KR102187132B1 - Lipase from Croceibacter atlanticus - Google Patents

Abstract

The present invention is Croceibacter atlanticus ( Croceibacter atlanticus )-derived lipolytic enzyme (lipase), more specifically Croceibacter The atlanticus derived lipolytic enzymes (LipCA), using the recombinant microorganism that expresses a lipid-decomposing enzyme, and it relates to a process for producing a lipolytic enzyme. In the present invention, the temperature and pH characteristics and substrate specificity of the lipolytic enzyme (LipCA) derived from Croceibacter atlanticus were confirmed, and the immobilized lipolytic enzyme cross-linked with the lipolytic enzyme was temperature, pH and It is useful industrially because the stability to organic solvents is significantly increased and the activity is maintained while being easily recovered by centrifugation.

Description

Lipase from Croceibacter atlanticus {Lipase from Croceibacter atlanticus}

The present invention is Croceibacter atlanticus ( Croceibacter atlanticus )-derived lipolytic enzyme (lipase), more specifically Croceibacter The atlanticus derived lipolytic enzymes (LipCA), using the recombinant microorganism that expresses a lipid-decomposing enzyme, and it relates to a process for producing a lipolytic enzyme.

The Antarctic Ocean occupies the southernmost part of the Pacific, Atlantic, and Indian Oceans, and the surface water temperature surrounds Antarctica near the freezing point. It is the coldest unknown place on the planet, and it is rich in biological resources that can be developed. Since polar biological resources have biological characteristics that can survive in polar environments, it is estimated that industrial applicability is very high.

Lipolytic enzyme (lipase; triacylglycerol acylhydrolase, EC 3.1.1.3) is a lipohydrolyzing enzyme and an enzyme that hydrolyzes the ester bond of triglycerides to produce glycerol and fatty acids. It is an industrial enzyme that catalyzes ester synthesis reactions and transesterification reactions depending on reaction conditions. Meanwhile, lipases produced by polar microorganisms have been found to have various temperature and pH characteristics, substrate specificity, and stereospecificity, and are thus being studied as enzyme catalysts in the food, paper, biodiesel, detergent, and cosmetics industries (Sharma R, Chisti Y, Banerjee UC. 2001. Production, purification, characterization, and applications of lipase.Biotechnol. Adv. 19: 627-662.).

In order to utilize the lipase discovered in a special environment on the planet as an industrial catalyst, recombinant enzymes must be produced using genetic engineering techniques. Transform microorganisms by putting the discovered lipase gene ORF (open reading frame) into an expression vector with a special promoter, and mass production in an active form by controlling the composition of the medium, culture temperature, culture time, inducer concentration, and induction culture time. This makes it possible to make recombinant lipase enzymes at low cost. In addition, the enzyme must be immobilized to improve stability and to be used repeatedly. Adsorption, entrapment, and cross-linking methods are commonly used as enzyme immobilization methods (Datta S, Christena LR, Rajaram YRS. 2013. Enzyme immobilization: an overview on techniques and support) materials. 3 Biotech. 3: 1-9.). The cross-linked enzyme aggregate (CLEA) method is a type of cross-linking method that uses a cross-linking agent to covalently bond Lysine residues in the enzyme to increase stability. In addition, because it is an easy and inexpensive immobilization method without using expensive beads, it has been studied a lot (Roger A. Sheldon. 2011. Cross-linked enzyme aggregates as industrial biocatalysts. Org . Process Res. Dev . 15: 213 -223.).

So far, the X-ray crystal structure of many microbial lipase enzymes has been revealed and reported. In most cases, it has an α/β hydrolase fold with a parallel β-sheet at the center of the enzyme structure (Lenfant N, Hotelier T, Velluet E, Bourne Y, Marchot P, Chatonnet A. 2013. ESTHER, the database of the α/β-hydrolase fold superfamily of proteins: tools to explore diversity of functions.Nucleic Acids Res. 41: 423-429). Have a catalytic triad of Asp-His-Ser in the active site, which contains in a double Ser is in a Gly-X-Ser-X- Gly sequence conservation (Arpigny JL, Jaeger KE 1999. Bacterial lipolytic enzymes:.. Classification and properties Biochem J. 343: 177-183.). In addition, the active site pocket is covered with a lid composed of amphipathic α-helix, which is closely related to the lipase-specific'interfacial activation' mechanism. In the case of esterase enzymes, it has a structure similar to that of lipase, but does not have a lid structure at the active site.

Accordingly, the present inventors have made diligent efforts to produce lipolytic enzymes that can be used for various industrial purposes. As a result, the lipase gene ( lipCA ) was found and found from the Croceibacter atlanticus (Stock No. 40-F12) strain isolated from the Antarctic Ross Sea. Mass produced by Escherichia coli , C. atlanticus By characterizing and immobilizing the derived lipase (LipCA), the possibility of industrial use was confirmed, and the present invention was completed.

The information described in the background section is only for improving an understanding of the background of the present invention, and thus does not include information forming the prior art known to those of ordinary skill in the art to which the present invention belongs. May not.

An object of the present invention is to provide a lipolytic enzyme derived from Croceibacter atlanticus represented by the amino acid sequence of SEQ ID NO: 1.

Another object of the present invention is to provide a gene encoding the lipolytic enzyme, a recombinant vector containing the gene, and a recombinant microorganism in which the gene or recombinant vector has been introduced into a host cell.

Another object of the present invention is to provide a method for preparing a lipolytic enzyme using the recombinant microorganism.

In order to achieve the above object, the present invention provides a lipolytic enzyme (lipase) represented by the amino acid sequence of SEQ ID NO: 1.

The present invention also provides a gene encoding the lipolytic enzyme, a recombinant vector containing the gene, and a recombinant microorganism in which the gene or recombinant vector has been introduced into a host cell.

The present invention also includes the steps of culturing the recombinant microorganism to express a lipolytic enzyme represented by the amino acid sequence of SEQ ID NO: 1; And it provides a method for producing a lipolytic enzyme comprising the step of recovering the expressed lipolytic enzyme.

In the present invention, Croceibacter atlanticus ( Croceibacter atlanticus ) The temperature and pH characteristics and substrate specificity of the lipolytic enzyme (LipCA) derived from the lipolytic enzyme were confirmed, and the immobilized lipolytic enzyme cross-linked with the lipolytic enzyme significantly increased the stability to temperature, pH and organic solvents, and centrifuged It is easily recovered and retained its activity, so it is industrially useful.

1 shows shotgun cloning and sub cloning of the lipCA gene.
Figure 2 is Croceibacter atlanticus The base sequence and amino acid sequence of LipCA are shown, and catalytic residues are underlined.
Figure 3 is a phylogenetic tree showing the phylogenetic location of Croceibacter atlanticus LipCA and other related proteins shown using the DNAStar megalign program.
Figure 4 shows the 16S rRNA sequence alignment (alignment), Figure 4a is an isolated strain (Stock No. 40-F12) and Croecibacter atlanticus HTCC2559 strain, FIG. 4B is an isolated strain and Alcanivorax sp. This is the 16S rRNA alignment of DG881.
5 shows a homology model of LipCA, FIG. 5A shows a three-dimensional structure of LipCA, FIG. 5B shows an active site of LipCA, and FIG. 5C shows a lid structure of LipCA.
6 shows the expression and purification of LipCA (Lane 1: protein size marker, Lane 2: cell-free extract of E. coli cells containing an empty vector, Lane 3: E. coli Insoluble fraction of cells, Lane 4: E. coli expressing LipCA Cell-free extract, Lane 5: LipCA purified by 30% ammonium sulfate precipitation method, Lane 6: LipCA purified by gel filtration chromatography after precipitation of ammonium sulfate).
7 is a graph showing the effect of temperature and pH on the activity and stability of LipCA and LipCA ^CLEA . 7A shows the effect of temperature on activity, FIG. 7B shows the effect of pH on activity, FIG. 7C shows the effect of temperature on stability, and FIG. 7D shows the effect of pH on stability. The open circle is LipCA, and the closed circle is LipCA ^CLEA .
Figure 8 is a graph showing the substrate specificity of LipCA and LipCA ^CLEA , Figure 8A is a p NP ester assay, Figure 8B is a pH stat assay results. Open bar is LipCA, closed bar is LipCA ^CLEA .
9 is a graph showing the effect of an organic solvent on the stability of LipCA and LipCA ^CLEA . 9A is a result of measuring the residual activity of an enzyme incubated in 10% organic solvent for 1 hour at room temperature, and FIG. 9B is a result of measuring the residual activity of an enzyme cultured in 30% organic solvent for 1 hour at room temperature. Log P values are DMSO -1.3, Methanol -0.76, Acetonitrile -0.34, Ethanol -0.24, Acetone -0.23, 1,2-Dimethoxyethane -0.2, Isopropanol -0.05, Propionitrile 0.17, 2-Butanone 0.29, Pyridine 0.65, Ethyl Acetate. 0.73, 1-Butanol 0.839, open bar is LipCA, closed bar is LipCA ^CLEA .
10 shows the reusability of LipCA ^CLEA , and the lipase activity was repeatedly measured after recovery by centrifugation.

Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by an expert skilled in the art to which the present invention belongs. In general, the nomenclature used in this specification is well known and commonly used in the art.

There are many microorganisms in the Antarctic Ocean that produce novel biocatalysts applicable to various industrial fields. The present inventors screened many psychrophilic bacterial strains isolated from the Ross Sea, and Croceibacter exhibiting high lipolytic activity in plates containing tributyrin. atlanticus A strain (Stock No. 40-F12) was found. In the present invention, the lipase gene ( lipCA ) was isolated by a shotgun cloning method, and the LipCA enzyme was Escherichia coli cells. The enzyme properties including optimal temperature and pH of LipCA, substrate specificity, and organic solvent stability were identified. LipCA was immobilized by cross-linked enzyme aggregate (CLEA) method, and the enzyme properties were compared with free LipCA. After immobilization, the stability to temperature, pH and organic solvents was significantly increased, but the substrate specificity did not change. LipCA ^CLEA was easily recovered by centrifugation and showed about 40% activity after 4 times recovery.

Accordingly, the present invention relates to a lipolytic enzyme (lipase) represented by the amino acid sequence of SEQ ID NO: 1 in one aspect.

In the present invention, the amino acid sequence of SEQ ID NO: 1 is as follows:

MNPAVFERATVRALMTLPGPVLARFAAGLETHSRSHLDARLRFLLALSSAKPTLDSGTVEQARRTYREMIALLDVAPIRLPVVVDHQVTVDDGSQILVRRYRPANAPRVAPAILFFHGGGFTVGGVEEYDRLCRYIADRTNAVVLSVDYRLAPEHPAPTGMDDSFAAWRWLLDNTAQLGLDPQRLAVMGDSAGGCMSAVVSQQAKLAGLPLPALQVLIYPTTDGALAHPSVQTLGQGFGLDLALLHWFRDHFIQDQALIEDYRISPLRNPDLAGQPPAIVITATDPLRDEGLEYAEKLRAAGSTVTSLDYPELVHGFISMGGVIPAARKALNDICDATAQRL (SEQ ID NO: 1).

In the present invention, the lipolytic enzyme may be characterized in that it is derived from Croceibacter atlanticus .

In one embodiment of the present invention, Croceibacter To find the lipolytic enzyme (LipCA) gene derived from atlanticus (Stock No. 40-F12), shotgun cloning and sub cloning were performed, and then one ORF was found out of the entire 1.3 kb nucleotide sequence through the DNAStar program. 1,029 It was confirmed that it was composed of a bp-sized nucleotide sequence, encoded a sequence of 342 amino acids, and had a Gly-Asp-Ser-Ala-Gly motif, a signature sequence of lipase/esterase. In addition, according to the homology model, the active site has a catalytic triad of Ser ¹⁹¹ -His ³¹⁵ -Asp ²⁸⁵ , and the active site pocket is covered with an amphipathic α-helix lid (Leu ²⁴² -Phe ²⁵² ). It was confirmed that it is a lipase enzyme.

In another aspect, the present invention relates to a gene encoding a lipolytic enzyme represented by the amino acid sequence of SEQ ID NO: 1.

In the present invention, the gene may be characterized in that it is represented by the nucleotide sequence of SEQ ID NO: 2, but is not limited thereto.

In the present invention, the nucleotide sequence of SEQ ID NO: 2 is as follows:

ATGAATCCTGCTGTTTTTGAGCGGGCGACTGTACGCGCCCTGATGACGTTACCCGGCCCGGTGCTGGCGCGTTTTGCTGCCGGACTGGAAACCCACAGTCGTTCGCATCTGGATGCGCGGTTGCGTTTTCTGTTGGCACTCAGCAGCGCCAAGCCAACGCTGGATTCAGGCACGGTGGAGCAGGCCCGGCGAACCTACCGGGAGATGATCGCGCTGCTGGATGTGGCGCCGATTCGTCTCCCCGTGGTGGTGGATCACCAGGTCACGGTGGACGACGGCAGCCAGATTCTGGTGCGTCGTTACCGCCCGGCCAATGCGCCGCGAGTGGCTCCCGCCATTCTGTTTTTTCACGGTGGCGGTTTTACTGTGGGCGGCGTGGAAGAGTACGACCGGCTGTGCCGCTATATTGCTGATCGCACCAATGCGGTGGTGCTCAGTGTGGATTACCGGTTGGCCCCGGAGCACCCTGCGCCCACCGGCATGGATGATTCGTTTGCCGCCTGGCGCTGGTTGCTGGATAACACCGCTCAACTGGGCCTGGATCCGCAGCGGTTAGCGGTGATGGGCGATAGTGCGGGCGGTTGCATGAGTGCGGTGGTGTCACAACAGGCCAAGCTGGCAGGCCTGCCGCTGCCGGCGTTGCAGGTGTTGATCTACCCCACCACGGACGGTGCCCTGGCCCACCCTTCCGTGCAGACGCTGGGGCAGGGTTTCGGGCTGGATCTGGCCTTGCTGCACTGGTTCCGTGACCATTTTATTCAGGACCAGGCACTGATCGAAGACTATCGCATCTCCCCCCTGCGCAACCCGGATCTGGCCGGTCAGCCCCCGGCAATTGTGATTACCGCGACGGATCCGTTGCGGGATGAAGGCCTGGAGTACGCCGAAAAACTGCGTGCGGCGGGGAGCACCGTGACCTCACTGGATTACCCGGAACTGGTGCATGGATTTATTTCCATGGGCGGGGTGATTCCGGCAGCCCGCAAGGCGTTGAATGACA TCTGTGATGCCACCGCTCAGCGGTTGTAG (SEQ ID NO: 2).

In one embodiment of the present invention, the lipase gene ( lipCA ) was isolated from the Croceibacter atlanticus strain (Stock No. 40-F12) showing high lipolytic activity by a shotgun cloning method, and the LipCA enzyme was Escherichia coli cells were expressed (KCTC 13603BP).

In another aspect, the present invention relates to a recombinant vector comprising a gene encoding a lipolytic enzyme represented by the amino acid sequence of SEQ ID NO: 1.

In another aspect, the present invention relates to a recombinant microorganism in which a gene encoding a lipolytic enzyme represented by the amino acid sequence of SEQ ID NO: 1 or a recombinant vector including the gene is introduced into a host cell.

In the present invention, the host cell is preferably E. coli , more preferably E. coli BL21 (DE3), and most preferably KCTC 13603BP strain, but is not limited thereto.

The KCTC 13603BP strain of the present invention was deposited on July 27, 2018.

In the present invention, "vector" refers to a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host. Vectors can be plasmids, phage particles or simply potential genomic inserts. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are currently the most commonly used form of vectors, “plasmid” and “vector” are sometimes used interchangeably. For the purposes of the present invention, it is preferred to use a plasmid vector. Typical plasmid vectors that can be used for this purpose include (a) an initiation point for efficient replication to contain hundreds of plasmid vectors per host cell, and (b) a host cell transformed with a plasmid vector to be selected. It has a structure including an antibiotic resistance gene and (c) a restriction enzyme cleavage site into which a foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cleavage site does not exist, the vector and foreign DNA can be easily ligated by using a synthetic oligonucleotide adapter or linker according to a conventional method.

After ligation, the vector must be transformed into an appropriate host cell. In the present invention, the preferred host cell is a prokaryotic cell. Suitable prokaryotic host cells are E. coli XL-1Blue (Stratagene), E. coli DH5α , E. coli JM101, E. coli K12, E. coli W3110, E. coli X1776, E. coli BL21 , and the like. However , strains of E. coli such as FMB101 , NM522, NM538 and NM539 and other prokaryotic species and genera may also be used. In addition to the above E. coli , strains of the genus Agrobacterium such as Agrobacterium A4, bacilli such as Bacillus subtilis, Salmonella typhimurium or Serratia margesense (Serratia marcescens), and various strains of the genus Pseudomonas can be used as host cells.

Transformation of prokaryotic cells can be readily accomplished using the calcium chloride method described in section 1.82 of Sambrook et al., supra. Alternatively, electroporation (Neumann et al., EMBO J. , 1:841, 1982) can also be used for transformation of these cells.

As the vector used for overexpression of the gene according to the present invention, an expression vector known in the art may be used.

As is well known in the art, in order to increase the expression level of a transfected gene in a host cell, the gene must be operably linked to a transcriptional and translational expression control sequence that exerts a function in the selected expression host. Preferably, the expression control sequence and the corresponding gene are included in a single recombinant vector that includes a bacterial selection marker and a replication start point.

The host cell transformed by the above-described recombinant vector constitutes another aspect of the present invention. As used herein, the term "transformation" means that DNA is introduced into a host so that the DNA becomes replicable as an extrachromosomal factor or by chromosomal integrity completion.

Of course, it should be understood that not all vectors perform equally well in expressing the DNA sequence of the present invention. Likewise, not all hosts function equally for the same expression system. However, those skilled in the art can make an appropriate selection among various vectors, expression control sequences and hosts without departing from the scope of the present invention without undue experimental burden. For example, when selecting a vector, the host must be considered, since the vector must be replicated in it. The number of copies of the vector, the ability to control the number of copies, and the expression of other proteins encoded by the vector, such as antibiotic markers, should also be considered.

In another aspect of the present invention, the step of culturing the recombinant microorganism to express a lipolytic enzyme represented by the amino acid sequence of SEQ ID NO: 1; And it relates to a method for producing a lipolytic enzyme comprising the step of recovering the expressed lipolytic enzyme.

In the present invention, the expression of the lipolytic enzyme is recovered by separating it from a cell-free extract, exemplarily, a purification method using a difference in molecular weight and/or affinity, that is, a gel filtration chromatography method. , Membrane separation method, column chromatography method, high performance liquid chromatography method, ion exchange chromatography method, etc. More preferably, the active lipolytic enzyme may be purified through gel filtration chromatography after precipitation with ammonium sulfate, but the present invention is not limited thereto.

In another aspect, the present invention relates to an immobilized lipolytic enzyme obtained by mixing and crosslinking the lipolytic enzyme represented by the amino acid sequence of SEQ ID NO: 1 with glutaraldehyde.

Enzyme stability can be improved and immobilized for repeated use. The cross-linked enzyme aggregate (CLEA) method is a type of cross-linking method that uses a cross-linking agent to covalently bond Lysine residues in the enzyme to increase stability.

In the present invention, the lipolytic enzyme immobilized by the CLEA method refers to a crosslinked enzyme assembly that itself has lipolytic activity. In one embodiment of the present invention, the substrate specificity of the lipolytic enzyme does not change after fixation, but thermal stability, pH stability, and organic solvent stability are increased. In addition, it was easily recovered by centrifugation, and the activity was maintained up to about 40% after being reused 4 times.

In one embodiment of the present invention, after selectively precipitating lipolytic enzyme (LipCA) from the cell extract, glutaraldehyde (25% aqueous solution) was added as a crosslinking agent, stirred, and centrifuged (14,000 Хg, 10 min) to obtain a crosslinked enzyme. LipCA ^CLEA , which is cross-linked enzyme aggregates, was prepared.

In the present invention, the lipolytic enzyme preferably exhibits the highest activity at a temperature of 40° C., a pH of 8.5, and a substrate having C8 carbon atoms, but is not limited thereto. In addition, it may be characterized by high stability at a temperature of 10 to 40° C., pH 6.0 to 8.0, and a hydrophilic organic solvent, more specifically, DMSO and 1,2-dimethoxyethane.

In the present invention, the immobilized lipolytic enzyme preferably exhibits the highest activity in a substrate having a temperature of 40° C., pH 9.0, and C8, but is not limited thereto. In addition, it may be characterized by high stability at a temperature of 10 to 50° C., pH 6.0 to 9.0, and a hydrophilic organic solvent, more specifically, DMSO and 1,2-dimethoxyethane.

The present invention is the first report to show the possibility of industrial application based on the expression, characterization, and cross-linked enzyme Aggregated immobilization of C. atlanticus lipolytic enzyme.

Lipolytic enzymes are attracting particular attention because they can be used in various ways as additives for detergents or soil and wastewater purification. Based on the physical and chemical characterization of LipCA and LipCA ^CLEA according to the present invention, the expression strain, optimum temperature and pH, etc., first mass production technology development is required for industrial application of LipCA, through which application to various fields is possible. Do.

Hereinafter, the present invention will be described in more detail through examples. These examples are for illustrative purposes only, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not construed as being limited by these examples.

Example 1: Experimental material

p -Nitrophenyl acetate (C ₂ ), p -nitrophenyl butyrate (C ₄ ), p -nitrophenyl caprylate (C ₈ ), p -nitrophenyl caprate (C ₁₀ ), p -nitrophenyl laurate (C ₁₂ ), tributyrin (TBN), tricaprylin (TCN), olive oil, glutaraldehyde (25% H ₂ O), amipicillin, isopropanol, 1,2-dimethoxyethane, acetonitrile, 1-butanol, 2-butanone, and propionitrile are Sigma Aldrich Co. (USA), p- nitrophenyl caproate (C ₆ ) was purchased from Tokyo Chemical Industry Co. Purchased from (Japan). Dimethylsulfoxide(DMSO), acetone, pyridine and ethyl acetate were obtained from Junsei Co. (Japan), methanol and ethanol were purchased from Merck Chemical Co. (Germany). β-D-thiogalactopyranoside (IPTG) was obtained from Duchefa Biochemie BV Co. (Netherlands), and Marine badges were purchased from Becton, Dickinson and Co. (USA).

Example 2: Lipolytic enzyme-producing strain isolation

Lipolytic strain screening was performed using TBN/Marine agar medium to select bacteria having lipolytic activity among bacteria isolated from the Antarctic Ross Sea. The preparation method of TBN/Marine agar medium is as follows. TBN and gum arabic solution (200mM NaCl, 10mM CaCl ₂ , 10% gum arabic) are mixed in a 1:9 volume ratio and sterilized. Put this in a waring blender and emulsify at high speed for 2 minutes to make a 10% TBN emulsion, and then mix this and marine agar medium in a 1:9 volume ratio to make TBN/Marine agar medium. After culturing the isolates at 15° C. for 96 hours, the strains that produced the most pronounced transparent rings were selected.

Of the 42 isolates extracted, 24 formed a clear ring in the TBN/Marine agar medium, of which Croceibacter atlanticus (Stock No. 40-F12, 75°44'S, 176°57', the isolate showing the greatest activity) E, depth 320m) was conducted to find the lipase enzyme gene.

Example 3: Lipolytic enzyme gene cloning and sequencing

The largest lipolytic activity Croceibacter atlanticus In order to isolate the lipase gene from the bacteria, shotgun cloning was performed as follows (Fig. 1).

C. atlanticus After genomic DNA was extracted from the bacteria, Hin dIII was treated to create a DNA library. DNA library was ligated to pUC19 vector, transformed into E. coli XL1-Blue, plated on TBN/Luria Bertani (LB) agar medium containing ampicillin (100 μg/ml) and cultured at 37°C. After selecting the colony generating the transparent ring, extracting the plasmid (pUC19- lip1 ), sub-cloning was performed. The pUC19- lip1 plasmid was treated with Hin dIII and Eco RI to obtain a 1.3kb- sized DNA fragment. This was ligated with pUC19 vector and transformed into E. coli XL1-Blue to prepare a recombinant plasmid (pUC19- lip2 ), and the nucleotide sequence of the inserted DNA was analyzed. The DNAStar program and the BLAST program of the National Center for Biotechnology Information (NCBI) were used to analyze the base and amino acid sequence of the lipase gene ( lipCA ) and to search the database, respectively.

As a result of performing shotgun cloning using Hin dIII restriction enzyme, a recombinant plasmid (pUC19- lip1 ) having an insert DNA of about 10 kb was obtained. Afterwards, 10kb DNA was cut with Eco RI to obtain gene fragments of about 1.3kb and 9kb, and these were ligated to pUC19 to create two recombinant plasmids. Recombinant plasmid was transformed into E. coli XL1-Blue and screened in TBN/LB agar medium. As a result, a transparent ring was formed in E. coli containing 1.3 kb of DNA. Since the lipase gene found by sub cloning was linked to the pUC19 vector, sequence analysis was performed using M13-20F/M13-47R primer.

M13-20F primer: 5'-GTA AAA CGA CGG CCA G-3' (SEQ ID NO: 3)

M13-47R primer: 5'-CGC CAG GGT TTT CCC AGT CAC GAC-3' (SEQ ID NO: 4)

Through the DNAStar program, one ORF was found out of the 1.3 kb total nucleotide sequence, which is composed of a nucleotide sequence of 1,029 bp and codes for 342 amino acid sequences. The molecular weight of the protein calculated from the amino acid sequence was 37,099 Da, and was found to have a Gly-Asp-Ser-Ala-Gly motif, a signature sequence of lipase/esterase (FIG. 2).

C. atlanticus The lipase gene isolated from the fungus was named lipCA . As a result of searching lipCA with NCBI's BLAST program, Alcanivorax sp. It showed 100% homology with the putative alpha/beta hydrolase (Sequence ID, WP_007151635) of DG881 (Fig. 3). Alcanivorax sp. DG881 is a fungus isolated from the Antarctic Sea, C. atlanticus It is a fungus belonging to the phylum that is completely different from the fungus family (Cho JC, Giovannoni SJ. 2003. Croceibacter atlanticus gen.nov., sp. Nov., A Novel Marine Bacterium in the Family Flavobacteriaceae . Syst. Appl . Microbiol . 26: 76- 83.; 13. Lai Q, Wang J, Gu L, Zheng T, Shao Z. 2013. Alcanivorax marinus sp. Nov., isolated from deep-sea water. Int. J. Syst. Evol. Microbiol. 63: 4428-4432.).

Example 4: 16s rRNA identification of isolate

Croceibacter Genomic DNA of atlanticus (Stock No. 40-F12) was analyzed for 16s rRNA using 514F and 1542R primers.

514F: 5'-CGT GCC AGC AGC CGC GGT-3' (SEQ ID NO: 5)

1542R: 5'-AGA AAG GAG GTG ATC CAC CC-3' (SEQ ID NO: 6)

The DNAStar program and the BLAST program of the National Center for Biotechnology Information (NCBI) were used for partial nucleotide sequence analysis and database search of 16s rRNA.

As a result of performing 16s rRNA analysis, it showed 99.9% homology with C. atlanticus HTCC2559 (Fig. 4a), and Alcanivorax sp. It showed a low 79.2% homology with DG881 (Fig. 4b). Nevertheless, the fact that C. atlanticus and Alcanivorax have the same lipase enzyme gene is very interesting and suggests the possibility that gene transfer may have occurred between bacteria living in the same environment in Antarctica. So far, no lipase has been reported from C. atlanticus bacteria, and Alcanivorax Since research on putative hydrolase has not been conducted at all, the present inventors Enzymes were mass-produced and characterization studies were conducted.

Example 5: LipCA homology modeling

Since screening was performed in TBN agar medium, it is necessary to confirm whether lipCA is a lipase gene or an esterase gene. The structural difference between lipase and esterase is the presence or absence of amphipathic α-helix lid. The amino acid sequence of LipCA was entered into SWISS-MODEL (https://swissmodel.expasy.org) to perform homology modeling. LipCA homology model was performed based on alpha/beta hydrolase enzyme (PDB ID 5JD4) derived from the Spain Arreo lake metagenome (Martinez-Martinez M, et al., 2013. Biochemical diversity of carboxyl esterases and lipases from lake Arreo. (Spain):... a metagenomic approach Appl Environ Microbiol 79:.. 3553-3562), made the protein three-dimensional structure through the program PyMOL.

As a result of modeling the Spain Arreo lake hydrolase, which has 38.24% identity with LipCA, as a template, it was found that LipCA has an α/β hydrolase structure with a parallel β-sheet composed of 8 strands at the center. It has a catalytic triad of Ser ¹⁹¹ -His ³¹⁵ -Asp ^{285 in} the active site, and it was confirmed that the active site pocket is a typical lipase enzyme covered by amphipathic α-helix lid (Leu ²⁴² -Phe ²⁵² ) (Fig. 5) (Arpigny JL , Jaeger KE 1999. Bacterial lipolytic enzymes: . classification and properties Biochem J. 343:... 177-183 .; Kartal F, et al, 2011. Improved esterification activity of Candida rugosa lipase in organic solvent by immobilization as cross-linked enzyme aggregates (CLEAs). J. Mol . Catal . B: Enzym. 71: 85-89.).

Example 6: Lipase gene ( lipCA ) Expression

The lipCA gene inserted into the recombinant plasmid (pUC19- lip2 ) was amplified through a PCR reaction using lipCA- F/ lipCA- R primers.

lipCA- F: 5'-GAT CAT ATG AAT CCT GCT GTT TTT-3' (SEQ ID NO: 7)

lipCA- R: 5'-GAT AAG CTT TTA CAA CCG CTG AGC-3' (SEQ ID NO: 8)

The amplified DNA was ligated to a pGEM-T vector to make a recombinant plasmid (pGEM-T- lipCA ) and transformed into E. coli XL1-Blue. Recombinant plasmid isolated from E. coli was treated with Nde I and Hin dIII to obtain lipCA gene. This was ligated to pET-22 vector to create a recombinant plasmid (pET-22- lipCA ) and transformed into E. coli BL21 (DE3). The transformed E. coli bacteria were inoculated into LB containing ampicillin (100 μg/ml) and cultured at 37° C. until absorbance (600 nm) reached 0.5. IPTG (0.1 mM) was added and further incubated at 20°C for 20 hours. After incubation, the bacteria were collected by centrifugation (3,500 Хg, 10 min), washed with distilled water, and then resuspended with distilled water. After crushing the bacteria by ultrasonic grinding, centrifugation (14,000 Хg, 10 min) was performed to obtain a cell-free extract, and lipase purification and CLEA preparation were performed.

Example 7: Isolation and purification of LipCA

The lipCA gene was cloned into pET-22 and transformed into E. coli BL21 (DE3). IPTG was added to the E. coli culture solution and cultured for 20 hours at 20°C. As a result, LipCA was produced in large quantities, and it was confirmed that LipCA was present in the supernatant of the cell extract in the form of a water-soluble protein through SDS-PAGE analysis (Fig. 6).

As a result of salting-out by adding ammonium sulfate to 30% saturation to the cell extract, most of the LipCA protein precipitated. After the protein was suspended in a small amount of solution, desalting and enzyme separation were simultaneously performed through gel filtration chromatography (Saxena RK, Sheoran A, Giri B, Davidson WS. 2003. Purification strategies for microbial lipase. J. Microbiol . Methods. 52: 1-18). In general, most proteins are precipitated in a 30-70% saturated solution of ammonium sulfate (Li M, Yang LR, Xu G, Wu JP. 2013. Screening, purification and characterization of a novel cold-active and organic solvent-tolerant lipase) from Stenotrophomonas maltophilia CGMCC 4254. Bioresour . Technol . 148: 114-120.; Wang Q, Hou Y, Ding Y, Yan P. 2012. Purification and biochemical characterization of a cold-active lipase from Antarctic sea ice bacteria Pseudoalteromonas sp. NJ 70. Mol. Biol . Rep. 39: 9233-9238.) The precipitation of LipCA in a saturated solution of 0-30% ammonium sulfate is a very peculiar result. This was presumed to be due to the large distribution of hydrophobic amino acid residues on the surface of the LipCA enzyme. The isolated LipCA showed a size of about 37 kDa on SDS-PAGE (Fig. 6), and has an activity of 329 U/mg (Table 1).

LipCA tablets Purification
step Total
activity
(U) Total
protein
(mg) Specific
activity
(U/mg) Yield
(%) Purification
fold Cell-free extract 2370 51.0 46.5 100 One (NH ₄ ) ₂ SO ₄ PPT 1640 8.00 205 69 4.4 GPC 1420 4.32 329 60 7.0

It was confirmed through the SDS-PAGE result that LipCA was separated, and enzyme characterization studies were performed using the separated LipCA.

For the purification of LipCA, ammonium sulfate was added to the cell extract to be saturated with 30%, and the protein was precipitated for 1 hour. Discard the supernatant by centrifugation (14,000 Хg, 4 min), add a buffer solution PBS (Phosphate Buffer Solution, NaCl 137mM, KCl 2.7mM, Na ₂ HPO ₄ 10mM, KH ₂ PO ₄ 1.8mM) to the precipitated protein and resuspend Made it. Desalting and purification of the protein was performed through gel filtration chromatography in FPLC equipped with Superose ^TM 12 10/300 GL gel filtration column (GE healthcare, Buckinghamshire, UK).At this time, 20 mM Tris-HCl (pH 8.5) was used as an elution solution. Used.

Example 8: LipCA ^CLEA Manufacture of

Ammonium sulfate was added to the cell extract to be saturated with 30%, and LipCA was selectively precipitated for 1 hour. After precipitation, glutaraldehyde (25% aqueous solution), a crosslinking agent, was added at concentrations of 25, 50, 75, and 100mM, respectively, and stirred at 10°C for 24 hours (Kartal F, et al., 2011. Improved esterification activity of Candida. rugosa lipase in organic solvent by immobilization as cross-linked enzyme aggregates (CLEAs). J. Mol . Catal . B: Enzym . 71: 85-89.; Rehman S, et al., 2016. Cross-linked enzyme aggregates (CLEAs) of Pencilluim notatum lipase enzyme with improved activity, stability and reusability characteristics. Int . J. Biol . Macromol . 91: 1161-1169.). LipCA ^CLEA prepared through centrifugation (14,000 Хg, 10 min) was washed twice with 50 mM potassium phosphate (pH 8.0), suspended in 500 μl of the same buffer, and stored at 10°C.

The activity retention of the resulting four concentrations of LipCA ^CLEA was measured as 108%, 73%, 37%, and 24%, respectively, when the enzyme activity of the cell extract was set as 100% (Table 2).

Activity retention of manufactured LipCA ^CLEA Lipase preparation Total activity(U) Activity retention(%) Cell free extract 128 100 LipCA ^CLEA prepared with GA ^a Conc. of 0mM 83.6 65.5 25mM 138 108 50mM 92.9 72.8 75mM 46.6 36.5 100mM 30.1 23.6

^a GA stands for Glutaraldehyde.

The reason why the activity decreases as the concentration of glutaraldehyde increases can be explained as follows. LipCA protein consists of lysine and arginine in 10% of the total amino acid composition. Glutaraldehyde, as a crosslinking agent, connects lysine and arginine residues by covalent bonds in the form of schiff bases, and thus can bind to precipitated LipCA proteins (Gauthier MA, et al., 2011. Arginine-specific protein modification using α-oxoxo) Chem -aldehyde functional polymers prepared by atom transfer radical polymerization Polym 2:...... 1490-1498 .; Farris S, et al, 2010. Alternative reaction mechanism for the cross-linking of gelatin with glutaraldehyde J. Agric Food Chem 58: 998-1003). However, as the concentration of glutaraldehyde increases, covalent bonds within and between protein molecules increase, and ionic bonds originally formed by lysine and arginine in the LipCA protein molecule are broken. That is, it is estimated that structural denaturation proceeds simultaneously with the phenomenon that the flexibility of the active site of the enzyme decreases (Migneault I, Dartiguenave C, Bertrand MJ, Waldron KC. 2004. Glutaraldehyde: behavior in aqueous solution, reaction with proteins, and application to .. enzyme crosslinking Biotechniques 37: 790-802 ).. Therefore, in the present invention, a characteristic study was performed using LipCA ^CLEA made of glutaraldehyde having the highest activity of 25mM.

Example 9: LipCA, LipCA ^CLEA Of temperature and pH on the lipolytic activity of

Lipase activity was measured under the following reference conditions. 0.1mM p- nitrophenyl caprylate ( p NPC) was used as a substrate, and the substrate and enzyme solution were added to a 50mM Tris-HCl (pH 8.5) buffer solution and reacted at 37° C. for 3 minutes to measure absorbance (405 nm). Enzyme activity 1 unit was defined as the amount of enzyme that produces 1 μmol of p- nitrophenol in 1 minute (Iftikhar T, et al., 2011. Purification and characterization of extracellular lipase. Pak. J. Bot. 43: 1541-1545 .;... Pιrez D, et al, 2011. A novel halophilic lipase, LipBL, showing high efficiency in the production of eicosapentaenoic acid (EPA) PLoS ONE https://doi.org/10.1371/journal.pone.0023325. ).

In order to confirm the optimum temperature of LipCA and LipCA ^CLEA , the enzyme reaction was carried out at a temperature between 10 ℃ and 80 ℃. Enzyme activity was measured by p NPC assay, and 50mM potassium phosphate (pH 8.0) was used as a buffer solution.

The optimum pH was also carried out through the p NPC assay, and the reaction temperature was carried out at 37°C. The pH values were measured from 7.0 to 10.0, and the buffer solutions used were as follows: 50mM potassium phosphate (pH 7.0-8.0), 50mM Tris-HCl (pH 8.5-9.0), and 50mM sodium bicarbonate (pH 9.5-10.0).

The temperature and pH characteristics of LipCA and LipCA ^CLEA were confirmed by measuring the degradation activity of p NPC substrate. It was found that the optimum temperature of both LipCA and LipCA ^CLEA was 40°C (FIG. 7A), the optimum pH of LipCA was 8.5, and the optimum pH of LipCA ^CLEA was 9.0 (FIG. 7B). From the fact that the optimum pH increased due to the immobilization of the enzyme, it can be seen that the active site of the enzyme was partially modified.

Example 10: LipCA, LipCA ^CLEA Of temperature and pH on the stability of

It was confirmed that the stability of the enzyme due to the immobilization was increased by performing stability tests for the temperature and pH of LipCA and LipCA ^CLEA .

In order to check the stability of LipCA and LipCA ^CLEA against temperature, it was allowed to stand from 10℃ to 80℃ for 1 hour at 10℃ intervals, and then the p NPC assay was performed. For both LipCA and LipCA ^CLEA, 50mM potassium phosphate (pH 8.0) was used as a buffer solution. The residual activity of the enzyme was measured through the p NPC assay under the reference condition, and the reference condition was that LipCA and LipCA ^CLEA were mixed with the enzyme and 0.1 mM p NPC in a buffer solution of 50 mM Tris-HCl (pH 8.5, pH 9.0), respectively. After reacting at for 3 minutes, the amount of p- nitrophenol produced is measured by absorbance (405 nm).

In order to confirm the pH stability of the lipase, the enzyme was allowed to stand for 1 hour under the condition of pH 1.0-12.0, and then the residual activity was measured. Buffer solutions depending on the pH used are as follows: 50mM KCl-HCl (pH 1.0-2.0), 50mM glycine-HCl (pH 3.0), 50mM acetate-sodium acetate (pH 4.0-5.0), 50mM potassium phosphate (pH 6.0) -8.0), 50mM Tris-HCl (pH 9.0), 50mM sodium-bicarbonate (pH 10.0), 50mM NaHCO ₃ -NaOH (pH 11.0), 50mM KCl-NaOH (pH 12.0). To measure the residual activity of the enzyme, p NPC assay was used. For 3 minutes at 37°C, LipCA reacted in a buffer solution of 50mM Tris-HCl (pH 8.5) and LipCA ^CLEA in a buffer solution of 50mM Tris-HCl (pH 9.0). After making, the residual activity was measured.

First, in the case of thermal stability, LipCA ^CLEA was more stable at a temperature of 20°C or higher than that of LipCA (FIG. 7C). In addition, for pH stability, LipCA ^CLEA has a wider pH stability range than LipCA (Fig. 7D). It can be seen that the enzyme formed a robust structure through covalent bonds between the lysine and arginine residues of LipCA protein carried out by glutaraldehyde (Saxena RK, et al., 2003. Purification strategies for microbial lipase. J. Microbiol . Methods. 52 : 1-18.; Li M, et al., 2013. Screening, purification and characterization of a novel cold-active and organic solvent-tolerant lipase from Stenotrophomonas maltophilia CGMCC 4254. Bioresour . Technol . 148: 114-120.).

Example 11: LipCA, LipCA ^CLEA Specificity for the temperament of

In order to investigate the specificity of the substrate, the degradation capacity of various substrates was measured by p NP ester assay and pH stat assay. The p NP ester assay used the following substrates with different carbon numbers under reference conditions: p -nitrophenyl acetate, butyrate, caproate, caprylate, caprate, and laurate.

The pH stat assay was used as a method to determine the substrate specificity for triglycerides, and 1% TBN, TCN, and olive oil were used as substrates. The reaction condition of the pH stat assay is 3 minutes at 37℃, and before the enzymatic reaction proceeds, a 10mM NaOH solution is added to the emulsion in which 1% of the substrate and 10% gum arabic are emulsified to adjust the pH to 8.0. As the enzyme reaction proceeds, triglycerides are decomposed into fatty acid and glycerol, and NaOH solution is added. Enzyme activity was measured by the amount of NaOH added, and 1 unit was defined as the amount of enzyme that produced 1 μmol of fatty acid in 1 minute. The pH stat assay was measured with a 718 Titrino pH titrator (Metrohm, Switzerland) (Kim HK, Park SY, Lee JK, Oh TK. 1998. Gene cloning and characterization of thermal stable lipase from Bacillus stearothermophilus) L1. Biosci . Biotechnol . Biochem . 62: 66-71.).

As a result of measuring p NP-ester assay for p NP substrates having various carbon lengths, the relative activity was highest when p -nitrophenyl caprylate having 8 carbon atoms was used as a substrate (FIG. 8A). In the case of the pH stat assay, the highest activity was shown when TBN composed of butyric acid with 4 carbon atoms was used as a substrate. However, even when olive oil with oleic acid having 18 carbon atoms was used as a substrate, high relative activity was shown (FIG. 8B). This means that LipCA is a lipase enzyme capable of cutting not only short carbon chains but also long carbon chains, and it means that the immobilization process using glutaraldehyde does not affect the active site of the enzyme.

Example 12: LipCA, LipCA ^CLEA Of organic solvents on the stability of

In order to test the stability of the organic solvent, the enzyme was left in the organic solvent for 1 hour, and then the residual activity was measured through the p NPC assay under the reference condition. The organic solvents used were as follows: DMSO, methanol, acetonitrile, ethanol, acetone, 1,2-dimethoxyethane, isopropanol, propionitrile, 2-butanone, pyridine, ethyl acetate, 1-butanol.

LipCA was tested for stability in 10% organic solvent. Among the 12 types of organic solvents used in the experiment, high stability was revealed in a hydrophilic organic solvent (FIG. 9A), and a stability test was conducted in 30% hydrophilic organic solvent based on the results. LipCA ^CLEA was tested for stability only in 30% hydrophilic organic solvent. As a result, both LipCA and LipCA ^CLEA had high relative activities in DMSO and 1,2-dimethoxyethane (FIG. 9B). The reason for the relatively high activity in 30% 1,2-dimethoxyethane is that 1,2-dimethoxyethane acted as a protein precipitating agent (Lopez-Serrano P, et al., 2002. Cross-linked enzyme aggregates with enhanced activity: application to ... lipases Biotechnol Lett 24: . 1379-1383). The total enzymatic activity of LipCA, which was first isolated by precipitating with 30% ammonium sulfate, was greater than that of LipCA, which was separated second by gel filtration chromatography. This suggests that LipCA is more active when aggregated than when it was water-soluble. For 30% hydrophilic organic solvent, LipCA ^CLEA also showed similar graph pattern to LipCA, but the relative activity was higher in DMSO and 1,2-dimethoxyethane. This means that the stability to the organic solvent increased due to the immobilization (FIG. 9B).

Example 13: LipCA ^CLEA Recovery of

Centrifugation (19,000Хg, 10 min) was used as a recovery method for measuring the recovery rate of LipCA ^CLEA . A total of five centrifugation was performed, and the residual activity of the supernatant after centrifugation and the lower layer resuspended with 50mM potassium phosphate (pH 8.0) was measured by p NPC assay under the reference conditions.

The biggest advantage of LipCA enzyme immobilized by CLEA method is low manufacturing cost and easy recovery. That is, the CLEA enzyme can be quickly and effectively recovered using centrifugation. The LipCA ^CLEA used in the present invention was added to glutaraldehyde using the last 48 hours, LipCA ^CLEA. A total of five centrifugation was performed, and 40% or more of the activity was maintained after four times of recovery (FIG. 10).

The gradual decrease in activity after multiple uses of LipCA ^CLEA is a result of the enzyme dropping from CLEA, and it is presumed that the Lys content of LipCA enzyme is low and the molecular length of glutaraldehyde used as a cross-linker is short. Existing literature (Valdes EC, Soto LW, Arcaya GA. 2011. Influence of the pH of glutaraldehyde and the use of dextran aldehyde on the preparaton of cross-linked enzyme aggregates (CLEAs) of lipase from Burkholderia. cepacia . Electronic J. Biotechnol . 14: doi: 10.2225/vol14-issue3-fulltext-1.), it was found that the enzyme could be prevented from dropping by adding BSA, adjusting the pH, and using dextran aldehyde. It is expected that the enzyme activity can be stabilized.

As described above, specific parts of the present invention have been described in detail, and it will be apparent to those of ordinary skill in the art that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. will be. Accordingly, it will be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.

Korea Research Institute of Bioscience and Biotechnology Biological Resource Center KCTC13603BP 20180727

<110> Korea Institute of Ocean Science and Technology <120> Lipase from Croceibacter atlanticus <130> P20-B181 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 342 <212> PRT <213> Artificial Sequence <220> <223> Croceibacter atlanticus LipCA <400> 1 Met Asn Pro Ala Val Phe Glu Arg Ala Thr Val Arg Ala Leu Met Thr 1 5 10 15 Leu Pro Gly Pro Val Leu Ala Arg Phe Ala Ala Gly Leu Glu Thr His 20 25 30 Ser Arg Ser His Leu Asp Ala Arg Leu Arg Phe Leu Leu Ala Leu Ser 35 40 45 Ser Ala Lys Pro Thr Leu Asp Ser Gly Thr Val Glu Gln Ala Arg Arg 50 55 60 Thr Tyr Arg Glu Met Ile Ala Leu Leu Asp Val Ala Pro Ile Arg Leu 65 70 75 80 Pro Val Val Val Asp His Gln Val Thr Val Asp Asp Gly Ser Gln Ile 85 90 95 Leu Val Arg Arg Tyr Arg Pro Ala Asn Ala Pro Arg Val Ala Pro Ala 100 105 110 Ile Leu Phe Phe His Gly Gly Gly Phe Thr Val Gly Gly Val Glu Glu 115 120 125 Tyr Asp Arg Leu Cys Arg Tyr Ile Ala Asp Arg Thr Asn Ala Val Val 130 135 140 Leu Ser Val Asp Tyr Arg Leu Ala Pro Glu His Pro Ala Pro Thr Gly 145 150 155 160 Met Asp Asp Ser Phe Ala Ala Trp Arg Trp Leu Leu Asp Asn Thr Ala 165 170 175 Gln Leu Gly Leu Asp Pro Gln Arg Leu Ala Val Met Gly Asp Ser Ala 180 185 190 Gly Gly Cys Met Ser Ala Val Val Ser Gln Gln Ala Lys Leu Ala Gly 195 200 205 Leu Pro Leu Pro Ala Leu Gln Val Leu Ile Tyr Pro Thr Thr Asp Gly 210 215 220 Ala Leu Ala His Pro Ser Val Gln Thr Leu Gly Gln Gly Phe Gly Leu 225 230 235 240 Asp Leu Ala Leu Leu His Trp Phe Arg Asp His Phe Ile Gln Asp Gln 245 250 255 Ala Leu Ile Glu Asp Tyr Arg Ile Ser Pro Leu Arg Asn Pro Asp Leu 260 265 270 Ala Gly Gln Pro Pro Ala Ile Val Ile Thr Ala Thr Asp Pro Leu Arg 275 280 285 Asp Glu Gly Leu Glu Tyr Ala Glu Lys Leu Arg Ala Ala Gly Ser Thr 290 295 300 Val Thr Ser Leu Asp Tyr Pro Glu Leu Val His Gly Phe Ile Ser Met 305 310 315 320 Gly Gly Val Ile Pro Ala Ala Arg Lys Ala Leu Asn Asp Ile Cys Asp 325 330 335 Ala Thr Ala Gln Arg Leu 340 <210> 2 <211> 1029 <212> DNA <213> Artificial Sequence <220> <223> Croceibacter atlanticus LipCA <400> 2 atgaatcctg ctgtttttga gcgggcgact gtacgcgccc tgatgacgtt acccggcccg 60 gtgctggcgc gttttgctgc cggactggaa acccacagtc gttcgcatct ggatgcgcgg 120 ttgcgttttc tgttggcact cagcagcgcc aagccaacgc tggattcagg cacggtggag 180 caggcccggc gaacctaccg ggagatgatc gcgctgctgg atgtggcgcc gattcgtctc 240 cccgtggtgg tggatcacca ggtcacggtg gacgacggca gccagattct ggtgcgtcgt 300 taccgcccgg ccaatgcgcc gcgagtggct cccgccattc tgttttttca cggtggcggt 360 tttactgtgg gcggcgtgga agagtacgac cggctgtgcc gctatattgc tgatcgcacc 420 aatgcggtgg tgctcagtgt ggattaccgg ttggccccgg agcaccctgc gcccaccggc 480 atggatgatt cgtttgccgc ctggcgctgg ttgctggata acaccgctca actgggcctg 540 gatccgcagc ggttagcggt gatgggcgat agtgcgggcg gttgcatgag tgcggtggtg 600 tcacaacagg ccaagctggc aggcctgccg ctgccggcgt tgcaggtgtt gatctacccc 660 accacggacg gtgccctggc ccacccttcc gtgcagacgc tggggcaggg tttcgggctg 720 gatctggcct tgctgcactg gttccgtgac cattttattc aggaccaggc actgatcgaa 780 gactatcgca tctcccccct gcgcaacccg gatctggccg gtcagccccc ggcaattgtg 840 attaccgcga cggatccgtt gcgggatgaa ggcctggagt acgccgaaaa actgcgtgcg 900 gcggggagca ccgtgacctc actggattac ccggaactgg tgcatggatt tatttccatg 960 ggcggggtga ttccggcagc ccgcaaggcg ttgaatgaca tctgtgatgc caccgctcag 1020 cggttgtag 1029 <210> 3 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> M13-20F primer <400> 3 gtaaaacgac ggccag 16 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> M13-47R primer <400> 4 cgccagggtt ttcccagtca cgac 24 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> 514F primer <400> 5 cgtgccagca gccgcggt 18 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1542R primer <400> 6 agaaaggagg tgatccaccc 20 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> lipCA-F primer <400> 7 gatcatatga atcctgctgt tttt 24 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> lipCA-R primer <400> 8 gataagcttt tacaaccgct gagc 24

Claims (3)

Culturing the gene represented by the nucleotide sequence of SEQ ID NO: 2 or E. coli into which the recombinant vector containing the gene is introduced to express the lipolytic enzyme represented by the amino acid sequence of SEQ ID NO: 1; And adding a 30% saturated ammonium sulfate solution to precipitate and recover the expressed lipolytic enzyme.
The method of claim 1, wherein the lipolytic enzyme is a lipolytic enzyme derived from Croceibacter atlanticus .
delete

Images