KR0180570B1 - Novel plasmid pkle and mass production method of lipase by using the same - Google Patents

Novel plasmid pkle and mass production method of lipase by using the same Download PDF

Info

Publication number
KR0180570B1
KR0180570B1 KR1019960020320A KR19960020320A KR0180570B1 KR 0180570 B1 KR0180570 B1 KR 0180570B1 KR 1019960020320 A KR1019960020320 A KR 1019960020320A KR 19960020320 A KR19960020320 A KR 19960020320A KR 0180570 B1 KR0180570 B1 KR 0180570B1
Authority
KR
South Korea
Prior art keywords
lipase
pkle
plasmid
strain
novel
Prior art date
Application number
KR1019960020320A
Other languages
Korean (ko)
Other versions
KR980002265A (en
Inventor
김형권
박순양
오병철
오태광
Original Assignee
박원훈
한국과학기술연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 박원훈, 한국과학기술연구원 filed Critical 박원훈
Priority to KR1019960020320A priority Critical patent/KR0180570B1/en
Publication of KR980002265A publication Critical patent/KR980002265A/en
Application granted granted Critical
Publication of KR0180570B1 publication Critical patent/KR0180570B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 신규한 플라스미드 pKLE와 이를 이용한 리파제의 대량생산방법에 관한 것으로서, 더욱 상세하게는 유전자 조작에 의해 제조된 신규한 재조합 벡터 pKLE을 이용하여 알카리 및 단백질 분해효소에 대한 내성이 강하고 용매안정성이 우수한 리파제를 대장균 세포내에서 다량 발현시키고 이를 활성이 있는 안정된 형태로 고수율로 분리정제하여 제조하는 방법에 관한 것이다.The present invention relates to a novel plasmid pKLE and a method for mass production of lipase using the same, and more particularly, to a method for mass production of lipase using the novel plasmid pKLE using a novel recombinant vector pKLE prepared by genetic engineering and having high resistance to alkaline and proteolytic enzymes, And a method for preparing the lipase by mass-expressing excellent lipase in E. coli cells and isolating and purifying the lipase in a stable form having high activity and high yield.

Description

신규한 플라스미드 pKLE와 이를 이용한 리파제의 대량생산방법Method for mass production of novel plasmid pKLE and lipase using the same

제1도는 본 발명에 따른 신규한 플라스미드 pKLE의 제조과정을 나타낸 도면이고,FIG. 1 is a view showing a process for producing a novel plasmid pKLE according to the present invention,

제2도는 신규한 플라스미드 pKLE의 유전자 지도이고,Figure 2 is a gene map of the novel plasmid pKLE,

제3도는 1% 아가로우즈 젤 전기영동법에 의해 pKLE를 확인한 분석사진이고,FIG. 3 is an analysis image showing pKLE confirmed by 1% agarose gel electrophoresis,

제4도는 형질전환된 대장균을 배양하고 IPTG 처리후 시간에 따른 세포추출액의 리파제 활성을 측정한 그래프이고,FIG. 4 is a graph showing the lipase activity of the cell extract according to time after culturing the transformed E. coli and IPTG treatment,

제5도는 형질전환된 대장균을 배양하고 IPTG 처리후 시간에 따른 세포추출액의 SDS-PAGE 전기영동 분석 결과이며,FIG. 5 shows the result of SDS-PAGE electrophoresis analysis of the cell extract with time after culturing transformed E. coli and IPTG treatment,

제6도는 순수 분리된 리파제의 SDS-PAGE 전기영동 사진을 나타낸 것이고,FIG. 6 shows an SDS-PAGE electrophoresis photograph of purely separated lipase,

제7도는 생산된 리파제의 트리올레인 분해능을 관찰한 사진이다.FIG. 7 is a photograph showing the ability of the produced lipase to degrade the triolein.

본 발명은 신규한 플라스미드 pKLE와 이를 이용한 리파제의 대량생산방법에 관한 것으로서, 더욱 상세하게는 유전자 조작에 의해 제조된 신규한 재조합 벡터 pKLE을 이용하여 알카리 및 단백질 분해효소에 대한 내성이 강하고 용매안정성이 우수한 리파제를 대장균 세포내에서 다량 발현시키고 이를 활성이 있는 안정된 형태로 고수율로 분리정제하여 제조하는 방법에 관한 것이다.The present invention relates to a novel plasmid pKLE and a method for mass production of lipase using the same, and more particularly, to a method for mass production of lipase using the novel plasmid pKLE using a novel recombinant vector pKLE prepared by genetic engineering and having high resistance to alkaline and proteolytic enzymes, And a method for preparing the lipase by mass-expressing excellent lipase in E. coli cells and isolating and purifying the lipase in a stable form having high activity and high yield.

리파제는 장쇄 지방산을 갖고 있는 트리글리세라이드를 가수분해하여 디글리세라이드, 모노글리세라이드, 글리세롤 및 지방산 등으로 만드는 효소로서, 식품, 화학 및 피혁 가공산업 등에서 널리 이용되고 있다.Lipase is an enzyme that hydrolyzes triglyceride having a long chain fatty acid to form diglyceride, monoglyceride, glycerol, fatty acid, and the like, and is widely used in food, chemical and leather processing industries.

또한, 리파제는 세탁과정에서 지방 성분의 때를 물에 잘 녹는 지방산 또는 글리세롤로 가수분해시켜 계면활성제의 작용을 용이하게 해주는 역할을 한다.In addition, lipase plays a role in facilitating the action of surfactant by hydrolyzing the fat component during the washing process with fatty acid soluble in water or glycerol.

따라서, 세제용 리파제에 관한 연구가 많이 이루어져 왔으며, 그 결과 1988년 아스퍼질러스 오라이제(Aspergillus oryzae)에서 대량 생산된 휴미콜라 라누기노사(Humicola lanuginosa) 리파제가 Lipoase™이라는 이름으로 효소시장에 사용되기 시작하여 현재는 전세계적으로 사용되고 있는 실정이다.Therefore, many studies on detergent lipases have been conducted, and as a result, in 1988, the mass produced Humicola lanuginosa lipase from Aspergillus oryzae was used in the enzyme market under the name of Lipoase (TM) And now it is used worldwide.

그 이후로, 슈도모나스 알칼리겐스(Pseudomonas alcaligens)[유럽특허 제0334462호], 바실러스 퓨밀리스(Bacillus pumilis[유럽특허 제91-16422호], 슈도모나스 플란타리(Pseudomonas plantarii)[유럽특허 제468102A1호] 및 슈도모나스 글루메(Pseudomonas glumae)[유럽특허 제407225A1호] 등이 생산하는 리파제도 세제용으로 적합한 것으로 판명되었다.Thereafter, Pseudomonas alcaligens (European Patent No. 0334462), Bacillus pumilis (European Patent No. 91-16422), Pseudomonas plantarii (European Patent 468102A1) And Lipase produced by Pseudomonas glumae [European Patent No. 407225A1] and the like have also proven to be suitable for detergents.

그런데 세제용으로 사용되는 리파제는 알칼리성 단백질 가수분해효소에 대해서도 내성이 있어야 하지만, 상기 보고된 리파제들은 이와같은 문제점을 해결하지 못해 세제로 사용할 때 그 효과가 크지 못한 문제가 있다.However, the lipase used for the detergent should be resistant to the alkaline protease, however, the lipases reported above can not solve the above problem, so that there is a problem that the lipase is not effective when used as a detergent.

상기와 같이 리파제는 세제용 이외에도 일반적으로 리파제가 위치특이성과 광학활성 특이성을 나타냄으로 인하여 의약품을 비롯한 부가가치가 높은 선도물질의 합성에서 생촉매(biocatalyst)로써 사용되고 있다.As described above, lipase is generally used as a biocatalyst in the synthesis of high-value-added lead compounds including pharmaceuticals because lipase exhibits position specificity and optical activity specificity in addition to detergent.

이와같은 이유로 근래 생촉매로서의 리파제의 사용이 폭증하고 있으나, 용매안정성이 떨어지는 문제가 있다.For this reason, although the use of lipase as a biocatalyst has recently been intensified, there is a problem that the stability of the solvent is poor.

따라서, 이와같은 상기의 리파제 사용에 따른 문제점을 해결하기 위하여 노력한 결과, 본 발명자들은 알칼리 내성과 단백질 가수분해 효소 내성이 우수하며 용매에 대한 안정성이 큰 효소를 생산하는 신규 미생물을 발견하여 이를 동정한 결과 프로테우스 불가리스(Proteus vulgaris) K80으로 규명되었고 이를 1995년 1월 9일자로 대한민국 특허 균주기탁기관인 한국과학기술연구원 부설 생명공학연구소내 유전자원센타에 기탁하고 수탁번호 KCTC 8642P를 부여받았다[대한민국 특허 출원 제95-4708호]. 여기서, 상기 미생물이 생산하는 신규 리파제에 대하여 특성을 조사하였으며, 그 결과 효소 역가가 우수하고 단백질분해 효소나 알칼리에 대한 내성이 우수함을 증명하였다.As a result, the present inventors have found a novel microorganism that produces an enzyme having high alkali resistance and high protease resistance and high stability against a solvent. As a result, it was identified as Proteus vulgaris K80 and deposited with the Genetic Resource Center in the Institute of Biotechnology, Korea Research Institute of Science and Technology (KITS), which is a depository of the Korean patent strain, on January 9, 1995, and granted accession number KCTC 8642P 95-4708]. Here, the characteristics of the novel lipase produced by the microorganism were examined, and as a result, it was proved that the enzyme had an excellent titer and an excellent resistance to proteolytic enzymes and alkalis.

이에 따라, 본 발명자들은 상기와 같은 우수한 특성을 갖는 리파제를 대량생산하고자 하였는 바, 일반적인 리파제의 경우 해당 폴리펩티드로 판독된 후에 활성이 있는 3차 구조로 폴딩되기 위해서 또다른 단백질(Lif-Lipase foldase)을 필요로 한다. 따라서 리파제 유전자만을 대장균(E. coli)에 형질전환시키는 경우, 활성 리파제가 생산되지 않는다.Accordingly, the present inventors have intensively tried to mass produce lipase having excellent properties as described above. In the case of general lipase, another protein (Lif-Lipase foldase) is required to be folded into a tertiary structure, need. Therefore, when only the lipase gene is transformed into E. coli, no active lipase is produced.

따라서, 본 발명자들은 리파제 유전자만을 대장균에 형질전환시켜도 활성 리파제가 생산될 수 있고, 또다른 단백질의 유전자를 대장균에 형질전환시켜야 하는 문제점을 해결하기 위해 연구 노력한 결과 유전자 조작을 통해 리파제 유전자만을 지니는 재조합 벡터를 제조한 후, 이 벡터를 대장균(E. coli)에 형질전환시켜 이로부터 리파제를 대량으로 생산한 후 양이온 교환수지를 이용해서 리파제를 순수 분리정제함으로써 본 발명을 완성하였다.Therefore, the present inventors have made efforts to solve the problem that the active lipase can be produced even when only the lipase gene is transformed into E. coli and another gene of the protein must be transformed into E. coli. As a result, After the vector was prepared, this vector was transformed into E. coli to produce a large amount of lipase, and the lipase was purified and purified by using a cation exchange resin to complete the present invention.

본 발명은 프로테우스 불가리스(Proteus vulgaris) K80(KCTC 8642P)으로부터 유래한 알칼리 내성 및 단백질 분해효소 내성의 리파제를 생산하기 위한 플라스미드를 제공하는 데 그 목적이 있다.It is an object of the present invention to provide a plasmid for producing an alkali-tolerant and protease-resistant lipase derived from Proteus vulgaris K80 (KCTC 8642P).

또한, 본 발명은 상기 플라스미드를 대장균에 형질전환시켜 리파제를 대량생산하고 이를 순수 분리하는 방법을 제공하는 데도 그 목적이 있다.It is another object of the present invention to provide a method for mass-producing a lipase by transforming the plasmid into Escherichia coli and purifying the same.

이하, 본 발명을 상세히 설명하면 다음과 같다.Hereinafter, the present invention will be described in detail.

본 발명은 리파제를 코우드하는 플라스미드 pKLE에 의해 E. coli에 형질전환된 신균주 BL21(DE3)/pKLE(기탁번호:KCTC 8742P)에 관한 것이다.The present invention relates to a new strain BL21 (DE3) / pKLE (accession number: KCTC 8742P) transformed into E. coli by a plasmid pKLE encoding lipase.

또한, 본 발명은 상기 신균주 BL21(DE3)/pKLE를 배양시켜서 생성된 리파제 코우드로 된 재조합 단백질을 세포추출물로부터 분리하여 리파제 활성이 있는 형태로 전환시키고 정제하는 리파제를 제조하는 방법에 관한 것도 포함된다.The present invention also relates to a method for producing a lipase which is obtained by culturing the new strain BL21 (DE3) / pKLE and separating the recombinant protein produced in the lipase gene from the cell extract to convert it into a lipase active form and purifying it do.

그리고, 본 발명은 리파제가 대장균에서 발현되도록 연결된 DNA 서열을 함유하는 플라스미드 pKLE에 관한 것도 포함된다.And, the present invention also includes a plasmid pKLE containing a DNA sequence in which lipase is linked to be expressed in E. coli.

이와같은 본 발명을 더욱 상세하게 설명하면 다음과 같다.Hereinafter, the present invention will be described in detail.

본 발명은 유전자 조작에 의해 프로테우스 불가리스(Proteus vulgaris) K80(KCTC 8642P)의 cDNA로부터 새로운 재조합 DNA 발현벡터를 제조하고, 이로부터 신규한 재조합 플라스미드 pKLE를 제조한 다음, 이를 대장균에 형질전환시키고 배양하여 이로부터 리파제를 생산하도록 함으로써 정제된 리파제를 대량으로 생산하는 방법에 관한 것이다.The present invention relates to a novel recombinant DNA expression vector prepared from the cDNA of Proteus vulgaris K80 (KCTC 8642P) by genetic engineering, from which a novel recombinant plasmid pKLE is prepared and then transformed and cultured in Escherichia coli And a method for mass-producing purified lipase by allowing the lipase to be produced therefrom.

이를 단계별로 설명하면 다음과 같다.The following is a step-by-step explanation.

[신규 플라스미드 pKLE의 제조][Production of novel plasmid pKLE]

신규 플라스미드 pKLE의 제조방법은 첨부도면 제1도에 나타낸 바와 같은 바, 본 출원인에 의해 기 출원된 프로테우스 불가리스(Proteus vulgaris) K80(KCTC 8642P)의 염색체 DNA(cDNA)를 모형(母形, template) DNA로 하고, 합성된 2개의 프라이머(프라이머 1 : 5'GAACATATGTCAACTACATATCCA3', 프라이머 2 : 5'GCAGGATCCTTACAGCTTTTTACTTGCTAA3')와 taq DNA 중합효소 및 dNTP를 사용하여 PCR(Polymerase chain reaction)을 수행하였다. PCR의 조건은 다음과 같다.A method for producing a novel plasmid pKLE is a method for producing a plasmid pKLE using a chromosomal DNA (cDNA) of Proteus vulgaris K80 (KCTC 8642P) filed by the present applicant as shown in FIG. 1, DNA was polymerase chain reaction (PCR) using two synthesized primers (primer 1: 5 'GAACATATGTCAACTACATATCCA3', primer 2: 5 'GCAGGATCCTTACAGCTTTTTACTTGCTAA3') and taq DNA polymerase and dNTP. The PCR conditions are as follows.

디네츄레이션(denaturation); 95℃에서 1분, 어니얼링(annealing); 45℃에서 2분, 폴리머리제이션(polymerization); 72℃에서 3분, 포스트-일롱게이션(post-elongation); 7분Denaturation; Annealing at 95 캜 for 1 minute; Polymerization at 45 캜 for 2 minutes; Post-elongation at 72 占 폚 for 3 minutes; 7 minutes

상기와 같이 PCR 수행 후, 1% 아가로우즈 젤 전기영동을 수행하여 합성된 PCR 산물을 젤로부터 회수하고, 제한효소 NdeI과 BamHI으로 상기에서 합성된 DNA의 양 끝을 자른 후, 동일한 제한효소로 처리된 대량생산용 벡터 pET-3a와 함께 라이게이션(ligation)시켜 본 발명의 재조합 발현벡터를 제조하였다.After the PCR was performed as described above, 1% agarose gel electrophoresis was performed, and the synthesized PCR product was recovered from the gel. Both ends of the DNA synthesized above were digested with restriction enzymes NdeI and BamHI, The recombinant expression vector of the present invention was prepared by ligation with the vector pET-3a for mass production.

상기와 같이 재조합된 DNA 발현벡터를 대장균 균주에 형질전환시키고, 리파제 활성을 나타내는 콜로니로부터 플라스미드 DNA를 분리하고, 그 크기가 5.6kbp인 것을 확인한 후 플라스미드 pKLE이라 명명하였다.The recombinant DNA expression vector was transformed into Escherichia coli strain, and the plasmid DNA was isolated from the colonies showing lipase activity. After confirming that the size was 5.6 kbp, the plasmid was named pKLE.

이와같은 새로운 플라스미드 pKLE의 특징은 강력한 T7 프로모터와 해독(translation) 신호가 리파제 유전자의 앞쪽에 내재되어 있다는 것이다.The new plasmid pKLE is characterized by the presence of a strong T7 promoter and translation signal upstream of the lipase gene.

상기의 플라스미드 pKLE의 유전자 지도는 첨부도면 제2도에 나타낸 바와 같으며, 제조된 플라스미드 pKLE에 대하여 1% 아가로우즈 젤 전기영동을 수행한 결과는 첨부도면 제3도에 나타낸 바와 같다(1 : DNA분자량 표지체, 2 : pET-3a/BamHI, 3 : pKLE/BamHI, 4 : pKLE/NdeI, BamHI).The gene map of the above plasmid pKLE is as shown in FIG. 2, and the result of performing 1% agarose gel electrophoresis on the plasmid pKLE produced is as shown in FIG. 3 (1: DNA molecular weight markers, 2: pET-3a / BamHI, 3: pKLE / BamHI, 4: pKLE / NdeI, BamHI).

[형질전환체 E. coli의 제조방법][Production method of transformant E. coli]

상기에서 제조된 신규한 플라스미드 pKLE에 의해 코드되는 리파제를 발현시키기 위해 플라스미드를 분리하여 숙주 미생물로서, T7 RNA 폴리머라제 유전자를 갖고 있는 E. coli 균주에 도입하여 Hanahan의 방법으로 형질전환시켜 BL21(DE3)/pKLE라 명명하였으며, 이를 대한민국 균주기탁 기관인 한국과학기술연구원 부설 생명공학연구소 내 유전자원센타에 1996년 5월 14일 자로 기탁하고 수탁번호 KCTC 8742P를 부여받았다.In order to express the lipase encoded by the novel plasmid pKLE prepared above, the plasmid was isolated and introduced into an E. coli strain having a T7 RNA polymerase gene as a host microorganism and transformed by the method of Hanahan to obtain BL21 (DE3 ) / pKLE, which was deposited with KCTC 8742P on May 14, 1996 in the Genetic Center of the Institute of Bioscience and Biotechnology, Korea Research Institute of Science and Technology.

상기 균주의 세균학적, 배양학적 및 미생물학적 특성을 검토한 결과 리파제 생산능 외에도 E. coli BL21(DE3)과 동일하였다.The bacteriological, cultural and microbiological characteristics of the strain were examined, and it was the same as E. coli BL21 (DE3) in addition to the ability to produce lipase.

[리파제의 생산][Production of lipase]

상기 형질전환된 E. coli BL21(DE3)/pKLE균을 암피실린(ampicillin) (100㎍/㎎)이 함유된 LB(Luria-Bertani)배지(배지 조성 : 트립톤 1%, 효모 추출물 0.5%, 염화나트륨 0.5%)에서 100nm에서의 흡광도(OD600nm)가 0.6이 될 때까지 배양한 후 IPTG(isopropy1-1-thio-β-D-galactoside)를 처리하여 발현을 유도하여 배양하였다. 이때, 배양온도는 37℃로 하고, 여기에 상기 형질전환된 균을 가한 후 배양하면서 시간별로 생성된 리파제의 활성을 측정하였으며, 그 결과는 첨부도면 제4도에 나타낸 바와 같다. 첨부도면 제4도의 결과로부터 IPTG 처리후 4시간이 경과한 다음 세포내 리파제의 함량이 세포추출액의 ㎖당 360 유닛까지 증가하게 되었으며, 아에 대하여 SDS-PAGE 전기영동을 실시한 결과는 첨부도면 제5도에 나타낸 바와 같다. 여기서, 1은 분자량 97, 66, 45, 31, 21 kDa인 표준단백질, 2는 IPTG 처리시, 3은 IPTG 처리후 1시간 후, 4는 IPTG 처리후 2시간 후, 5는 IPTG 처리후 3시간 후, 6은 IPTG 처리후 4시간 후 및 7은 IPTG 처리후 5시간 후의 세포추출액을 나타낸다. 첨부도면 제5도의 결과로부터 세포내 리파제의 분자량은 31 kDa 위치에서 주 밴드로 나타남을 알 수 있다.The transformed E. coli BL21 (DE3) / pKLE bacteria were cultivated in LB (Luria-Bertani) medium containing ampicillin (100 μg / mg) (medium composition: 1% trytone, 0.5% yeast extract, 0.5%) until the absorbance at 100 nm (OD 600 nm ) became 0.6, and then IPTG (isopropy1-1-thio-β-D-galactoside) was treated to induce the expression. At this time, the incubation temperature was set to 37 캜, and the activity of the lipase produced over time was measured while adding the transformed microorganism thereto, and the result was as shown in FIG. 4 hours after the IPTG treatment, the content of intracellular lipase increased to 360 units per ml of the cell extract. From the result of SDS-PAGE electrophoresis, As shown in FIG. 1 is the standard protein with molecular weights of 97, 66, 45, 31 and 21 kDa, 2 is the IPTG treatment, 3 is the 1 hour after IPTG treatment, 4 is 2 hours after IPTG treatment, 5 is 3 hours after IPTG treatment 6 shows the cell extract after 4 hours after the IPTG treatment and 7 shows the cell extract after 5 hours after the IPTG treatment. From the results of FIG. 5 of the accompanying drawings, it can be seen that the molecular weight of intracellular lipase appears as the main band at the position of 31 kDa.

이때, 리파제의 활성은 파라니트로페닐카프릴레이트(p-nitrophenylcaprylate)를 기질로하여 측정하였으며, 리파제 1 유닛은 분당 1μmol의 파라니트로페놀(p-nitrophenol)을 만들어 내는 효소의 양으로 정의한다.At this time, the activity of the lipase was measured using p-nitrophenylcaprylate as a substrate, and 1 unit of lipase was defined as the amount of enzyme that produced 1 μmol of p-nitrophenol per minute.

이와같은 결과로부터 본 발명의 신규 플라스미드 pKLE로 형질전환된 신규 미생물 E. coli BL21(DE3)/pKLE은 기 출원된 원균주인 프로테우스 불가리스(Proteus vulgaris) K80에 비하여 72배 이상의 양으로 리파제를 생산함을 알 수 있다.As a result, the novel microorganism E. coli BL21 (DE3) / pKLE transformed with the novel plasmid pKLE of the present invention produced lipase in an amount of 72 times or more as compared with Proteus vulgaris K80, Able to know.

[리파제의 분리정제 방법][Separation and purification method of lipase]

상기에서 E. coli BL21(DE3)/pKLE 균이 대량으로 생산하는 리파제를 다음과 같은 방법으로 순수분리하였다.The lipase produced in large quantities by E. coli BL21 (DE3) / pKLE was purified by the following method.

초음파분쇄법으로 상기 균의 균체를 깬 후에 원심분리를 통해 상층액을 얻고, 이를 10mM 인산염 완충액(pH 7.0)으로 투석하여 CM-세파로오즈 컬럼에 가하였다. 염화칼륨염을 전개 용매에 순차적으로 첨가하여 리파제를 용출시킨 후, 다시 완충액을 30mM 트리스,-HCl(pH 7.5)로 바꾸고 양이온 교환수지인 리소스 S HR 5/5 칼럼(파마시아 바이오텍 제품)에 다시 한 번 통과시킴으로써 리파제를 순수 분리하였으며, 이 과정은 첨부도면 제6도에 나타낸 바와 같다. 여기서, 1은 분자량 97, 66, 45, 31, 21 kDa인 표준단백질, 2는 세포추출액, 3은 CM-세파로오즈 컬럼을 통과한 시료 및 4는 리소스 S 컬럼을 통과한 시료를 나타낸 것이다.The microbial cells of the microorganism were broken by ultrasonic pulverization, and the supernatant was obtained by centrifugation. The supernatant was dialyzed with 10 mM phosphate buffer (pH 7.0) and added to the CM-Sepharose column. The potassium chloride salt was added to the developing solvent in order to elute the lipase. The buffer was again replaced with 30 mM Tris , -HCl (pH 7.5), and the cation exchange resin, Resource S HR 5/5 column (Pharmacia Biotech) The lipase was separated pure by passing it, as shown in FIG. 6 of the accompanying drawings. Here, 1 is a standard protein having molecular weights of 97, 66, 45, 31 and 21 kDa, 2 is a cell extract, 3 is a sample passed through a CM-Sepharose column, and 4 is a sample passed through a Resource S column.

[리파제의 세제로서의 활성 측정][Measurement of activity of lipase as detergent]

대장균에서 대량생산된 리파제를 이용하여 그 세제 활성을 측정하기 위하여 트리올레인 분해능 시험을 수행하였으며, 그 결과는 첨부도면 제7도에 나타낸 바와 같다.In order to measure the detergent activity using lipase mass-produced in Escherichia coli, triolein decomposability test was performed, and the results are shown in FIG. 7 of the accompanying drawings.

트리올레인을 4% 함유하는 100mM 트리스,-HCl(pH 9.0) 완충액을 37℃로 조정된 반응기에 넣고 100 유닛의 리파제를 가한 후에 교반하면서 60분간 반응을 수행하였다. 시간별로 시료를 채취해서 박층크로마토그라피(클로로포름 : 아세톤 : 아세트산=96 : 4 : 1)로 분석한 결과, 첨부도면 제7도에 나타낸 바와 같으면 첨부도면 제7도로부터 트리올레인 첨가후 5분 후부터 1,2-디올레인산 또는 2,3-디올레인산, 모노올레인산 및 올레인산이 생성됨을 알 수 있다. 여기서 1~6은 각각 트리올레인 처리시, 처리후 5, 10, 20, 30 및 60분간 반응시킨 후의 시료, 7은 트리올레인, 8은 1,3-디올레인, 9는 1,2-디올레인 또는 2,3-디올레인, 10은 올레인산 및 11은 모노올레인을 나타낸 것이다.A 100 mM Tris , -HCl (pH 9.0) buffer solution containing 4% of triolein was placed in a reactor adjusted to 37 ° C, 100 units of lipase was added, and the reaction was carried out for 60 minutes with stirring. Samples were taken over time and analyzed by thin layer chromatography (chloroform: acetone: acetic acid = acetic acid: acetic acid = 96: 4: 1). As a result, as shown in FIG. 7, 1,2-dioleenoic acid or 2,3-dioleenoic acid, monooleic acid and oleic acid are produced. Herein, 1 to 6 are triolein-treated samples, 5, 10, 20, 30, and 60-minute samples after treatment, 7 is triolein, 8 is 1,3-diolane, Diol lane or 2,3-diol lane, 10 denotes oleic acid and 11 denotes monoolein.

이는 효소가 1,3-위치특이성을 갖고 있음을 의미하며, 이러한 위치특이성을 갖는 효소는 광학활성 특이성도 동시에 갖기 때문에 이 효소를 여러 가지 화학반응의 생효소로 이용할 수 있음을 알 수 있다.This means that the enzyme has 1,3-position specificity, and since the enzyme having the position specificity also has the optical activity specificity, it can be used as a biosynthetic enzyme of various chemical reactions.

Claims (5)

제2도에 도시된 발현벡터 pKLE에 의해 형질전환된 신균주 BL21(DE3)/pKLE(KCTC 8742P).New strain BL21 (DE3) / pKLE (KCTC 8742P) transformed by the expression vector pKLE shown in FIG. 2. 균주를 배양시켜 생성된 리파제 코우드로 된 재조합 단백질을 세포추출물로부터 분리하여 리파제 활성이 있는 형태로 전환시키고 정제하는 과정을 포함하는 리파제의 제조방법에 있어서, 상기 균주는 제1항의 신균주 BL21(DE3)/pKLE인 것임을 특징으로 하는 리파제의 제조방법.A method for producing a lipase comprising the steps of culturing a strain to transform a recombinant protein produced from lipase cowd into a form having lipase activity by separating the recombinant protein from a cell extract, and purifying the lipase, wherein the strain is the new strain BL21 (DE3 ) / pKLE. < / RTI > 제2항에 있어서, 상기 신균주 BL21(DE3)/pKLE의 배양은 암피실린이 포함된 LB 배지에서 IPTG로 단백질 생성을 유도시키는 증식조건에서 배양온도 37℃에서 리파제 재조합 단백질을 생산하는 것을 특징으로 하는 방법.The method according to claim 2, wherein the culture of the new strain BL21 (DE3) / pKLE produces lipase recombinant protein at a culturing temperature of 37 DEG C under a propagation condition in which protein production is induced by IPTG in LB medium containing ampicillin Way. 제2항에 있어서, 상기 리파제 재조합 단백질을 원심분리하고 인산염 완충액으로 투석한 다음 CM-세파로우즈 컬럼 크로마토그래피 및 리소스 SHR 5/5 컬럼 크로마토그래피하여 리파제를 분리하는 것을 특징으로 하는 방법.3. The method of claim 2, wherein the lipase recombinant protein is centrifuged and dialyzed with phosphate buffer, followed by CM-Sepharose column chromatography and Resource SHR 5/5 column chromatography to separate the lipase. 리파제를 활성상태로 과발현하며, 제2도에 도시된 개열지도를 갖는 것을 특징으로 하는 발현벡터 pKLE.2. Expression vector pKLE, which overexpresses lipase in an active state and has a cleavage map as shown in FIG. 2.
KR1019960020320A 1996-06-07 1996-06-07 Novel plasmid pkle and mass production method of lipase by using the same KR0180570B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1019960020320A KR0180570B1 (en) 1996-06-07 1996-06-07 Novel plasmid pkle and mass production method of lipase by using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1019960020320A KR0180570B1 (en) 1996-06-07 1996-06-07 Novel plasmid pkle and mass production method of lipase by using the same

Publications (2)

Publication Number Publication Date
KR980002265A KR980002265A (en) 1998-03-30
KR0180570B1 true KR0180570B1 (en) 1999-04-01

Family

ID=19461073

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1019960020320A KR0180570B1 (en) 1996-06-07 1996-06-07 Novel plasmid pkle and mass production method of lipase by using the same

Country Status (1)

Country Link
KR (1) KR0180570B1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100405475B1 (en) * 2000-12-06 2003-11-15 현대자동차주식회사 Starting system for an automobile

Also Published As

Publication number Publication date
KR980002265A (en) 1998-03-30

Similar Documents

Publication Publication Date Title
US5290694A (en) Recombinant DNA, bacterium of the genus Pseudomonas containing it, and process for preparing lipase by using it
KR960014703B1 (en) Cephalosporin acetylhydrolase gene and protein encoded by the gene
MANCO et al. Overexpression and properties of a new thermophilic and thermostable esterase from Bacillus acidocaldarius with sequence similarity to hormone-sensitive lipase subfamily
JP6048850B2 (en) D-succinylase and method for producing D-amino acid using the same
JPH11155570A (en) Modification of substrate specificity of enzyme
EP2020441A1 (en) Tetrasphaera lipase
JP2657383B2 (en) Novel hydrolase and its production method
KR0180570B1 (en) Novel plasmid pkle and mass production method of lipase by using the same
Ningsih et al. Cloning and expression of gene encoding lipase from local isolate Bacillus cereus isolated from compost Jambangan Indonesia
RU2447151C1 (en) ALKALINE PHOSPHATASE CmAP SYNTHESIS-DETERMINING 40Ph PLASMID, E. coli rosetta(DE3)/40Ph STRAIN - PRODUCER OF CHIMERIC PROTEIN, CONTAINING AMINO ACID SEQUENCE OF RECOMBINANT ALKALINE PHOSPHATASE CmAP, AND PRODUCTION METHOD THEREOF
CN111057691B (en) Novel GDSL family lipid hydrolase EII-3 and encoding gene and application thereof
CN113151377A (en) Enzymatic preparation method for preparing glucosamine from glucose and enzyme application
KR100380804B1 (en) Thermostable Phospholipase A1 Mutants and Process for Preparing the Same
US5217880A (en) L-fucose dehydrogenase gene, microorganism having said gene and production of l-fucose dehydrogenase by the use of said microorganism
KR100330359B1 (en) Novel esterase derived from Pseudomonas aeruginosa, its gene and process for production of optically active carboxylic acids using them
Simatupang et al. Lipolytic activity of Itb1. 1 and Lk3 thermostable lipases expressed in Escherichia coli and Pichia pastoris
CA2242864A1 (en) Stable biocatalysts for ester hydrolysis
KR102187132B1 (en) Lipase from Croceibacter atlanticus
KR102097720B1 (en) Lipase from Marinobacter lipolyticus
CN112760306B (en) Family six ester hydrolase with high salinity, organic solvent and detergent tolerance, and coding gene and application thereof
KR101081012B1 (en) Chlorohydrin and hydroxy carboxylic ester hydrolase gene
JPH09191887A (en) Depolymerase of biodegradable polymer and its production
CN116121215A (en) Mutant of glycerophosphate oxidase and application thereof
KR100449316B1 (en) Novel esterase, and Bacillus niacini EM001 for producing the esterase
KR100463350B1 (en) Novel alkaline lipase, strain of bacillus producing the same, method of producing the lipase

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20031203

Year of fee payment: 6

LAPS Lapse due to unpaid annual fee