KR102189143B1 - Composition and method for prognosing chronic kidney disease - Google Patents

Abstract

The present invention relates to a composition, a kit, and a method for predicting exacerbation of chronic kidney disease using genetic polymorphism.

Description

Composition and method for prognosing chronic kidney disease {Composition and method for prognosing chronic kidney disease}

The present invention relates to a composition, kit, and method for predicting exacerbation of chronic kidney disease using genetic polymorphism.

Chronic kidney disease (CKD) refers to a disease in which the kidney function is gradually and progressively lost due to various causes. According to the commonly used definition of the National Kidney Foundation, chronic kidney disease is defined according to the presence or absence of kidney damage and the level of kidney function, that is, evidence of kidney damage such as proteinuria or hematuria, or glomerular filtration rate indicating renal function. A condition in which the (glomerular filtration rate, GFR) is reduced to less than 60 ml/min/1.73 m ² is defined as a condition that persists chronically for more than 3 months.

In the clinical field, the stage of chronic kidney disease is divided into 5 stages from stage 1 (stage 1) to stage 5 (stage 5) according to the glomerular filtration rate for diagnosis and treatment of patients, and additional dialysis patients (Dialysis, D) and kidney Transplantation (T) is separately indicated. In general, dialysis is not required in stages 1 to 4, but when the degeneration process of the kidney begins, kidney function is irreversibly deteriorated toward the end stage (stage 5), and most patients in stage 5 Survival is often difficult without replacement therapy.

The goal of treatment for chronic kidney disease is primarily to prevent renal disease, but once chronic renal deterioration begins, the rate of progression is stopped or delayed as much as possible to suppress the occurrence of end-stage renal disease and complications, and a better quality of life. Is to run. Therefore, it is important to detect early risk groups with a high possibility of exacerbation of chronic kidney disease and to respond appropriately. However, due to the characteristics of chronic kidney disease in which the decline of renal function or onset of complications chronically progresses over several years or 10 years, there is a problem that it takes a long time to evaluate the course of the disease and the response to treatment.

Therefore, there is a need to develop a biomarker that can predict the prognosis or inform a treatment response by reflecting the deterioration of renal function or the severity of the disease.

Korean Patent Publication No. 10-2011-0097850 (published on August 31, 2011)

An example of the present invention provides a composition for predicting exacerbation of chronic kidney disease due to diabetic nephropathy, comprising an agent capable of detecting single nucleotide polymorphism (SNP) of rs74798667 (NCBI refSNP ID).

In a specific embodiment, the agent capable of detecting the SNP may include a polynucleotide consisting of 10 to 100 consecutive bases including the SNP or a complementary polynucleotide thereof; Alternatively, a probe or primer that specifically hybridizes with a polynucleotide containing the SNP may be included.

Another example provides a kit for predicting exacerbation of chronic kidney disease due to diabetic nephropathy, including the composition.

In an embodiment, the kit may be an RT-PCR kit, a microarray chip, or a microfluidic chip kit.

Another example provides a method for predicting exacerbation of chronic kidney disease due to diabetic nephropathy, comprising detecting a single nucleotide polymorphism (SNP) of rs74798667 from a sample of a patient with chronic kidney disease due to diabetic nephropathy.

Another example is a method of providing information for predicting exacerbation of chronic kidney disease due to diabetic nephropathy, comprising the step of detecting a single nucleotide polymorphism (SNP) of rs74798667 from a sample of a patient with chronic kidney disease due to diabetic nephropathy. to provide.

Another example provides a method of detecting a single nucleotide polymorphism (SNP) of rs74798667 from a sample of a patient with chronic kidney disease due to diabetic nephropathy in order to provide information necessary for predicting exacerbation of chronic kidney disease due to diabetic nephropathy.

Specifically, as a method of detecting single nucleotide polymorphism (SNP), sequencing, mini-sequencing, automatic sequencing, TaqMan analysis, pyrosequencing, allele-specific PCR (allele specific PCR), dynamic allele hybridization technique (dynamic allelespecific hybridization, DASH), PCR-RELP (restriction fragment length polymorphism), PCR-SSCP (single strand conformation polymorphism), PCR-SSO (specific sequence oligonucleotide), microarray hybridization, primer extension, Southern blot hybridization, dot hybridization, ASO (allele specific oligonucleotide) hybridization combining PCR-SSO and dot hybridization, rolling circle amplification (RCA), high resolution melting (HRM), or MALDI-TOF/MS (matrix-assisted laser desorption ionization-time of flight mass) spectrometry).

The present invention confirmed the base of a specific single nucleotide polymorphism (SNP) having a significant correlation with the estimated glomerular filtration rate slope (eGFR slope), which is an index that determines the exacerbation of patients with chronic kidney disease through full-length genome-related analysis. We provide a molecular biological diagnosis technology that predicts the prognosis of patients with chronic kidney disease using SNP as a biomarker. Since SNP markers are present in DNA, they are easy to detect, are more stable than protein markers, occur at specific locations in chromosomes, so analysis is easy, and can be easily identified even in a small amount of samples.

Therefore, as an embodiment, the present invention comprises a composition for predicting exacerbation of chronic kidney disease due to diabetic nephropathy, including an agent capable of detecting single nucleotide polymorphism (SNP) of rs74798667 (NCBI refSNP ID), and comprising the same Kits are provided.

As another aspect, the present invention is for predicting exacerbation of chronic kidney disease due to diabetic nephropathy, comprising the step of confirming a single nucleotide polymorphism (SNP) of rs74798667 from a sample of a patient with chronic kidney disease due to diabetic nephropathy. Provides a way to present information.

As used herein, "rs number" or "NCBI refSNP ID" is registered in the National Center for Biotechnology Information (NCBI)'s SNP reference database (http://www.ncbi.nlm.nih.gov/snp). As a unique number of the SNPs, information on the SNP can be checked by accessing the database through this unique number. Therefore, as long as the rs number is specified herein, those skilled in the art will have information on the SNP, for example, the chromosomal location where the SNP exists, the genetic loci, and the polymorphic sequence including the SNP. Information can be easily checked. As an example, Table 1 below shows information on rs74798667 identified through the database. In the polymorphic sequence of the following table, SNP exists as T or C at the 101st base, and is indicated in bold letters in parentheses.

NCBI refSNP ID Chromosomal
location Gene spot Polymorphic sequence rs74798667 chr5:90738686 (GRCh38.p12) ADGRV1 TGGTAGAAGTTTTTTTCCCCTTCTTCATTACTTTGAGTTTATTATTCTACTCTCTCATGGTCTGCAGGGTTTCTGCTGAGAAATCTGCTAATTAGCCATA [T/C] TGAGACGCCTTTGAATGCGACTATATTCTATCTCTCTTCCTGCTTTCAGTATTCTTTCTTTGTGTTTGATTTTATTTGGTTGTAACTCT

In the above table, the nucleotide sequence of the human genomic chromosome region was expressed according to GRCh38.p12 (Genome Reference Consortium Human Build 38 patch release 12), but the specific sequence of the human genomic chromosome region was somewhat expressed as the genome sequence study result was updated. It may be changed, and according to this change, the expression of the human genomic chromosome region of the present invention may be different. Therefore, even if the human genomic chromosome region expressed according to GRCh38.p12 of the present invention has been updated since the filing date of the present invention, the expression of the human genomic chromosome region is changed differently from now, It will be apparent that the scope of the present invention extends to the altered human genomic chromosome region. These changes can be easily understood by anyone of ordinary skill in the art to which the present invention belongs.

In the present invention, the term "predicting deterioration" refers to damage to renal function in the future, progression of reduced renal function, risk of developing end-stage renal disease, risk of progressing to chronic renal failure or end-stage renal failure, renal replacement therapy such as dialysis or kidney transplantation This includes pre-evaluating and predicting the risk and damage to the kidney condition in the future, such as the required risk.

In addition, the composition, kit, and method of the present invention select patients with high risk of renal function deterioration among patients with chronic kidney disease due to diabetic nephropathy, and stop or delay the progression as much as possible through special and appropriate management. It can be used clinically to suppress the occurrence of end-stage renal disease and complications and to lead a better quality of life.

In addition, the compositions, kits and methods of the present invention are used to evaluate renal function in patients with chronic kidney disease due to diabetic nephropathy, to evaluate the possibility of changes in the patient's future renal condition, to monitor renal deterioration, or to impair renal function in the future. It can be used for a variety of clinical purposes, such as determining the risk of disease or determining an appropriate treatment regimen.

In the present invention, the term "glomerular filtration rate (GFR)" refers to the rate at which blood is filtered from the glomerulus of the kidney to make a filtrate, and is used as an index reflecting kidney function. To measure the glomerular filtration rate, there is a method using a radioactive isotope or a method of obtaining the urine clearance by continuously injecting inulin in vitro, but it takes a lot of time and the test method is complicated.

In the present invention, the term "estimated glomerular filtration rate (estimated GFR, eGFR)" refers to a value calculated according to a predetermined formula. The glomerular filtration rate cannot be measured directly in the glomerulus, and as mentioned above, although indirect measurements can be made using radioisotope and clearance rates, they are rarely used in clinical practice. Therefore, in clinical practice, a method of estimating the glomerular filtration rate through a predetermined formula that considers factors such as age, sex, and weight based on the plasma concentration of creatinine is mainly used, which is expressed as an estimated glomerular filtration rate. do. Accordingly, in the present application, the term "glomerular filtration rate" will most likely be measured as an estimated glomerular filtration rate when applied in clinical practice, and the terms GFR and eGFR are used interchangeably.

Formulas for calculating the estimated glomerular filtration rate are known in the art and commonly used formulas can be used. For example, CG formula (Cockcroft-Gault Equation), MDRD formula (Modification of Diet in Renal Disease Equation), CKD-EPI formula (Chronic Kidney Disease Epidemiology Collaboration Equation), etc. can be exemplified, but the scope of the present invention It is not limited.

"GFR decline" [or "estimated glomerular filtration rate decline"] is an index that can predict the exacerbation of chronic kidney disease. Therefore, according to GFR, the stage of renal disease is determined and nephrotoxic drugs are administered. Appropriate preventive and therapeutic measures such as dose determination and progression after renal replacement therapy will be taken. For example, the 2002 K/DOQI (Kidney disease/Dialysis outcome quality improvement) guideline of the National Kidney Foundation (NKF) classifies the stages of chronic kidney disease based on glomerular filtration rate. Stage 1 (stage 1) is normal GFR (90 ml/min/1.73 m ² or more), stage 2 is mild GFR reduction (60-89 ml/min/1.73 m ² ), stage 3 is moderate GFR reduction ^{(30-59 ml / min / 1.73m 2} ), 4 groups severe (severe) decreased GFR ^{(15-29 ml / min / 1.73m 2} ), and the 5 groups are end-stage renal failure (failure) (15 ml / min / 1.73m ^{2 or} less).

"GFR slope" [or "estimated glomerular filtration rate slope"] refers to the annual change in eGFR. For example, in patients with chronic kidney disease, GFR values are measured over time and the longitudinal axis is GFR (Or eGFR) value, when plotted as a graph with the horizontal axis as time (time), it can be confirmed as the slope of a straight line. In general, as chronic kidney disease progresses, the GFR value decreases linearly from the upper left to the lower right. As the slope of this straight line increases, it can be understood that the rate of decrease in the glomerular filtration rate is faster, that is, the rate of decrease in renal function is faster. As such, the steeper the GFR slope (or eGFR slope), the faster the rate of reduction of chronic kidney disease is, which is associated with exacerbation of chronic kidney disease.

In a common or chronic kidney disease cohort, it is known to be associated with predicting risk of end-stage kidney disease, cardiovascular disease and death. The eGFR slope has been validated as a clinical surrogate endpoint for renal outcome in a randomized controlled study [Greene, T, et al.: Performance of GFR Slope as a Surrogate End Point for Kidney Disease Progression in Clinical Trials: A Statistical Simulation. J Am Soc Nephrol, 30: 1756-1769, 2019]. In the present invention, since the loci and SNPs significantly related to the decrease in the eGFR slope were identified for the first time, these specific SNPs can be used as biomarkers to predict the prognosis of patients with chronic kidney disease.

In a specific example of the present application, the present inventors performed a full-length genome-related analysis on a total of 1738 samples using a Korean chronic kidney disease patient cohort and two hospital-based diabetic chronic kidney disease cohorts. The study group was divided according to diabetic status, and analyzed into diabetic group, non-diabetic group, and total. As an outcome, the glomerular filtration rate reduction rate (eGFR slope) calculated using a random slope and random intercept method was used. . In the discovery study, SNPs related to eGFR slope were detected at the significance threshold of P value less than 1 × 10 ^-6 , and the reliability of the study was increased through a reproducibility/verification study in the American Chronic Kidney Disease Cohort Study (CRIC). As a result, through discovery and reproducibility/verification studies, rs74798667 was found to have a high significant relationship with eGFR reduction in patients with chronic kidney disease caused by diabetic nephropathy.

The composition of the present invention is characterized in that it contains an agent for detecting or confirming the SNP of rs74798667 with respect to a gene sample isolated from a patient.

The agent capable of detecting the SNP includes a polynucleotide consisting of 10 to 100 consecutive bases including the SNP or a complementary polynucleotide thereof; Or a probe or primer that specifically hybridizes with the polynucleotide containing the SNP.

As an example, the agent capable of detecting SNP may be a polynucleotide composed of 10 to 100 consecutive bases including SNP or a complementary polynucleotide thereof, and these may be, for example, 10 to 100, 10 to 90 Dogs, 10 to 80, 10 to 70, 10 to 60, 10 to 50, 10 to 40, 10 to 30, 10 to 20, 20 to 100, 20 to 90, 20 to 80 Dogs, 20 to 70, 20 to 60, 20 to 50, 20 to 40, 20 to 30, 30 to 100, 30 to 90, 30 to 80, 30 to 70, 30 to 60 Can be composed of, 30 to 50, 30 to 40, 40 to 100, 40 to 90, 40 to 80, 40 to 70, 40 to 60, or 40 to 50 consecutive bases, It is not limited thereto, and those skilled in the art can appropriately determine.

The polynucleotide or its complementary polynucleotide according to the present invention is associated with a polymorphic sequence. A polymorphic sequence refers to a sequence including a polymorphic site representing SNP in a nucleotide sequence. The polymorphic site refers to a site in which SNPs exist among polymorphic sequences. In the present invention, the polynucleotide may be DNA or RNA.

As another example, the agent capable of detecting the SNP herein may be a probe or primer that specifically hybridizes with a polynucleotide containing the SNP, and preferably, they are allele-specific.

Allele-specific probes or primers refer to probes or primers capable of hybridizing specifically to each allele. In other words, it refers to hybridization so that the base of the polymorphic site present in the polymorphic sequence can be specifically distinguished. Here, the hybridization conditions should be sufficiently stringent to hybridize only to a specific allele, showing a significant difference in hybridization strength between alleles. Conditions suitable for hybridization may be determined by referring to information commonly known in the art, and may be determined by controlling temperature, ionic strength (buffer concentration), and the presence of a compound such as an organic solvent. These stringent conditions can be determined differently depending on the sequence being hybridized.

In the present invention, the term "probe" refers to a nucleic acid fragment capable of sequence-specific binding to a specific nucleic acid. The probe may be a nucleic acid fragment such as RNA or DNA corresponding to a few bases or hundreds of bases as short as, and is labeled, so that the presence or absence of a specific nucleic acid can be confirmed. The probe may be manufactured in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like. In the probe of the present application, a sequence that is completely or partially complementary to the sequence including the SNP may be used, but a sequence that is substantially (substantially) complementary within a range that does not interfere with specific hybridization may be used. In the present invention, hybridization is performed using a probe complementary to a region containing the SNP of the present invention, and SNP can be identified through hybridization. Selection of suitable probes and conditions for hybridization can be modified based on those known in the art.

As used herein, the term "primer" refers to a short nucleic acid sequence capable of forming a base pair with a complementary template with a nucleic acid sequence having a short free 3-terminal hydroxyl group and serving as a starting point for template strand copying. Primers can initiate DNA synthesis in the presence of reagents for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer and temperature. In addition, the primer may usually consist of 7 to 50 or 15 to 30 bases, but the appropriate length of the primer may vary depending on the purpose of use. Primers can incorporate additional features that do not change the basic properties of the primers serving as the starting point for DNA synthesis. The primer sequence need not be completely complementary to the template, but must be sufficiently complementary to hybridize to the template. The primer can be used to amplify a DNA fragment containing a polymorphic site by hybridizing to a sequence containing the SNP and detect it.

Primers or probes can be chemically synthesized using the phosphoramidite solid support method, or other well known methods. Such nucleic acid sequences can also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, encapsulation, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, such as uncharged linkers (e.g., methyl phosphonate, phosphotriester, phosphoro Amidates, carbamates, etc.) or to charged linkers (eg phosphorothioate, phosphorodithioate, etc.).

In the present invention, when it is confirmed or detected that the SNP genotype of rs74798667 is C, it can be predicted that there is a high risk of deteriorating chronic kidney disease due to diabetic nephropathy.

In the present invention, the kit may be an RT-PCR kit, a microarray chip, or a microfluidic chip kit. The kits of the present invention may contain polynucleotides as well as one or more other constituent compositions, solutions or devices suitable for analysis methods.

As an example, the kit of the present invention may be a PCR kit. Preferably, it may be a real-time PCR (RT-PCR) kit. Such kits may contain essential elements necessary to perform PCR, such as real-time PCR (RT-PCR). For example, the kit comprises each pair of primers capable of amplifying a nucleic acid containing a SNP site, a test tube or other suitable container, a reaction buffer, an enzyme such as deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase. , DNase, RNAse inhibitors, DEPC-water and sterile water, etc. may additionally be included.

As another example, the kit of the present invention may be a DNA chip kit. Preferably, it may be a microarray chip or a microfluidic chip kit. Such a kit may include a substrate on which a polynucleotide containing the SNP site or a complementary polynucleotide thereof, or a probe or primer that specifically hybridizes with the polynucleotide containing the SNP is immobilized.

Microarrays may be made of conventional microarrays, except for including the polynucleotides, primers, or probes of the present invention. Hybridization of nucleic acids on microarrays and detection of hybridization results are well known in the art. In the detection, for example, a nucleic acid sample is labeled with a labeling substance capable of generating a detectable signal including a fluorescent substance, for example, a substance such as Cy3 and Cy5, and then hybridized on a microarray and the labeling substance By detecting the signal generated from the hybridization result can be detected.

Microarrays include printing using fine-pointed pins on a substrate, photolithography using prefabricated masks, photolithography using dynamic micromirror devices, inkjet printing, or electrochemistry on microelectrode arrays. It can be manufactured using various techniques. The substrate of the microarray chip is preferably coated with an active group selected from the group consisting of amino-silane, poly-Llysine, and aldehyde, but is not limited thereto. In addition, the substrate is preferably selected from the group consisting of slide glass, plastic, metal, silicone, nylon film, and nitrocellulose membrane, but is not limited thereto.

A microfluidic chip is a microfluidic device that measures and analyzes the interaction of an analyte contained in a fluid sample with a biomaterial, cell, tissue or detection device on the chip using microfluidic control technology. Processes such as hybridization, nucleic acid amplification, and capillary electrophoresis reactions may be included by miniaturization and compartmentalization.

In the detection of the genotype of the SNP of the present invention, sequencing, hybridization analysis by microarray, etc., amplification using PCR, and the like can be used. For example, sequencing, mini-sequencing, autosequencing, TaqMan analysis, pyrosequencing, allele specific PCR (allele specific PCR), dynamic allele-specific hybridization (DASH), PCR-RELP (restriction fragment length) polymorphism), PCR-SSCP (single strand conformation polymorphism), PCR-SSO (specific sequence oligonucleotide), hybridization by microarray, primer extension, southern blot hybridization, dot hybridization, ASO combining PCR-SSO and dot hybridization ( Known methods such as allele specific oligonucleotide) hybridization, rolling circle amplification (RCA), high resolution melting (HRM), or MALDI-TOF/MS (matrix-assisted laser desorption ionization-time of flight mass spectrometry) may be used. It is not limited thereto.

In another aspect, the present invention provides a method for predicting exacerbation of chronic kidney disease due to diabetic nephropathy, comprising the step of detecting a single nucleotide polymorphism (SNP) of rs74798667 from a sample of a patient with chronic kidney disease due to diabetic nephropathy. About.

In addition, the present invention provides information for predicting exacerbation of chronic kidney disease due to diabetic nephropathy, comprising the step of detecting a single nucleotide polymorphism (SNP) of rs74798667 from a sample of a patient with chronic kidney disease due to diabetic nephropathy. It's about how.

In addition, the present invention relates to a method of detecting a single nucleotide polymorphism (SNP) of rs74798667 from a sample of a patient with chronic kidney disease due to diabetic nephropathy in order to provide information necessary for predicting exacerbation of chronic kidney disease due to diabetic nephropathy. will be.

In the present invention, the term "sample" refers to a biological material isolated from a subject. The sample may contain any biological material capable of detecting the desired SNP. For example, the sample may contain genetic material, such as DNA, genomic DNA, complementary DNA (cDNA), RNA, heterogeneous nuclear RNA (hnRNA), mRNA, etc. . Such a sample may be isolated from cells, tissues, blood (whole blood, serum, or plasma), saliva, body hair, oral mucosa, tears, sputum or urine, and methods of separating samples are well known in the art.

First, obtaining genomic DNA from samples of patients with chronic kidney disease is a phenol/chloroform extraction method and SDS extraction method commonly used in the industry (Tai et al., Plant Mol. Biol. Reporter, 8: 297-303, 1990), CTAB separation (Cetyl Trimethyl Ammonium Bromide; Murray et al., Nuc. Res., 4321-4325, 1980) or commercially available DNA extraction kits can be used.

The detection of the genotype of SNP may include sequencing, hybridization analysis using microarrays, etc., amplification using PCR, and the like. For example, sequencing, mini-sequencing, autosequencing, TaqMan analysis, pyrosequencing, allele specific PCR (allele specific PCR), dynamic allele-specific hybridization (DASH), PCR-RELP (restriction fragment length) polymorphism), PCR-SSCP (single strand conformation polymorphism), PCR-SSO (specific sequence oligonucleotide), hybridization by microarray, primer extension, southern blot hybridization, dot hybridization, ASO combining PCR-SSO and dot hybridization ( Allele specific oligonucleotide) hybridization, RCA (rolling circle amplification), HRM (high resolution melting), or MALDI-TOF/MS (matrix-assisted laser desorption ionization-time of flight mass spectrometry), or other known methods. have.

The method includes the SNP detected in the patient's sample with the SNP control group of the patient whose chronic kidney disease progressed rapidly due to diabetic nephropathy, or the SNP control group of the patient whose chronic kidney disease progressed slowly or did not worsen due to diabetic nephropathy. It may further include the step of comparing. For example, if the SNP detected in the patient's sample shows the same genotype as the SNP control group of a patient whose chronic kidney disease due to diabetic nephropathy progressed rapidly, the patient is judged to be a patient with a high risk of worsening chronic kidney disease. It may be, and if the same genotype as the control group is not displayed, it may be determined that the risk of deteriorating chronic kidney disease is low. Alternatively, if the SNP detected in the patient's sample exhibits the same genotype compared to the SNP control group of a patient whose chronic kidney disease due to diabetic nephropathy progressed slowly or did not worsen, the patient is considered to have a low risk of worsening chronic kidney disease. It may be determined, and if the same genotype as the control group is not displayed, the corresponding patient may be determined as a patient with a high risk of deteriorating chronic kidney disease.

Alternatively, the method may further include predicting that there is a high risk of deteriorating chronic kidney disease due to diabetic nephropathy when it is confirmed or detected that the SNP genotype of rs74798667 is C.

Therefore, according to the present invention, it can be usefully used in predicting exacerbation of chronic kidney disease by detecting the presence of the specific SNP described above.

The present invention provides a molecular biological diagnostic method for predicting exacerbation of chronic kidney disease by detecting a specific SNP of genomic DNA collected from a sample of a patient, which is simple, non-invasive, and economical. In addition, SNPs are easy to detect, are stable compared to conventional protein or RNA markers, and are easy to analyze.

FIG. 1 is a Manhattan plot showing the results of a full-length genome-related analysis of eGFR reduction in all (FIG. 1a ), diabetes group (FIG. 1b) and non-diabetic group (FIG. 1c) in the discovery study.
FIG. 2 shows a regional plot of the locus of rs74798667, which was confirmed to have a high significant association with a decrease in eGFR in a reproduction or verification study. The Y axis represents the log ₁₀ (P value) of the SNP and the X axis represents its chromosomal location.

Hereinafter, the present invention will be described in more detail by the following examples. However, these are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example 1. Research subject

This study is a sample of 2118 patients from the KoreaN cohort study for Outcome in patients With Chronic Kidney Disease (KNOW-CKD), which was launched in March 2011 in the Academic Service Project of the Centers for Disease Control and Prevention. A total of 2,306 samples of chronic kidney disease patients were collected, including a sample of 188 patients with chronic kidney disease identified as nephropathy (91 samples from Seoul National University Hospital Human Resources Bank, 97 samples from Kyunghee Medical Center). KNOW-CKD is a total of 2,388 adult patients aged 20 to 75 years, covering the entire stage 1 to 5 of chronic kidney disease from stage 1 diagnosed as chronic kidney disease to stage 5 patients who have not yet undergone dialysis (Predialysis). It is a cohort for a multicenter prospective observational study of, and in this study, blood samples from 2118 patients were collected.

A total of 2,045 samples passed the quality control (QC) test, of which 273 patients with autosomal dominant polycystic kidney and 34 patients who could not calculate the estimated glomerular filtration rate slope (eGFR slope) were excluded. Patients were placed in a discovery cohort. Consent forms and blood samples were obtained from all patients, and the study was approved by the Medical Research Ethics Committee of Seoul National University Hospital.

Example 2. Genotyping and quality control (QC)

Whole blood samples of the patients to be studied were collected in ethylenediaminetetraacetic acid tubes, and genomic DNA was extracted from peripheral blood leukocytes isolated therefrom. A Korean chip (K-CHIP; Affymetrix Axiom KORV1.1, Santa Clara, CA, USA) developed by the National Institutes of Health Genomics Center was provided by the K-CHIP consortium, and genotyping data was produced using it.

Quality control (QC) was performed by the first and second sample QC and SNP QC according to the Korean chip protocol. Samples were excluded from the primary sample QC based on the following criteria: (i) DQC (dish quality control) less than 0.82, (ii) call rate less than 97%, (iii) missing call rate 2% or more, ( iv) When the heterozygosity deviates from Mean ± 3SD, (v) When deviated from the pattern in the multidimensional accumulation method (MDS) figure, (vi) 15 singletones or more. Afterwards, the second sample QC was conducted and the criteria were as follows: (i) DQC (dish quality control) less than 0.82, (ii) call rate less than 97%, (iii) missing call rate 2% or more, ( iv) If the heterozygosity deviates from Mean ± 3SD, (v) deviates from the pattern in the MDS plot, (vi) 15 singletones or more, (vii) associated individuals (identical-by-descent)> 0.8), (viii) sex inconsistence.

The following SNPs were then excluded: (i) 5% or more missing call rate, and (ii) P value (Hadi-Weinberg equilibrium test) less than 10 ^-6 .

As a result, 745,176 autosomal SNPs were identified. Minimac3 was used to replace the reference panel of phase 3 of the 1000 Genome Project, and the phase was adjusted using Shapeit_v2.12. Finally, after the missing value imputation QC, 7,734,192 SNPs were used for the analysis, excluding SNPs with a coefficient of determination (R ² ) less than 0.7 and a double allele frequency less than 0.01.

Example 3. Statistical analysis

The patient group was divided into total/diabetic/non-diabetic groups according to diabetes status, and descriptive statistics for the underlying characteristics of the study group were calculated. Results were expressed as mean (standard deviation) or numbers and percentages (%). eGFR was calculated using the four-variable CKD-EPI (Chronic Kidney Disease Epidemiology Collaboration) formula. The primary outcome was the estimated glomerular filtration rate slope (eGFR slope). The eGFR slope was calculated using a linear mixed model with a random intercept.

In order to find the genetic loci related to the eGFR slope, a multivariate linear regression analysis was performed after correcting the age and sex using an additional model. PLINK (version 2.0) was used for statistical analysis. Manhattan plot and QQ (quantile-quantile) plot were drawn using the R statistical software package version 3.6.2 (R Development Core Team; R Foundation for Statistical Computing, Vienna, Austria). Annotation of each SNP was performed using ANNOVAR, and regional plots were drawn using LDassoc of the National Institutes of Health. Important SNPs were chosen with a p value of less than 10 ^-6 . Effectiveness was analyzed using a p value of less than 0.05. In meta-analysis, the p-values were combined using a fixed-effects model.

Example 4. Reproduction and validation study

The term replication is used when conducting confirmation studies on independent samples of similar circumstances. The reproducible study was conducted by the American Chronic Renal Insufficiency Cohort (CRIC). A total of 2,498 CRIC cohort patients were analyzed by race (white and black) and diabetic status (with or without diabetes).

Experiment result

1. Characteristics of study subjects

The clinical and demographic characteristics of the discovery cohort are summarized in Table 2. A total of 1,738 patient samples were analyzed in this study. The average age was 54.9 years, and 63.3% of the patients were male. In addition, 44.3% had diabetes and 96.3% had hypertension. The average eGFR was 48.9 ± 28.5 mL/min/1.73 m ² . Patients were divided into diabetic and non-diabetic groups, and diabetic patients were older and had higher systolic blood pressure, body mass index and proteinuria levels, and lower hemoglobin and albumin levels than non-diabetic patients. Diabetic patients showed lower eGFR and steep eGFR decreases compared to those in the non-diabetic group.

Characteristics of the discovery cohort all
N=1738 Diabetes group
N=771 Non-diabetic group
N=967 P Age (at baseline) 54.9 (12.1) 58.1 (10.6) 52.4 (12.7) <0.001 Gender (male) 1101 (63.3%) 517 (67.1%) 584 (60.4%) 0.004 High blood pressure (%) 1674 (96.3%) 730 (94.7%) 944 (97.6%) 0.001 Systolic blood pressure (mmHg) 127.7 (17.7) 131.9 (20.3) 124.8 (14.9) <0.001 Diastolic blood pressure (mmHg) 76.3 (11.7) 76.1 (13.1) 76.6 (10.7) 0.416 Body mass index (kg/m ² ) 24.7 (6.0) 25.4 (7.8) 24.1 (4.0) <0.001 White blood cells (/mm3) 6529.8 (2320.0) 6551.4 (2649.1) 6512.6 (2020.8) 0.737 Hemoglobin (g/dL) 12.5 (3.5) 12.0 (4.3) 13.0 (2.5) <0.001 Albumin (mg/dL) 4.0 (0.6) 3.9 (0.7) 4.2 (0.5) <0.001 24-h urine protein (g) 1.8 (2.5) 2.6 (3.2) 1.1 (1.5) <0.001 eGFR (ml/min/1.73m ² ) 48.9 (28.5) 42.0 (25.3) 54.4 (29.8) <0.001 eGFR slope -2.1 (2.1) -2.5(2.1) -1.7 (1.9) <0.001 Tracking period (years) 3.3 (1.8) 2.8 (1.7) 3.7 (1.7) <0.001

Significant SNPs associated with eGFR reduction

In the discovery study, the results of full-length genome-related analysis on the reduction of eGFR in the whole, diabetic group and non-diabetic group were shown as a Manhattan plot (FIG. 1 ). As a result, a total of 85 SNPs related to the eGFR slope were identified in the total, diabetic group, and non-diabetic group with a significance of less than p value 10 ^-6 , respectively (18 in the entire SNP group, 40 in the diabetic group, and the non-diabetic group. From 27).

Reproduction study results

A total of 2,498 CRIC cohort patients (1339 diabetic patients and 1159 non-diabetic patients) were reproducible, and 21 SNPs were reproduced (4 in the entire SNP group, 1 in the diabetic group, and 1 in the non-diabetic group). 16). Among them, rs74798667 (located in the ADGRV1 gene) in the diabetic group was found to have very high eGFR reduction and significance (Table 3).

rsID
chromosome
location approximate
gene Opposition
gene
(allele) Discovery research Reproduction research Combination
(combined) EAF beta (SE) p
group EAF beta (SE) p p rs74798667 5q14.3 ADGRV1 T/C 0.03 -1.90 (0.32) 7.01 x 10 ^-9 AA 0.002 -13.16 (5.28) 0.01 1.99 x 10 ^-9

Abbreviation: SE, standard error; AA, African American; EAF, effect allele frequency

In addition, FIG. 2 shows a regional plot of the locus of rs74798667, which was confirmed to have a high significant association with a decrease in eGFR in a reproduction or verification study.

As such, rs74798667 was found to have very high eGFR reduction and significance in the diabetic group, so it can be usefully used as a marker for predicting exacerbation of chronic kidney disease caused by diabetic nephropathy.

From the above description, those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in other specific forms without changing the technical spirit or essential features thereof. Therefore, the embodiments described above are illustrative in all respects and should be understood as non-limiting. The scope of the present invention should be construed that all changes or modifications derived from the meaning and scope of the claims to be described later rather than the above detailed description, and equivalent concepts thereof, are included in the scope of the present invention.

<110> SEOUL NATIONAL UNIVERSITY HOSPITAL <120> Composition and method for prognosing chronic kidney disease <130> DPP20203536EN <160> 1 <170> KopatentIn 1.71 <210> 1 <211> 201 <212> DNA <213> Homo sapiens <220> <221> allele <222> (101) <223> rs74798667 (y is t or c.) <400> 1 tggtagaagt ttttttcccc ttcttcatta ctttgagttt attattctac tctctcatgg 60 tctgcagggt ttctgctgag aaatctgcta attagccata ytgagacgcc tttgaatgcg 120 actatattct ctatctcttg ctgctttcag tattctttct ttgtgtttga tttttgtctg 180 ggtaaactct tcattgagtt g 201

Claims (6)

A composition for predicting exacerbation of chronic kidney disease due to diabetic nephropathy, comprising an agent capable of detecting single nucleotide polymorphism (SNP) of rs74798667. The method of claim 1, wherein the agent capable of detecting the SNP,
A polynucleotide consisting of 10 to 100 consecutive bases including the SNP or a complementary polynucleotide thereof; or
A composition, which is a probe or primer that specifically hybridizes with a polynucleotide containing the SNP. A kit for predicting exacerbation of chronic kidney disease due to diabetic nephropathy, comprising the composition of claim 1 or 2. The kit of claim 3, wherein the kit is an RT-PCR kit, a microarray chip or a microfluidic chip. A method of providing information for predicting exacerbation of chronic kidney disease due to diabetic nephropathy, comprising the step of detecting a single nucleotide polymorphism (SNP) of rs74798667 from a sample of a patient with chronic kidney disease due to diabetic nephropathy. The method of claim 5, wherein the detection of the single nucleotide polymorphism (SNP) is sequencing, mini-sequencing, automatic sequencing, TaqMan analysis, pyrosequencing, allele specific PCR, and dynamic allele hybridization techniques. allele specific hybridization, DASH), PCR-RFLP (restriction fragment length polymorphism), PCR-SSCP (single strand conformation polymorphism), PCR-SSO (specific sequence oligonucleotide), microarray hybridization, primer extension, Southern blot hybridization, dot Hybridization, ASO (allele specific oligonucleotide) hybridization combining PCR-SSO and dot hybridization, RCA (rolling circle amplification), HRM (high resolution melting), or MALDI-TOF/MS (matrix-assisted laser desorption ionization-time of flight mass spectrometry).

Images