcaataa gcggagga 798
Claims (4)
1. An immunopotentiator for poultry, comprising a fermentation product of Inonotus obliquus; the Inonotus obliquus (Inonotus obliquus) is preserved in China general microbiological culture collection center with the preservation number of CGMCC No. 14549.
2. The poultry immunopotentiator according to claim 1, wherein the fermentation product of Inonotus obliquus is prepared by the following method:
(1) mother seed cultivation: inoculating inonotus obliquus on a test tube slant for culture to obtain a mother strain;
(2) and (3) shake flask culture: inoculating the mother strain to a liquid culture medium for culture to obtain an inoculation liquid;
(3) seed culture: inoculating the inoculation liquid into a liquid culture medium in a seeding tank, ventilating, stirring and fermenting to obtain a seed liquid;
(4) deep fermentation: inoculating the seed liquid into a liquid culture medium of a fermentation tank, and ventilating, stirring and fermenting;
(5) and (3) precipitation: transferring the fermentation liquor into a precipitation tank, adding a flocculating agent, precipitating and filtering to obtain a supernatant;
(6) concentration: transferring the supernatant into a vacuum concentration tank, concentrating to a certain density, and discharging to obtain the fermentation product.
3. The poultry immunopotentiator according to claim 2, wherein the density is 1.035-1.065.
4. Use of a poultry immunopotentiator according to claim 1 in the preparation of a poultry feed supplement, wherein the inonotus obliquus fermentation product is added to the poultry feed in an amount of 0.2-2 wt%; the addition amount of the drinking water for poultry is 0.1-5 wt%.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710990422.1A CN107550946B (en) | 2017-10-23 | 2017-10-23 | Preparation and application of poultry immunopotentiator |
| KR1020187029131A KR102195870B1 (en) | 2017-10-23 | 2018-04-03 | Chaga fungus and its application |
| PCT/CN2018/081658 WO2019080454A1 (en) | 2017-10-23 | 2018-04-03 | Inonotus obliquus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710990422.1A CN107550946B (en) | 2017-10-23 | 2017-10-23 | Preparation and application of poultry immunopotentiator |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107550946A CN107550946A (en) | 2018-01-09 |
| CN107550946B true CN107550946B (en) | 2020-05-05 |
Family
ID=60986915
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710990422.1A Active CN107550946B (en) | 2017-10-23 | 2017-10-23 | Preparation and application of poultry immunopotentiator |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107550946B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019080454A1 (en) * | 2017-10-23 | 2019-05-02 | 山东省农业科学院畜牧兽医研究所 | Inonotus obliquus and application thereof |
| CN110720561A (en) * | 2019-11-01 | 2020-01-24 | 贾立军 | Preparation and application of feed for improving disease resistance of black pigs |
| CN115025111B (en) * | 2022-06-24 | 2023-06-09 | 山东省农业科学院畜牧兽医研究所 | Preparation method and application of composite oligosaccharide immunopotentiator |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103156052A (en) * | 2013-02-21 | 2013-06-19 | 徐向群 | Submerged fermentation technology of producing immunological enhancement active materials of inonotus obliquus |
-
2017
- 2017-10-23 CN CN201710990422.1A patent/CN107550946B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103156052A (en) * | 2013-02-21 | 2013-06-19 | 徐向群 | Submerged fermentation technology of producing immunological enhancement active materials of inonotus obliquus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107550946A (en) | 2018-01-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102195870B1 (en) | Chaga fungus and its application | |
| CN109576180B (en) | Rhodococcus ruber and application thereof as immunologic adjuvant in preparation of vaccine | |
| CN107550946B (en) | Preparation and application of poultry immunopotentiator | |
| CN101870740B (en) | Morchellaconica extracellular polysaccharide extractive and preparation method and application thereof | |
| CN102242069B (en) | Paecilomycescicadae (Miq.)Samson and application thereof | |
| WO2023098678A1 (en) | High-protein saccharomyces cerevisiae and application thereof | |
| CN110777135A (en) | Fermentation method for high yield of β -glucan based on sparassis crispa | |
| CN1320101C (en) | Aweto cytosol preparing process | |
| CN113308378B (en) | Ganoderma lucidum strain for high-yield ergothioneine and application thereof | |
| CN111449239B (en) | Functional food additive of ganoderma lucidum fermented sea buckthorn seed meal and preparation method thereof | |
| CN116948836B (en) | Ganoderma lucidum strain with high flavone yield, culture medium, culture method and application thereof | |
| CN1141392C (en) | Process for preparing ganoderic polyose and ganoderic acid by fermentation during which raw materials are supplemented | |
| CN1977039A (en) | Mutant yeast, method of producing glutathione-rich yeast, culture thereof, fraction thereof, yeast extract and glutathione-containing foods and drinks | |
| CN107916229B (en) | One plant of Inonotus obliquus and its application | |
| CN114854604B (en) | Ganoderma lucidum, high-concentration oral liquid containing ganoderma lucidum and preparation method thereof | |
| TWI385248B (en) | A formula of culturing medium for cordyceps spp. | |
| CN108342327B (en) | Monascus ruber and application thereof in preparation of lipid-lowering drugs | |
| CN1142266C (en) | Cr-enriched yeast containing high biomass and its preparing process | |
| CN113957012B (en) | Chicken bursa synovialis mycoplasma culture medium and preparation method thereof | |
| CN108588142A (en) | The method and gained Garnoderma product of lucidum mycelium polysaccharide content are improved using fungi polysaccharide | |
| CN110423788B (en) | Method for producing grifola frondosa polysaccharide by using grifola frondosa strains generated by mutagenesis | |
| CN1317382C (en) | Amauoderma rude liquid fermenting method and product obtained thereby | |
| Zhu et al. | Screening of Cordyceps strains and optimization of its solid-state fermentation conditions on bioconversion of Astragalus residue | |
| CN110592161A (en) | Preparation method of polysaccharide, health-care oral liquid and preparation method | |
| CN1175766C (en) | Mannan polysaccharide disease resistant health care beverage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |