KR102184119B1 - Novel strain Saccharomyces cerevisiae EY2-27 having skin whitening and use of the same - Google Patents

Abstract

The present invention relates to a novel strain having skin whitening activity and a use thereof. Particularly, the present invention relates to: a novel Saccharomyces cerevisiae EY2-27 (KCCM12439P) strain having skin whitening activity; a skin whitening food composition and cosmetic composition including the strain; and a method of manufacturing a fermentation product having skin whitening activity by using the strain. The novel Saccharomyces cerevisiae EY2-27 (KCCM12439P) strain according to the present invention and the fermentation product obtained by using the strain are excellent in tyrosinase inhibitory activity and melanin production inhibitory activity, and thus may be favorably used for cosmetic compositions and food compositions having skin whitening activity.

Description

The new strain Saccharomyces cerevisiae EY2-27 having skin whitening and use of the same}

The present invention relates to a new strain of Saccharomyces cerevisiae EY2-27 having skin whitening activity and use thereof.

The general public's interest in plastic surgery, beauty and makeup is rapidly increasing. In particular, the interest in whitening cosmetics and wrinkle-improving cosmetics is constantly and explosively increasing due to the hot air and the preference for white faces.

In particular, interest in whitening cosmetics is leading to an increase in demand for whitening enhancing materials and the development of cosmetics using microorganisms such as enzymes and lactic acid bacteria, and recently, a desire to find materials with high skin stability and excellent skin whitening activity from natural materials. Research is actively underway.

On the other hand, skin color is mainly determined by the content of a pigment called melanin in the skin, which is biosynthesized by melanocytes (melanocytes) in the base layer of the skin, and keratinocytes through cytoplasmic processes (keratinocyte) is transferred from the basal layer of the epidermis to the stratum corneum by the keratinization process. This melanin-forming main enzyme, tyrosinase, is a conversion step from tyrosine, a rate-limiting step, to dihydroxyphenylalanine (3,4-dihydroxyphenylalanine, DOPA, dopa), and A subsequent step, a step of conversion from DOPA to DOPA quinone, is mediated. Therefore, it is possible to obtain a skin whitening effect by inhibiting the activity of the tyrosinase enzyme and suppressing the production of melanin.

Arbutin, which is currently most commonly used as a whitening agent, is an inhibitor that acts competitively with L-tyrosine. Also, Kojic acid, which is often used as a whitening agent, inhibits the process of tyrosine to waveguide and waveguide to dopaquinone by chelating copper at the tyrosinase active site. However, since these whitening agents have a problem that can cause skin side effects, it is time to develop a new material capable of enhancing skin whitening activity without side effects.

Accordingly, the inventors of the present invention were researching from microorganisms to find a material that can be used as a raw material for functional foods that can enhance whitening activity as well as cosmetics applied to the skin as a way to increase the whitening activity of the skin. The present invention was completed by identifying a new strain capable of enhancing and confirming its excellent whitening activity.

Korean Patent Registration No. 10-1503979

Accordingly, an object of the present invention is to provide a strain of Saccharomyces cerevisiae EY2-27 (Accession No.: KCCM 12439P).

Another object of the present invention is a food composition or cosmetic composition having a whitening activity comprising Saccharomyces cerevisiae EY2-27 (accession number: KCCM 12439P) strain, its lysate, its culture or its fermentation as an active ingredient Is to provide.

Another object of the present invention is to provide a method for producing a fermented product having whitening activity, comprising fermenting a starchy raw material using Saccharomyces cerevisiae EY2-27 (Accession No.: KCCM 12439P) strain.

In order to achieve the object of the present invention as described above, the present invention provides a Saccharomyces cerevisiae EY2-27 (accession number: KCCM 12439P) strain.

In one embodiment of the present invention, the strain may have a whitening activity through inhibition of tyrosinase inhibition and melanin production.

In addition, the present invention provides a food composition having a whitening activity comprising the Saccharomyces cerevisiae EY2-27 (Accession No.: KCCM 12439P) strain, its lysate, its culture, or its fermentation as an active ingredient.

In addition, the present invention provides a cosmetic composition having a whitening activity comprising Saccharomyces cerevisiae EY2-27 (Accession No.: KCCM 12439P) strain, its lysate, its culture, or its fermentation as an active ingredient.

In addition, the present invention provides a method for producing a fermented product having whitening activity, comprising fermenting a starchy raw material using Saccharomyces cerevisiae EY2-27 (Accession No.: KCCM 12439P) strain.

In one embodiment of the present invention, the fermented product is (1) mixed with water and Saccharomyces cerevisiae EY2-27 (Accession No.: KCCM 12439P) strain, its lysate or its culture, and fermented To prepare a first fermented product; (2) preparing a second fermented product by fermenting after mixing the starchy raw material and water steamed in the first fermented product; And (3) distilling the secondary fermented product and obtaining the remaining residue.

In one embodiment of the present invention, the starchy raw material may be documents or grains.

In one embodiment of the present invention, the document may be sweet potato or potato, and the grain may be rice, glutinous rice, barley, apparent, corn, buckwheat, oats, or crushed rice.

In one embodiment of the present invention, the fermentation in step (1) may be fermentation for 4 to 6 days at a temperature of 20 to 25°C.

In an embodiment of the present invention, in the step (2), the starchy raw material is washed with water, immersed in water at room temperature for 2 to 4 hours, then increased with steam for 40 to 60 minutes, and then for 20 to 30 minutes. It may be cooled at room temperature.

In one embodiment of the present invention, the second fermentation in step (2) may be fermentation for 8 to 12 days at a temperature of 20 to 25°C.

In one embodiment of the present invention, in the distillation in step (3), the alcohol contained in the secondary fermentation is removed using a still, but the alcohol component contained in the residue remaining after distillation is 1% (v/ v) It may be performed to be less than.

The present invention relates to a novel Saccharomyces cerevisiae EY2-27 (KCCM12439P) strain having whitening activity. The strain, its lysate, its culture, or its fermented product according to the present invention has excellent tyrosinase inhibitory activity and excellent melanin production inhibitory activity, so it can be usefully used for cosmetic compositions and food compositions having skin whitening activity.

1 is a result of analyzing tyrosinase inhibitory activity against distillation residues of fermented sweet potato obtained using Saccharomyces cerevisiae EY2-27 (KCCM12439P) strain, a new strain of the present invention in an embodiment of the present invention Is shown.
Figure 2 is an analysis of the melanin production inhibitory activity on the distillation residue of the fermented sweet potato obtained using the Saccharomyces cerevisiae EY2-27 (KCCM12439P) strain, a new strain of the present invention in an embodiment of the present invention It shows the results.

The present invention is characterized by providing a novel strain having whitening activity, and in particular, the present invention is characterized by providing a new strain of Saccharomyces cerevisiae EY2-27 (KCCM12439P) having skin whitening activity. .

The inventors of the present invention isolated and identified a new strain having whitening activity while studying to find a new material in nature that can effectively enhance skin whitening activity without causing side effects in the body, and the novel microorganisms isolated in the present invention Through molecular phylogenetic analysis based on 16s rDNA sequence, it was confirmed that the isolated strain was a novel strain that did not exist before, and the Saccharomyces cerevisiae EY2-27 strain was transferred to the Korea Microbiological Conservation Center on February 19, 2019. It was deposited with and was assigned the deposit number KCCM 12439P.

Accordingly, in order to confirm whether the present inventors have skin whitening activity against the Saccharomyces cerevisiae EY2-27 strain isolated and identified in the present invention, fermentation prepared using the EY2-27 strain and the EY2-27 strain The melanin production inhibitory activity and tyrosinase inhibitory activity in water were analyzed.

As a result, it was found that the culture of the Saccharomyces cerevisiae EY2-27 strain of the present invention has excellent whitening activity, and the fermentation product obtained using the strain has melanin production inhibitory activity and tyrosinase inhibitory activity. This whitening activity was found to be superior to other types of Saccharomyces cerevisiae strains.

Therefore, it was found that the Saccharomyces cerevisiae EY2-27 strain of the present invention can be used as a material for cosmetics and functional foods for enhancing skin whitening.

Therefore, the present invention can provide a cosmetic composition having skin whitening activity comprising the Saccharomyces cerevisiae EY2-27 (KCCM12439P) strain, its lysate, its culture, or its fermentation as an active ingredient.

The cosmetic composition having skin whitening activity of the present invention may contain a strain according to the present invention, a lysate thereof, a culture product thereof, or a fermented product thereof as an active ingredient, and may further include a suitable excipient or carrier.

In the present invention, the culture is a culture solution obtained by culturing a new strain according to the present invention in a suitable liquid medium, a filtrate from which the strain is removed by filtration or centrifugation (filtrate or centrifugal supernatant), and ultrasonic treatment of the culture solution Or a cell lysate (lysate) obtained by treating the culture medium with a lysozyme, but is not limited thereto.

In addition, in the present invention, the fermented product may include any fermented product fermented using the new strain according to the present invention, and preferably, the fermented product is treated with the new strain of the present invention in the increased starchy raw material, The fermented product obtained by fermentation may be distilled, and then the alcohol may be removed and a remaining residue.

The cosmetic composition having the skin whitening activity of the present invention can be prepared in various formulations such as lotions, creams, lotions, packs, foundations, makeup bases, etc., specifically liquid, cream, paste, solid, etc. It can be applied in a variety of properties. In addition, a cosmetic composition having skin whitening activity of the present invention can be prepared using a conventional cosmetic or skin ointment preparation method.

On the other hand, in the cosmetic composition having skin whitening activity of the present invention, the content of the active ingredient of the present invention is preferably 0.0001 to 20% by weight based on the total weight of the composition. If the content of the active ingredient is less than 0.0001% by weight, it is not desirable because the intended skin whitening effect cannot be sufficiently achieved.If the content of the active ingredient exceeds 20% by weight, it may cause problems in the stability of the composition. There is a risk of causing a problem in the appearance of the composition due to this.

In addition, the present invention can provide a food composition having a whitening activity comprising a new strain according to the present invention, a lysate thereof, a culture product thereof, or a fermented product thereof as an active ingredient.

The food composition of the present invention includes all forms such as functional food, nutritional supplement, health food and food additives. Food compositions of this type can be prepared in various forms according to conventional methods known in the art.

For example, as a health food, the new strains of the present invention may be prepared in the form of tea, juice, and drinks to be consumed, or granulated, encapsulated, and powdered to be consumed. In addition, it may be prepared in the form of a composition by mixing with a known substance or active ingredient known to have a whitening activity or a whitening activity enhancing effect.

In addition, functional foods include beverages (including alcoholic beverages), fruits and processed foods thereof (eg, canned fruit, canned food, jam, marmalade, etc.), fish, meat and processed foods thereof (eg, ham, sausage corn beef, etc.) ), breads and noodles (e.g. udon, soba, ramen, spaghetti, macaroni, etc.), fruit juice, various drinks, cookies, syrup, dairy products (e.g. butter, cheese, etc.), edible vegetable oil, margarine, vegetable protein, Retort foods, frozen foods, various seasonings (eg, miso, soy sauce, sauce, etc.) can be prepared by adding a new strain of the present invention, a culture product thereof, a crushed product thereof, or a fermented product thereof.

The preferred content of the active ingredient of the present invention in the food composition of the present invention is not limited thereto, but is preferably 0.01 to 50% by weight of the solid content in the finally prepared food. In addition, for use in the form of a food additive, the composition of the present invention may be prepared and used in the form of a powder or concentrate.

Further, the present inventors conducted a study to prepare a fermented product having excellent whitening activity using the new strain of the present invention. As a result, the fermented product fermented using the new strain of the present invention using a starchy raw material as a substrate is different. It was confirmed that it has better whitening activity than the fermented product fermented using the strain of.

Accordingly, the present invention provides a method for producing a fermented product having whitening activity, comprising fermenting a starchy raw material using Saccharomyces cerevisiae EY2-27 (KCCM12439P), the new strain isolated and identified in the present invention. Can provide.

Specifically, the method comprises the steps of: (1) mixing and fermenting water and Saccharomyces cerevisiae EY2-27 (KCCM12439P) strain of the present invention, a lysate or a culture thereof, to prepare a primary fermentation product ; (2) preparing a second fermented product by fermenting after mixing the starchy raw material and water steamed in the first fermented product; And (3) distilling the secondary fermented product and obtaining the remaining residue.

The method of the present invention will be described in more detail as follows.

First, (1) water and Saccharomyces cerevisiae EY2-27 (KCCM12439P) strain of the present invention, a lysate or a culture thereof are mixed and fermented to prepare a primary fermented product.

Here, the entry may use an entry manufactured by a conventional method using increased rice, and in one embodiment of the present invention, inoculation of the bacteria in the increased rice and at a temperature of 33°C and a humidity of 95% in a thermo-hygrostat. While maintaining, the bacteria were propagated for 48 hours to prepare and use the immigration.

The primary fermentation product can be obtained by fermentation by adding water and a new strain of the present invention, a lysate thereof, or a culture thereof to entry into the country, preferably, adding water and a culture of the new strain of the present invention to the entry And can be obtained by fermentation for 4-6 days at a temperature of 20-25°C.

When the production of the first fermented product is completed, the starchy raw material and water are then added to the first fermented product, mixed, and fermented to prepare a second fermented product.

In this case, documents or grains may be used as the starchy raw material, and the documents are not limited thereto, but sweet potatoes or potatoes may be used, and sweet potatoes may be preferably used.

The grains are not limited thereto, but rice, glutinous rice, barley, apparent, corn, buckwheat, oats, or millet may be used.

The starchy raw material is washed with water, immersed in water at room temperature for 2 to 4 hours, steamed for 40 to 60 minutes, and cooled at room temperature for 20 to 30 minutes.

Fermentation for the production of the secondary fermented product is fermented for 8 to 12 days at a temperature of 20 to 25°C.

When the production of the secondary fermentation product is completed in this way, the secondary fermentation product is then distilled and the remaining residue is obtained. In this case, the distillation is performed by removing alcohol contained in the secondary fermentation product using a distiller. Make sure the component is less than 1% (v/v).

The fermented product obtained using the new strain of the present invention prepared through the above process, preferably the distilled residue of the fermented product, has excellent melanin production inhibitory activity and tyrosinase inhibitory activity, so that skin whitening can be effectively promoted.

In addition, the distilled residue of the fermentation having the whitening activity of the present invention is better than the residue prepared using other types of microorganisms (Saccharomyces strain, Lactobacillus strain) instead of the new strain of the present invention. It was confirmed that there is activity. Furthermore, the Saccharomyces cerevisiae EY2-27 strain of the present invention, the fermented product obtained by using the strain, or the distilled residue of the fermentation product may be used in the manufacture of alcoholic beverages having whitening activity, and the alcoholic beverage is limited thereto. Although it is not, it may be diluted soju, distilled soju, general spirits, yakju, takju, beer, ginseng wine, plum wine, or fruit wine.

Hereinafter, the present invention will be described in more detail through examples. These examples are for explaining the present invention more specifically, and the scope of the present invention is not limited to these examples.

< Example 1>

Neophyte Separation and sympathy

The present inventors performed the following experiments to isolate and identify a novel strain having excellent whitening activity. First, as a process for the isolation and identification of new strains, 0.1 ml of sweet potato soju diluted in PDA (Potato dextrose agar) medium made by adding 0.01% chloramphenicol and 0.3% sodium propionate to inhibit the growth of fungal mycelium and inhibit the growth of bacteria. After smearing, it was incubated at 30° C. for 24 hours. After cultivation, the formed colonies were taken and cultivated again to obtain a pure single colony without contamination, and a new strain that did not exist before was isolated from the obtained strain through 18s rDNA analysis.

At this time, 18s rRNA sequencing for strain identification was conducted by requesting a specialized agency, “Macrogen,” and the method was amplified using PCR after separating the whole genomic DNA of the strain confirmed to be pure. The primers used for PCR amplification were ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC). PCR conditions were 95°C for 5 minutes, 94°C for 45 seconds, 55°C for 1 minute, 72°C for 1 minute, 72°C for 10 seconds, a total of 35 cycles were repeated. PCR prodect analysis was performed using an ABI 3730XL sequencing machine. After the analyzed nucleotide sequence was aligned using the BioEdit seqencing program, the result was identified by comparing it with the NCBI data base.

As a result of the analysis, a new strain, which was not previously identified, was identified, which the present inventors named Saccharomyces cerevisiae EY2-27, and analyzed the nucleotide sequences of the ITS1 region and the ITS4 region for the 18s rRNA of the strain, and this was obtained as SEQ ID NO: 1 ( It was described in ITS1) and 2 (ITS4), and was deposited with the Korea Microbial Conservation Center (KCCM), an international microbial deposit organization, on February 19, 2019, and was given the deposit number KCCM12439P.

Here, the ITS (Internal Transcribed Spacer) refers to a DNA region located between the small-subunit ribosomal RNA (SSU rRNA) and large-subunit rRNA (LSU rRNA) genes of the chromosome, and in eukaryotes, a specific ITS1 for 18S rRNA, The result of nucleotide sequence analysis for the ITS4 region can be obtained, and whether a new strain can be identified through nucleotide sequence similarity analysis with a conventionally known strain.

< Example 2>

Of the present invention New strain Having excellent whitening activity Fermented Produce

The present inventors prepared a fermented product having excellent whitening activity by using Saccharomyces cerevisiae EY2-27, a new strain isolated and identified in Example 1, as follows.

First, the rice was mixed and cultured to prepare an immigration. At this time, the entry was made according to the usual method by inoculating the increased rice (10 kg) with a fungus (2g of Bacillus bacteria), and inoculating the increased rice with the fungus and maintaining the temperature and humidity of 95% at 33℃ in a thermo-hygrostat. While carrying out the breeding for 48 hours, the immigration was prepared. Thereafter, each culture solution of the new strain identified in the present invention was mixed with water and fermented to prepare a first fermentation broth at the entry of the prepared country. For the primary fermentation, 718 g of water was added to 513 g of the above-prepared country for fermentation and mixed, and then 10 ml of the culture solution of the new strain of the present invention was inoculated, which was confirmed to be a strain of 10 ⁸ /ml or more by culturing in the saccharification solution of the country . The immigration saccharification solution, which is the yeast culture solution of the present invention, was saccharified by mixing 200 g of immigration prepared by the above method and 600 g of water and stirring at 65° C. for 3 hours and 30 minutes. After saccharification, the mixture was centrifuged at 4,700 rpm for 30 minutes, filtered through a filter cloth, and diluted with water to 10˚ brix. The mixed solution was fermented at 25° C. for 5 days to prepare a first fermented solution.

The prepared primary fermentation broth was subjected to secondary fermentation, that is, steamed sweet potatoes and water were added to the primary fermentation broth, mixed, and fermented to prepare a secondary fermentation broth.

Specifically, sweet potatoes are first prepared for the secondary fermentation. To remove foreign substances or contaminants, wash them clean with water, immerse them in water at room temperature for 3 hours for sufficient absorption of moisture, and increase the sweet potatoes with steam for 60 minutes at normal pressure. I did. After steaming, it was cooled at room temperature for 20 minutes, and then 1,743 g of water and 1,026 g of steamed sweet potatoes were added to the first fermentation broth prepared above, mixed, and fermented at 25° C. for 10 days to use the new strain (Sweet potato mash) 4,000 g was prepared.

Thereafter, the secondary fermentation broth was distilled to obtain the remaining residue. Specifically, alcohol was removed from the secondary fermentation broth obtained in the above step using a single-type still, and the internal temperature was distilled under reduced pressure to 110 mmHg at 40°C. The pressure reducing pump used a water ring pump. The distiller for removing alcohol was a distillation machine equipped with a 5 L glass round flask, an anti-foam distillation column, a horizontal cooling tube, a graduated sight glass with a pressure reducing valve, and a receiver for collecting the effluent. The initial fermentation broth amount for alcohol removal was 2 L, the initial fermentation broth temperature was 25°C, and the set temperature of the cooler for cooling the effluent steam was 5°C, and circulated at a rate of 15 L/min. The alcohol removal rate was controlled by heat input to the alcohol remover. The alcohol was removed and the alcohol component in the obtained residue was made to be less than 1% v/v. In this way, as a fermented sweet potato having whitening activity using the new strain of the present invention, a distilled residue of the fermented sweet potato was obtained.

< Example 3>

Whitening activity assay

A whitening activity analysis was performed on the distilled residue of the fermented sweet potato product using the new strain of the present invention prepared in Example 2. The whitening activity analysis was performed by the tyrosinase activity inhibition efficacy analysis and the melanin production inhibition efficacy analysis. At this time, a group to which the new strain of the present invention was not added was used as a control group, and a group of distilled residues of sweet potato fermentation prepared using a Saccharomyces cerevisiae strain other than the new strain of the present invention was used as a control group. Was used. Each experimental group used in the experiment is shown in the table below.

Fermentation substrate Experimental group no Microorganism no Microorganism name sweet potato One control No microorganism added 2 EY2-27 Saccharomyces cerevisiae EY2-27(KCCM12439P) 3 EY2-2 Saccharomyces cerevisiae EY2-2 4 EY2-12 Saccharomyces cerevisiae EY2-12

<3-1> Tyrosinase Activity inhibitory effect analysis

The analysis of the tyrosinase activity inhibition efficacy was performed in the following manner. First, 20 ml of 0.1 M potassium phosphate buffer was added to the tube, and 20 ml of 0.02 mg/ml mushroom tyrosinase was added thereto, and then the distillation residue of the present invention was added by concentration (250ug/ml, 500ug/ml, 1000ug/ ml) was added and reacted at 25° C. for 10 minutes, and 40 ml of 1 mM L-3,4-dihydroxyphenylalanine (L-DOPA) was added as a substrate and reacted at 25° C. for 30 minutes. Thereafter, absorbance was measured in a wavelength region of 475 nm. At this time, the above process was repeated three times, and the average value was measured to analyze the degree of inhibition of tyrosinase activity.

<3-2> Analysis of melanin production inhibitory effect

The melanin-producing cell line B16F10 cells were cultured in a 6-well plate at a concentration of 2 x 10 ⁵ cells/well, and after 12 hours of culture, the distillation residue of the present invention was treated at different concentrations (250 ug/ml, 500 ug/ml, 1000 ug/ml). I did. After 1 hour of treatment with the distillation residue, a-melanocyte-stimulating hormone (a-MSH), which induces melanogenesis, was treated at a concentration of 100 nM, and after 72 hours, the cell culture solution was transferred to a tube and reacted at room temperature for 48 hours. After completion of the reaction, the absorbance was measured in a wavelength region of 400 nm. At this time, the above process was repeated three times, and the average value was measured to analyze the degree of inhibition of melanin production.

As a result of the analysis, as shown in Fig. 1, the distillation residue obtained using the new strain of the present invention was found to be superior to the control residue obtained without adding the strain of the present invention. The strain-treated group of the present invention was found to have more excellent tyrosinase inhibitory activity compared to the Saccharomyces cerevisiae-treated group, which is another strain used as a comparative group.

In addition, in FIG. 2, it was possible to confirm the results of the analysis of inhibition of melanin production, whereas the amount of melanin production was increased in the control residue to which the strain of the present invention was not added, whereas the amount of melanin production was significantly reduced in the strain-treated group of the present invention. It was found that the degree of melanin reduction was better than that of the Saccharomyces cerevisiae treatment group, which is another strain used as a control group.

Through the above results, the new strains identified in the present invention and the distilled residues of the fermented product obtained by fermenting starchy raw materials with the new strains have excellent skin whitening activity, and are useful in the manufacture of cosmetics and functional foods for skin whitening. I could see that it could be used.

So far, the present invention has been looked at around its preferred embodiments. Those of ordinary skill in the art to which the present invention pertains will be able to understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative point of view rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the above description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

Korea Microorganism Conservation Center (overseas) KCCM12439P 20190219

<110> Korea Food Research Institute <120> Novel strain Saccharomyces cerevisiae EY2-27 having skin whitening and use of the same <130> NPDC78399 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 828 <212> DNA <213> Artificial Sequence <220> <223> Saccharomyces cerevisiae (EY2-27) ITS1 sequence <400> 1 tggacaacta gcggaggact agcaatcgga cgtatggttt ggtttgggaa gagcatgaga 60 gcttttactg ggcaaaaaga caaaagaggg aaagtccagc cgggcctgcg cttaagtgcg 120 cggtcttgct aggcttgtaa gtttctttct tgctattcca aacggtgaaa gatttctgtg 180 cttttgttat aggacaatta aaaccgtttc aatacaacac actgtggagt tttcatatct 240 ttgcaacttt ttctttgggc attcaagcaa tcggggccca aaggtaacaa acacaaacaa 300 ttttatttat tcattaaatt tttgtcaaaa acaaaaattt tcgtaactgg aaattttaaa 360 atattaaaaa ctttcaacaa cggatctctt ggttctcgca tcgatgaaaa acgcagcgaa 420 atgcgatacg taatgtgaat tgcaaaattc cgtgaatcat caaatctttg aacgcacatt 480 gcgccccttg gtattccagg gggcatgcct gtttgagcgt catttccttc tcaaacattc 540 tgtttggtag tgagtgatac tctttgaagt taacttgaaa ttgctggcct tttcattgga 600 tgtttttttt tcaaagagag gtttctctgc gtgcttgagg taaatgcaat acggccgttt 660 taggtttaca actgcggcta tcttttttta ctgagcgtat tggaacgtat cgataaaaaa 720 gagcgctagg caacatgttc taaagttgac tcaatcagga ggataccgtg actattatta 780 atggggggga gaaaaaggcg cccccctttt ttcttattaa aaaagttt 828 <210> 2 <211> 862 <212> DNA <213> Artificial Sequence <220> <223> Saccharomyces cerevisiae (EY2-27) ITS4 sequence <400> 2 atgatggtac atacggcgtg gtttgaggcc tccttttata gcattgttcg cctagacgct 60 ctcttcttat cgataacgtt ccaatacgct cagtataaaa aagattagcc gcagttggta 120 aaacctaaaa cgaccgtact tgcattatac ctcaagcacg cagagaaacc tctctttgga 180 aaaaaaaaca tccaatgaaa aggccagcaa tttcaagtta actccaaaga gtatcactca 240 ctaccaaaca gaatgtttga gaaggaaatg acgctcaaac aggcatgccc cctggaatac 300 caaggggcgc aatgtgcgtt caaagattca atgattcacg gaattctgca attcacatta 360 cgtatcgcat ttcgctgcgt tcttcatcga tgcgagaacc aaaagatccg ttgttgaaag 420 tttttaatat tttaaaattt ccagttacga aaattcttgt ttttgacaaa aatttaatga 480 ataaataaaa ttgtttgtgt ttgttacctc tgggccccga ttgctcgaat gcccaaagaa 540 aaagttgcaa agatatgaaa actccacagt gtgttgtatt gaaacggttt taattgtcct 600 ataacaaaag cacagaaatc tctcaccgtt tggaatagca agaaagaaac ttacaagcct 660 agcaagaccg cgcacttaag cgcaggcccg gctggactct ccatctcttg tcttcttgcc 720 cagtaaaagc tctcatgctc ttgccaaaca aaaaaatcca ttttcaaaat ataaatttct 780 taatgacctc aggccccccc cccccaaaaa aggtgggggg gggggttaaa aaattttaaa 840 aagtttaaaa tgggattgga tt 862

Claims (12)

delete delete delete delete delete (1) mixing and fermenting water and Saccharomyces cerevisiae EY2-27 (Accession No.: KCCM 12439P) strain, its lysate or its culture at entry to prepare a primary fermented product;
(2) mixing the steamed sweet potato raw material and water in the first fermented product and then fermenting it to prepare a second fermented product; And
(3) comprising the step of distilling the secondary fermented product and obtaining the remaining residue,
Method for producing fermented sweet potato products having whitening activity. delete delete The method of claim 6,
In the step (1), the fermentation is characterized in that the fermentation is carried out for 4 to 6 days at a temperature of 20 to 25°C. The method of claim 6,
In the step (2), the sweet potato is washed with water, immersed in water at room temperature for 2 to 4 hours, then steamed for 40 to 60 minutes, and cooled at room temperature for 20 to 30 minutes, whitening A method for producing fermented sweet potato products having activity. The method of claim 6,
The second fermentation in the step (2) is characterized in that the fermentation is performed for 8 to 12 days at a temperature of 20 to 25°C. A method of producing a fermented sweet potato having whitening activity. The method of claim 6,
In the step (3), the distillation is performed so that the alcohol contained in the secondary fermentation product is removed using a still, but the alcohol component contained in the residue remaining after distillation is less than 1% (v/v). To, a method for producing a fermented sweet potato having a whitening activity.

Images