KR102183273B1 - Peptide Oligonucleotide conjugates - Google Patents

Abstract

Oligonucleotide analogues conjugated to a carrier peptide are provided. The described compounds are useful in the treatment of a variety of diseases, such as those that produce beneficial therapeutic effects through inhibition of protein expression or modification of abnormal mRNAs.

Description

Peptide Oligonucleotide Conjugates

Cross-reference to related applications

This application claims priority under 35 USC §120 of U.S. Patent Application 13/101,942 filed May 5, 2011 and U.S. Patent Application 13/107,528 filed May 13, 2011, all of these applications It is incorporated by reference in the specification.

Technical field

The present invention relates generally to oligonucleotide compounds (oligomers) useful as antisense compounds, and more particularly to oligomeric compounds conjugated to cell penetrating peptides, and the use of such oligomeric compounds in antisense applications.

The practical utility of many drugs with potentially useful biological activity is often hampered by the difficulty in delivering these drugs to their targets. Compounds intended to be delivered intracellularly must generally be delivered primarily from the aqueous extracellular environment and then penetrate the lipophilic cell membrane to gain entry into the cell. Unless the substance is actively transported to a specific transport mechanism, many molecules, especially large molecules, are either too lipophilic or too hydrophilic for actual solubilization to penetrate the membrane.

The HIV Tat protein (segment of (Tat 49 57) with the sequence RKKRRQRRR) consisting of amino acid residues 49-57 has been used to deliver biologically active peptides and proteins to cells (e.g., Barsoum et al. , 1994, PCT Publication No. WO 94/04686) Tat (49 60) has been used to increase the delivery of phosphorothioate oligonucleotides (Astriab-Fisher, Sergueev et al. 2000; Astriab-Fisher, Sergueev). et al. 2002).Reverse Tat, or rTat(57-49) (RRRQRRKKR) has been reported to deliver fluorescent substances into cells with enhanced efficacy compared to Tat (49 57) (Wender, Mitchell et al. 2000; Rothbard, Kreider et al. 2002). Rothbard and Wender have also described other arginine-rich transport polymers (PCT Publication WO 01/62297; U.S. Patent No. 6,306,993; U.S. Patent Publication 2003/0032593).

Oligonucleotides are a class of potentially useful drug compounds, and their delivery has often been a barrier to therapeutic use. Phosphorodiamidate-linked morpholino oligomers (PMOs; see for example Summerton and Weller, 1997) have been found to be more promising in this respect than charged oligonucleotide analogs such as phosphorothioates. PMO is a water-soluble, uncharged or substantially uncharged antisense molecule that inhibits gene expression by preventing splicing or binding or progression of translational machinery components. PMO has also been shown to inhibit or block viral replication (Stein, Skilling et al. 2001; McCaffrey, Meuse et al. 2003). They are very resistant to enzymatic digestion (Hudziak, Barofsky et al. 1996). PMO is in vitro in cell-free and cell culture models (Stein, Foster et al. 1997; Summerton and Weller 1997), and in vivo in zebrafish, frogs and sea urchins (Heasman, Kofron et al. 2000; Nasevicius and Ekker 2000), as well as in adult animal models such as rats, mice, rabbits, dogs and pigs (e.g. Arora and Iversen 2000; Qin, Taylor et al. 2000; Iversen 2001; Kipshidze, Keane et al. 2001; Devi 2002; Devi, Oldenkamp et al. 2002; Kipshidze, Kim et al. 2002; Ricker, Mata et al. 2002) demonstrated high antisense specificity and efficacy.

Antisense PMO oligomers are absorbed into cells and have been shown to be more consistently effective in vivo with less non-specific effects than other widely used antisense oligonucleotides (eg P. Iversen, "Phosphoramidite Morpholino Oligomers", in Antisense Drug Technology, ST Crooke, ed., Marcel Dekker, Inc., New York, 2001). Conjugation of PMOs to arginine-rich peptides has been shown to increase their cell uptake (see, for example, US Patent No. 7,468,418). However, the toxicity of the conjugates has slowed their development as available drug candidates.

Although significant progress has been made, a need remains in the art for oligonucleotide conjugates with improved antisense or antigenic performance. These improved antisense or antigenic performances include low toxicity, stronger affinity for DNA and RNA that do not match sequence selectivity; Improved pharmacokinetics and tissue distribution; Includes improved cell delivery and reliable and controllable ex vivo distribution.

The compounds of the present invention address this problem and provide improvements over existing antisense molecules in the art. By linking cell-penetrating peptides to nucleic acid analogs that are substantially uncharged via glycine or proline amino acids, the inventors have addressed the toxicity issues associated with other peptide oligomer conjugates. Moreover, modification of the subunit linkage and/or conjugation of the terminal site at the 5′ and/or 3′ end of an oligonucleotide analog, for example a morpholino oligonucleotide, can also improve the properties of the conjugate. For example, the conjugates described in certain embodiments have reduced toxicity and/or increased cellular delivery, potential, and/or tissue distribution compared to other oligonucleotide analogs and/or are capable of delivering more effectively to target organs. have. These superior properties result in a favorable therapeutic index, reduced clinical administration and low cost of the product.

Thus, in one embodiment, the present invention

(a) a carrier peptide containing an amino acid subunit; And

(b) a nucleic acid analog comprising a substantially uncharged backbone and a target nucleotide sequence for sequence-specific binding to a target nucleic acid

It is a conjugate containing,

Here, two or more of the amino acid subunits are positively charged amino acids, and the carrier peptide includes a glycine (G) or proline (P) amino acid at the carboxy terminal of the carrier peptide; It also provides a conjugate wherein the carrier peptide is covalently attached to a nucleic acid analog. Compositions comprising the conjugate and a pharmaceutically acceptable excipient are also provided.

In another embodiment, the invention provides a method of inhibiting production of a protein comprising exposing a nucleic acid encoding the protein to a conjugate of the invention.

Another aspect of the present invention is a method of enhancing transport of a nucleic acid analog into a cell, comprising the step of conjugating the carrier peptide of claim 1 to a nucleic acid analog, wherein the transport of the nucleic acid analog into the cell is not conjugated. It includes a method that is augmented compared to.

In yet another embodiment, the invention relates to a method of treating a disease in a subject comprising administering to the subject a therapeutically effective amount of the described conjugate. Also provided are methods of making such conjugates, methods of use thereof, and carrier peptides useful for conjugation to nucleic acid analogs.

These and other objects of the present invention will become apparent with reference to the following detailed description. For this purpose, a variety of documents are described herein that describe in more detail specific background information, procedures, compounds and/or compositions, each of which is incorporated herein by reference in its entirety.

1A shows an exemplary morpholino oligomer structure comprising phosphorodiamidate bonds.
1B shows a morpholino oligomer conjugated to a carrier peptide at the 5'end.
Figure 1C shows a morpholino oligomer conjugated to a carrier peptide at the 3'end.
1D-G depict repeating subunit segments of exemplary morpholino oligonucleotides represented by 1D-1G.
Figure 2 shows an exemplary subunit bond bonded to the morpholino-T moiety.
3 is a schematic diagram showing the preparation of a linker for solid phase synthesis.
4 demonstrates the preparation of a solid support for oligomer synthesis.
5A, 5B and 5C show exon skipping data for an exemplary conjugate compared to known conjugates in the mouse quadriceps, diaphragm and heart, respectively.
6A, 6B and 6C are alternative illustrations of exon skipping data for exemplary conjugates compared to known conjugates in mouse quadriceps, diaphragm and heart, respectively.
7A and 7B are graphs showing blood urea nitrogen (BUN) levels and survival rates of mice treated with various peptide-oligomer conjugates, respectively.
8A and 8B show kidney damage marker (KIM) data and clusterin (Clu) of mice treated with various peptide-oligomer conjugates, respectively.
9A, 9B, 9C and 9D are graphs comparing exon skipping, BUN levels, survival and KIM levels, respectively, in mice treated with exemplary conjugates compared to known conjugates.
10 shows KIM data of mice treated with various conjugates.
11 shows the results of BUN analysis of mice treated with various conjugates.
12 is a graph showing the concentration of various oligomers in mouse kidney tissue.

1. Definition

In the following description, specific specific details are set forth to provide a thorough understanding of the various embodiments. However, those skilled in the art will understand that the present invention may be practiced without these details. In other instances, well-known structures have not been shown or described in detail in order to avoid unnecessarily obscure description of the embodiments. Unless the context requires otherwise, throughout the following specification and claims, the words "includes" and variations thereof such as "includes" and "including" are open, It should be interpreted in a comprehensive sense, that is, "including but not limited to". Additionally, the preamble provided herein is for convenience only and does not interpret the scope or meaning of the claimed invention.

Reference throughout the specification to “one embodiment” or “one embodiment” includes a special feature, structure, or characteristic described in connection with the embodiment in at least one embodiment. Accordingly, publication of the phrases "in one embodiment" or "in one embodiment" in various places throughout this specification is not necessarily all referring to the same embodiment. Moreover, a particular feature, structure or characteristic can be combined in any suitable way in one or more embodiments. In addition, the singular forms “one” (a, an) and “above” (the) used in this specification and the appended claims include plural references unless the context clearly indicates otherwise. The term “or” is generally used in its meaning including “and/or” unless the context clearly dictates otherwise.

The following terms as used herein have the following meanings unless otherwise indicated.

"Amino" refers to the -NH ₂ radical.

"Cyano" or "nitrile" represents a radical.

“Hydroxy” or “hydroxyl” refers to a radical.

"Imino" represents a =NH substituent.

"Guanidyl" represents a -NHC(=NH)NH ₂ substituent.

"Amidinyl" represents a -C(=NH)NH ₂ substituent.

"Nitro" refers to the -NO ₂ radical.

"Oxo" represents the =O substituent.

"Thioxo" represents the =S substituent.

"Cholate" refers to the following structure:

"Deoxycholate" represents the following structure:

“Alkyl” denotes a straight or branched hydrocarbon chain radical that is saturated or unsaturated (ie contains one or more double and/or triple bonds), has 1 to 30 carbon atoms, and is attached to the rest of the molecule by a single bond. . Alkyl containing any number of carbon atoms from 1 to 30 are included. Alkyl containing up to 30 carbon atoms is referred to as C ₁ -C ₃₀ alkyl, likewise, for example, alkyl containing up to 12 carbon atoms is C ₁ -C ₁₂ alkyl. Alkyl (and other moieties as defined herein) containing different numbers of carbon atoms are similarly denoted. The alkyl group is C ₁ -C ₃₀ Alkyl, C ₁ -C ₂₀ Alkyl, C ₁ -C ₁₅ alkyl, C ₁ -C ₁₀ alkyl, C ₁ -C ₈ alkyl, C ₁ -C ₆ alkyl, C ₁ -C ₄ alkyl, C ₁ -C ₃ alkyl, C ₁ -C ₂ alkyl , C ₂ -C ₈ alkyl, C ₃ -C ₈ alkyl and C ₄ -C ₈ alkyl. Representative alkyl groups are methyl, ethyl, n -propyl, 1-methylethyl (iso-propyl), n -butyl, i -butyl, s -butyl, n -pentyl, 1,1-dimethylethyl ( t -butyl), 3 -Methylhexyl, 2-methylhexyl, ethenyl, prop-1-enyl, but-1-enyl, pent-1-enyl, penta-1,4-dienyl, ethynyl, propynyl, but-2- Phosphoryl, but-3-ynyl, fentinyl, hexynyl, and the like, but are not limited to these. Unless stated otherwise specifically in the specification, an alkyl group may be optionally substituted as described below.

"Alkylene" or "alkylene chain" refers to a straight or branched divalent hydrocarbon chain linking the remaining molecules to a radical group. Alkylene may be saturated or unsaturated (ie, it contains one or more double and/or triple bonds). Representative alkylenes are C ₁ -C ₁₂ alkylene, C ₁ -C ₈ alkylene, C ₁ -C ₆ alkylene, C ₁ -C ₄ alkylene, C ₁ -C ₃ alkylene, C ₁ -C ₂ alkyl Ene, C ₁ alkylene, but not limited to these. Representative alkylene groups include, but are not limited to, methylene, ethylene, propylene, n -butylene, ethenylene, propenylene, n -butenylene, and the like. The alkylene chain is attached to the rest of the molecule through a single or double bond and to the radical group through a single or double bond. The point of attachment of the alkylene chain to the rest of the molecule and to the radical group may exist through one carbon or any two carbons within the chain. Unless stated otherwise specifically in the specification, alkylene chains may be optionally substituted as described below.

"Alkoxy" refers to _a radical of the formula -OR _a , wherein R _a is alkyl as defined. Unless stated otherwise specifically in the specification, an alkoxy group may be optionally substituted as described below.

"Alkoxyalkyl" refers to _a radical of the formula -R _b OR _a , wherein R _a is an alkyl radical as defined and R _b is an alkylene radical as defined. Unless stated otherwise specifically in the specification, an alkoxyalkyl group may be optionally substituted as described below.

"Alkylcarbonyl" refers to _a radical of the formula -C(=O)R _a , wherein R _a is an alkyl radical as defined above. Unless stated otherwise specifically in the specification, an alkylcarbonyl group may be optionally substituted as defined below.

"Alkyloxycarbonyl" refers to _a radical of -C(=O)OR _a , wherein R _a is an alkyl radical as defined. Unless stated otherwise specifically in the specification, an alkyloxycarbonyl group may be optionally substituted as defined below.

"Alkylamino" refers to _a radical of the formula -NHR _a or -NR _a R _a , wherein each R _a is independently an alkyl radical as defined above. Unless stated otherwise specifically in the specification, an alkylamino group may be optionally substituted as defined below.

"Amidyl" refers to _a radical of the formula -N(H)C(=O)R _a , wherein R _a is an alkyl or aryl radical as defined herein. Unless stated otherwise specifically in the specification, an amidyl group may be optionally substituted as defined below.

"Amidinylalkyl" refers to a radical of the formula -R _b -C(=NH)NH ₂ wherein R _b is an alkylene radical as defined above. Unless stated otherwise specifically in the specification, an amidinylalkyl group may be optionally substituted as defined below.

"Amidinylalkylcarbonyl" refers to a radical of the formula -C(=O)R _b -C(=NH)NH ₂ wherein R _b is an alkylene radical as defined above. Unless stated otherwise specifically in the specification, an amidinylalkylcarbonyl group may be optionally substituted as defined below.

"Aminoalkyl" refers to _a radical of the formula -R _b -NR _a R _a wherein R _b is an alkylene radical as defined above, and each R _a is independently a hydrogen or an alkyl radical.

"Thioalkyl" refers to _a radical of the formula -SR _a , wherein R _a is alkyl as defined above. Unless stated otherwise specifically in the specification, a thioalkyl group may be optionally substituted.

“Aryl” refers to a radical derived from a hydrocarbon ring system comprising hydrogen, 6 to 30 carbon atoms and at least one aromatic ring. The aryl radical can be a monocyclic, bicyclic, tricyclic or tetracyclic ring system, which can include fused or bridged ring systems. Aryl radicals include aceanthrylene, acenaphthylene, acephenanthrylene, anthracene, azulene, benzene, chrysene, fluoroanthene, fluorene, as -indacene, s -indacene, indan, indene, nattalene, Aryl radicals derived from phenalene, phenanthrene, pleiadene, pyrene and triphenylene, but are not limited thereto. Unless stated otherwise specifically in the specification, the term “aryl” or the prefix “ar-” (eg “aralkyl”) is meant to include an optionally substituted aryl radical.

"Aralkyl" refers to a radical of the formula -R _b -R _c , wherein R _b is an alkylene chain as defined above and R _c is one or more aryl radicals as defined above, eg benzyl , Diphenylmethyl, trityl, and the like. Unless stated otherwise specifically in the specification, an aralkyl group may be optionally substituted.

"Arylcarbonyl" refers to a group of the formula -C(=O)R _c , wherein R _c is one or more aryl radicals as defined above, for example phenyl. Unless stated otherwise specifically in the specification, an arylcarbonyl group may be optionally substituted.

"Aryloxycarbonyl" refers to a radical of the formula -C(=O)OR _c , wherein R _c is one or more aryl radicals as defined above, for example phenyl. Unless stated otherwise specifically in the specification, an aryloxycarbonyl group may be optionally substituted.

"Aralkylcarbonyl" refers to a radical of the formula -C(=O)R _b -R _c , wherein R _b is an alkylene chain as defined above and R _c is one or more as defined above Aryl radicals such as phenyl. Unless stated otherwise specifically in the specification, an aralkylcarbonyl group may be optionally substituted.

"Aralkyloxycarbonyl" refers to a radical of the formula -C(=O)OR _b -R _c , wherein R _b is an alkylene chain as defined above, and R _c is one as defined above Or more aryl radicals, such as phenyl. Unless stated otherwise specifically in the specification, an aralkyloxycarbonyl group may be optionally substituted.

"Aryloxy" refers to a radical of the formula -OR _c , wherein R _c is one or more aryl radicals as defined above, for example phenyl. Unless stated otherwise specifically in the specification, an arylcarbonyl group may be optionally substituted.

“Cycloalkyl” refers to a stable, non-aromatic, monocyclic or polycyclic ring that may contain fused or bridged ring systems, is saturated or unsaturated, and is also attached to the rest of the molecule by a single bond. Representative cycloalkyls include, but are not limited to, cycloalkyls having 3 to 15 carbon atoms and 3 to 8 carbon atoms. Monocyclic cycloalkyl radicals include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl. Polycyclic radicals include, for example, adamantyl, norbornyl, decalinyl, and 7,7-dimethyl-bicyclo[2.2.1]heptanyl. Unless stated specifically in the specification, a cycloalkyl group may be optionally substituted.

"Cycloalkyl" refers to a radical of the formula -R _b R _d , wherein R _b is an alkylene as defined above and R _d is a cycloalkyl radical as defined above. Unless stated specifically in the specification, a cycloalkylalkyl group may be optionally substituted.

"Cycloalkylcarbonyl" refers to a radical of the formula -C(=O)R _d , wherein R _d is a cycloalkyl radical as defined above. Unless stated specifically in the specification, a cycloalkylcarbonyl group may be optionally substituted.

"Cycloalkyloxycarbonyl" refers to a radical of the formula -C(=O)OR _d , wherein R _d is a cycloalkyl radical as defined above. Unless stated specifically in the specification, a cycloalkyloxycarbonyl group may be optionally substituted.

“Fused” refers to any ring structure described herein that is fused to an existing ring structure. When the fused ring is a heterocyclyl ring or a heteroaryl ring, any carbon atom on the existing ring structure that is part of the fused heterocyclyl ring or fused heteroaryl ring may be substituted with a nitrogen atom.

"Guanidinylalkyl" refers to a radical of the formula -R _b -NHC(=NH)NH ₂ , wherein R _b is an alkylene radical as defined above. Unless stated specifically in the specification, a guanidinylalkyl group may be optionally substituted as described below.

"Guanidinylalkylcarbonyl" refers to a radical of the formula -C(=O)R _b -NHC(=NH)NH ₂ , wherein R _b is an alkylene radical as defined above. Unless stated specifically in the specification, a guanidinylalkylcarbonyl group may be optionally substituted as described below.

“Halo” or “halogen” denotes bromo, chloro, fluoro or iodo.

"Haloalkyl" is an alkyl radical as defined above substituted by one or more halo radicals as defined above, for example trifluoromethyl, difluoromethyl, fluoromethyl, trichloromethyl, 2, 2,2-trifluoroethyl, 1,2-difluoroethyl, 3-bromo-2-fluoropropyl, 1,2-dibromoethyl, and the like. Unless stated specifically in the specification, a haloalkyl group may be optionally substituted.

"Perhalo" or "perfluoro" each represents a moiety in which each hydrogen atom is respectively substituted by a halo atom or a fluoro atom.

“Heterocyclyl”, “heterocycle” or “heterocyclic ring” is a stable 3-membered to containing 1 to 8 heteroatoms and 2 to 23 carbon atoms selected from the group consisting of nitrogen, oxygen, phosphorus and sulfur. Represents a 24-membered non-aromatic ring radical. Unless specifically stated herein, a heterocyclyl radical may be a monocyclic, bicyclic, tricyclic or tetracyclic ring system, which may include fused or bridged ring systems; Also in the heterocyclyl radical the nitrogen, carbon or sulfur atom may be optionally oxidized; The nitrogen atom may be optionally quaternized; Also the heterocyclyl radical may be partially or wholly saturated. Examples of such heterocyclyl radicals include dioxolanyl, thienyl[1,3]ditianyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, ioxazolidinyl, morpholinyl Neil, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidonyl , Pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, tritianyl, tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1-oxo-thiomorpholinyl, 1 ,1-dioxo-thiomorpholinyl, 12-crown-4,15-crown-5,18-crown-6,21-crown-7, aza-18-crown-6, diaza-18-crown- 6, aza-21-crown-7, and diaza-21-crown-7, but are not limited to these. Unless otherwise stated in the specification, a heterocyclyl group may be optionally substituted.

"Heteroaryl" refers to a 5- to 14-membered ring system radical comprising 1 to 6 heteroatoms consisting of hydrogen atoms, 1 to 13 carbon atoms, nitrogen, oxygen, phosphorus and sulfur, and at least one aromatic ring. Show. For the purposes of the present invention, the heteroaryl radical may be a monocyclic, bicyclic, tricyclic or tetracyclic ring system which may include a fused or bridged ring system; In addition, nitrogen, carbon or sulfur atoms in the heteroaryl radical may be optionally oxidized; The nitrogen atom may be optionally quaternized. Examples thereof include azepinyl, acridinyl, benzimidazolyl, benzothiazolyl, benzoindolyl, benzodioxolyl, benzofuranyl, benzoxazolyl, benzothiazolyl, benzothiadiazolyl, benzo[ b ][ 1,4]dioxepinyl, 1,4-benzodioxanyl, benzonaphthofuranyl, benzoxazolyl, benzodioxolyl, benzodioxynil, benzopyranyl, benzopyranoyl, benzofuranyl, benzofura Noyl, benzothienyl (benzothiophenyl), benzotriazolyl, benzo[4,6]imidazo[1,2-a]pyridinyl, carbazolyl, cinnolinyl, dibenzofuranyl, dibenzothiophenyl , Furanyl, furanonyl, isothiazolyl, imidazolyl, indazolyl, indolyl, indazolyl, isoindolyl, indolinyl, isoindolinyl, isoquinolyl, indolizinyl, isoxazolyl, naphthyridi Nyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, oxiranyl, 1-oxidopyridinyl, 1-oxidopyrimidinyl, 1-oxidopyrazinyl, 1-oxidopyridazinyl, 1- Phenyl- 1H -pyrrolyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl, pteridinyl, furinyl, pyrrolyl, pyrazolyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, Quinazolinyl, quinoxalinyl, quinolinyl, quinuclidinyl, isoquinolinyl, tetrahydroquinolinyl, thiazolyl, thiadiazolyl, trizolyl, tetraazolyl, triazinyl, and thiophenyl (i.e. Thienyl), but is not limited to these. Unless otherwise stated in the specification, a heteroaryl group may be optionally substituted.,

All of the above groups may be substituted or unsubstituted. The term "substituted" as used herein refers to the above groups (e.g., alkyl, alkylene, alkoxy, alkoxyalkyl, alkylcarbonyl, alkyloxycarbonyl, alkylamino, amidyl, amidinylalkyl, amidi Nylalkylcarbonyl, aminoalkyl, aryl, aralkyl, arylcarbonyl, aryloxycarbonyl, aralkylcarbonyl, aralkyloxycarbonyl, aryloxy, cycloalkyl, cycloalkylalkyl, cycloalkylcarbonyl, cycloalkyl Alkylcarbonyl, cycloalkyloxycarbonyl, guanidinylalkyl, guanidinylalkylcarbonyl, haloalkyl, heterocyclyl and/or heteroaryl) may be further functionalized, wherein at least one hydrogen It means that an atom can be replaced by a non-hydrogen atom substituent by a bond. Unless otherwise stated in the specification, a substituted group is oxo, -CO ₂ H, nitrile, nitro, -CONH ₂ , hydroxyl, thiooxy, alkyl, alkylene, alkoxy, alkoxyalkyl, alkylcarbonyl, alkyloxycar Bornyl, aryl, aralkyl, arylcarbonyl, aryloxycarbonyl, aralkylcarbonyl, aralkyloxycarbonyl, aryloxy, cycloalkyl, cycloalkylalkyl, cycloalkylcarbonyl, cycloalkylalkylcarbonyl, cycloalkyl Oxycarbonyl, heterocyclyl, heteroaryl, dialkylamine, arylamine, alkylarylamine, diarylamine, N-oxide, imide, and enamine; Silicon atoms in the group such as trialkylsilyl, dialkylarylsilyl, alkyldiarylsilyl, triarylsilyl, perfluoroalkyl or perfluoroalkoxy, such as trifluoromethyl or trifluoro It may contain one or more substituents selected from lomethoxy. “Substituted” also means that one or more hydrogen atoms are heteroatoms such as oxygen in oxo, carbonyl, carboxyl, and ester groups by higher order bonds (eg, double or triple bonds); It means any of the above groups that can be replaced by nitrogen, oxime, hydrazine and nitrile in groups such as imine. For example, "substituted" means that one or more hydrogen atoms are -NR _g C(=O)NR _g R _h , -NR _g C(=O)OR _h , -NR _g SO ₂ R _h , -OC(=O )NR _g R _h , -OR _g , -SR _g , -SOR _g , -SO ₂ R _g , -OSO ₂ R _g , -SO ₂ OR _g , =NSO ₂ R _g , and -SO ₂ NR _g R _h And any of the above groups replaced by. "Substituted" also means that at least one hydrogen atom is -C(=O)R _g , -C(=O)OR _g , -CH ₂ SO ₂ R _g , -CH ₂ SO ₂ NR _g R _h , -SH,- It includes any of the above groups replaced by SR _g or -SSR _g . In the foregoing, R _g and R _h are the same or different and are independently hydrogen, alkyl, alkoxy, alkylamino, thioalkyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, haloalkyl, heterocyclyl, N -Heterocyclyl, heterocyclylalkyl, heteroaryl, N -heteroaryl and/or heteroarylalkyl. In addition, each of the aforementioned substituents may also be optionally substituted with one or more of the above substituents. Moreover, any of the groups may be substituted to contain one or more internal oxygen or sulfur atoms. For example, an alkyl group can be substituted with one or more internal oxygens to form an ether or polyether group. Similarly, alkyl groups can be substituted with one or more internal sulfur atoms to form thioethers, disulfides, and the like. The amidyl moiety may be substituted with up to two halo atoms, but other such groups may be substituted with one or more halo atoms. Any of the above groups may also be substituted with amino, monoalkylamino, guanidineyl or amidinyl. Optional substituents on any of the above groups also include arylphosphoryl, for example the formula -R _a P(Ar) ₃ , wherein R _a is alkylene and Ar is an aryl moiety, such as phenyl.

The terms “antisense oligomer” or “antisense compound” are used interchangeably and also refer to a sequence of subunits, each having a base carried on a backbone subunit consisting of ribose or other pentose sugar or morpholino groups, , Wherein the skeletal group hybridizes a base in the compound to a target sequence in a nucleic acid (typically RNA) by a Watson-Crickare base pair, and in the target sequence, a nucleic acid: oligomeric hetero-double chain is formed by subunit bonds. Connected by Oligomers may have exact sequence complementarity or close complementarity to the target sequence. Such antisense oligomers are designed to block or inhibit the translation of the mRNA containing the target sequence and can also be said to be "related" to the sequence forming the hybrid.

“Morpholino oligomer” or “PMO” refers to a polymer molecule that supports a hydrogen bondable base that binds to a representative polynucleotide, wherein the polymer contains a backbone moiety per pentose and more specifically nucleotides and nucleosides. It does not contain a ribose skeleton linked by a representative phosphodiester bond, but instead contains a ring nitrogen having a coupling through a ring nitrogen. Exemplary “morphrolpino” oligomers are linked together by (thio)phosphoramidate or (thio)phosphorodiamidate bonds, and one subunit of morpholino nitrogen to the 5′ exocyclic carbon of adjacent subunits. It includes a morpholino subunit structure that binds to, each containing a purine or pyrimidine base-pair moiety effective to link to a base in a polynucleotide by base-specific hydrogen bonding. Morpholino oligomers (including antisense oligomers) are described, for example, in US Pat. Nos. 5,698,685; 5,217,866; 5,142,047; 5,034,506; 5,166,315; 5,185,444; 5,185,444; 5,521,063; 5,506,337 and pending US patent application Ser. Nos. 12/271,036; 12/271,040; And PCT International Publication No. WO/2009/064471, all of which are incorporated herein by reference. Representative PMOs include PMOs in which the small molecule bond is a bond (A1).

"PMO+" is any number of (1-piperazino)phosphonylideneoxy, (1-(4-(ω-guanidino-alkanoyl)-piperazino)phosphiniredeneoxy bonds described above. (A2 and A3) refers to phosphorodiamidate morpholino oligomers (see, for example, PCT International Application Publication No. WO/2008/036127, all incorporated herein by reference).

“PMO-X” refers to a phosphorodiamidate described herein comprising at least one (B) linkage or at least one described terminal modification.

The “phosphoramidate” group contains three attached oxygen atoms and one attached nitrogen atom, while the “phosphorodiamidate” group (see eg FIGS. 1D-E) has two attached oxygen atoms. And phosphorus having two attached nitrogen atoms. In the uncharged or modified intersubunit bonds of oligomers described herein and in pending US patent applications 61/349,783 and 11/801,885, one nitrogen is always hanging on the backbone chain. The second nitrogen in the phosphorodiamidate bond is typically a ring nitrogen in the morpholino ring structure.

The "thiophosphoramidate" or "thiophosphorodiamidate" bond is a phosphoramidate or phosphorodiamidate, respectively, wherein one oxygen atom, typically oxygen hanging from the backbone, is replaced by sulfur.

"Bond between subunits" refers to a bond comprising two morpholino subunits such as, for example, formula (I).

The terms “uncharged”, “cationic” and “anionic” as used herein refer to the predominant state of the chemical moiety at an approximate neutral pH, eg about 6-8. For example, the term can refer to the main state of the chemical moiety at physiological pH, ie about 7.4.

"Lower alkyl" denotes an alkyl radical of 1 to 6 carbon atoms, for example methyl, ethyl, n-butyl, i-butyl, t-butyl, isoamyl, n-pentyl and isopentyl. In certain embodiments, a “lower alkyl” group has 1 to 4 carbon atoms. In other embodiments, the “lower alkyl” group has 1 to 2 carbon atoms, ie methyl or ethyl. Similarly, "lower alkenyl" denotes alkenyl radicals of 2 to 6, preferably 3 or 4 carbon atoms, such as allyl and butenyl.

A “non-interfering substituent” is one that adversely affects the ability of an antisense oligomer as described herein to bind its intended target. Such substituents include small and/or relatively non-polar groups such as methyl, ethyl, methoxy, ethoxy or fluoro.

The oligonucleotide or antisense oligomer is a target polymorphism when the oligomer hybridizes to the target under physiological conditions having a Tm of 37° C. or higher, 45° C. or higher, preferably at least 50° C., and typically 60° C.-80° C. or higher. "Specifically hybridizes" to a nucleotide. The "Tm" of an oligomer is the temperature at which it forms a 50% hybrid to the complementary polynucleotide. Tm is for example Miyada et al ., Methods Enzymol . 154 :94-107 (1987) is determined in physiological saline under standard conditions. Such hybrid formation can occur with exact complementarity as well as “close” or “substantial” complementarity of antisense to the target sequence.

Polynucleotides are described as "complementary" to each other when hybrid formation occurs in an antiparallel configuration between two single stranded polynucleotides. Complementarity (the degree to which one polynucleotide is complementary to another) can be quantified in terms of the proportion of bases in opposite strands that are expected to form hydrogen bonds with each other according to generally accepted base pairing rules.

The first sequence is an “antisense sequence” with respect to the second sequence when the polynucleotide specifically binds or specifically hybridizes the first sequence to the second polynucleotide sequence under physiological conditions.

The term “target sequence” is a sequence in an oligonucleotide analog that is complementary (meaningly further, substantially complementary) to the target sequence in the RNA genome. The entire sequence, or only a portion of the analog compound, may be complementary to the target sequence. For example, in an analog with 20 bases, only 12-14 may be the target sequence. Typically, the target sequence forms contiguous bases in the analog, but alternatively, when placed together, for example from the opposite end of the analog, can form a non-contiguous sequence that constitutes a sequence spanning the target sequence. have.

The “backbone” of an oligonucleotide analog (eg, an uncharged oligonucleotide analog) refers to a structure that supports the base pair moiety for a morpholino oligomer, eg, as described herein. The "backbone" includes a morpholino ring structure linked by small molecule bonds (eg, phosphorus-containing bonds). “Substantially uncharged backbone” refers to the backbone of an oligonucleotide analog, wherein less than 50% of the small molecule bonds are charged at near neutral pH. For example, a substantially uncharged backbone has less than 50%, less than 40%, 30%, less than, less than 20%, less than 10%, less than 5% or even 0% of subunit bonds charged near neutral pH. Can include. In some embodiments, the substantially uncharged backbone is at most one charged intermolecular bond (at physiological pH) for every 4 (at physiological pH) uncharged bonds (at physiological pH), 1 for every 8 Contains at most one for every dog, or 16 uncharged bonds. In some embodiments, the nucleic acid analogs described herein are fully uncharged.

The target and target sequence are described as "complementary" to each other when hybrid formation occurs in antiparallel structures. The target sequence may have “close” or “substantial” complementarity to the target sequence and also serves the purposes of the methods described herein, ie is still “complementary”. Preferably, the oligonucleotide analog compound used in the method described herein has at most one mismatch with the target sequence every 10 nucleotides, and preferably at most one mismatch out of 20. Alternatively, the antisense oligomer used has at least 80%, at least 90% sequence homology, or at least 95% sequence homology with an exemplary target sequence as described herein. For the purpose of complementary binding to the RNA target, the guanine base may be complementary to the cytosineor uracil RNA base, as described below.

“Heteroduplex” refers to a duplex between an oligonucleotide analog and a complementary portion of a target RNA. “Nuclease-resistant heteroduplex” refers to a heteroduplex formed by the binding of an antisense oligomer to its complementary target, and thus the heteroduplex is capable of cleaving, for example, a double-stranded RNA/RNA or RNA/DNA complex. Capable of being substantially resistant to digestion in vivo by intracellular and extracellular nucleases such as RNAse H.

When a drug enters a cell by a mechanism rather than a passive diffusion across the cell membrane, it is "actively taken up by mammalian cells". The drug may be transported, for example by "active transport", which represents the transport of the drug across mammalian cell membranes, for example by an ATP-dependent transport mechanism or by "facilitated transport" It represents the transport of the antisense drug across the cell membrane by a transport mechanism that requires binding of the drug to the protein and then facilitates the passage of the binding agent across the membrane.

The terms “regulated expression” and/or “antisense activity” refer to the ability to interfere with the expression or translation of RNA, thereby increasing or more typically reducing the expression of a given protein. In the case of reduced protein expression, antisense oligomers may directly block the expression of a given gene or contribute to the promotion of destruction of RNA transcribed from the gene. It is believed that morpholino oligomers as described herein act through an electron (stereoblocking) mechanism. Preferred antisense targets of steric blocking oligomers are the ATG start codon region, the splice site, the region closely adjacent to the splice site, and the 5'- of the mRNA, although other regions are successfully targeted using the morpholino oligomer. Includes untranslated areas.

The “amino acid subunit” is generally an amino acid residue (-CO-CHR-NH-); β- or other amino acid residues (eg, -CO-CH ₂ CHR-NH-), wherein R is an amino acid side chain.

The term “naturally occurring amino acids” refers to amino acids present in proteins found in nature. The term "non-natural amino acid" refers to an amino acid that is not present in proteins found in nature, and includes, for example, beta-alanine (β-Ala) and 6-aminohexanoic acid (Ahx).

An "effective amount" or "therapeutically effective amount" is the amount of antisense oligomer administered to the mammal as either a single dose or part of a series of doses effective to produce the desired therapeutic effect, typically by inhibiting the translation of the selected target nucleic acid sequence. Represents.

"Treatment" of an individual (eg, a mammal such as a human) or cell is any type of interference used in an attempt to alter the natural process of the individual or cell. Treatment includes, but is not limited to, administration of a pharmaceutical composition, and can also be carried out prophylactically or after the onset of a pathological event or after contact with an etiological agent.

II. Carrier peptide

A, the properties of the carrier peptide

As pointed out above, the present invention relates to a conjugate of a carrier peptide and a nucleic acid analog. Carrier peptides are generally effective in enhancing cellular penetration of nucleic acid analogs. Moreover, Applicants surprisingly found that inclusion of a glycine (G) or proline (P) amino acid between the nucleic acid analogue and the remaining carrier peptide (e.g., at the carboxy or amino terminus of the carrier peptide) reduces the toxicity of the conjugate, while the efficacy is It has been found to remain the same or increase for conjugates having different binding between the carrier protein and the nucleic acid analog. Thus, the conjugates of the present invention have a better therapeutic window than other peptide-oligomeric conjugates and are more promising drug candidates.

In addition to reduced toxicity, the presence of glycine or proline amino subunits between the nucleic acid analog and the carrier protein is believed to provide additional advantages. For example, glycine is inexpensive and easily couples to nucleic acid analogs (or optional linkers) without any possibility of racemization. Similarly, proline is easily coupled without racemization and also provides a carrier peptide that is not a helix-forming agent. The hydrophobicity of proline may also confer certain advantages regarding the interaction of the carrier peptide with the lipid bilayer of the cell. Carrier peptides comprising multiple prolines (eg, in certain embodiments) can resist G-tetraplex formation. Finally, in certain embodiments, when the proline moiety is adjacent to the arginine amino acid subunit, the proline moiety imparts metabolism to the conjugate because the arginine-proline amide bond cannot be cleaved by a common endopeptidase.

As pointed out above, a conjugate comprising a carrier protein bound to a nucleic acid analog through a glycine or proline amino acid subunit has lower toxicity and similar efficacy compared to other known conjugates. Experiments conducted to support this application show that the renal toxicity markers are much lower in the conjugates of the present invention compared to other conjugates (e.g., the kidney damage marker (KIM) described in Example 30 and blood urea nitrogen (BUN) data). Without wishing to be bound by theory, the inventors believe that the reduced toxicity of the described conjugates is associated with the absence of non-natural amino acids such as aminohexanoic acid or β-alanine in the portion of the peptide attached to the nucleic acid analog (e.g., carboxy terminus). I believe it can be related. Since these non-natural amino acids are not cleaved in vivo, it is thought that the toxic concentration of the non-cleaved peptide accumulates and may cause a toxic effect.

The glycine or proline moiety may be the amino or carboxy terminus of the carrier peptide, and in some cases, the carrier peptide may be directly linked to the nucleic acid analog via a glycine or proline subunit, or the carrier peptide may be linked to the nucleic acid analog via an optional linker. have.

In one embodiment, the present invention

(a) a carrier peptide containing an amino acid subunit; And

(b) a nucleic acid derivative comprising a target nucleotide sequence for sequence-specific binding to a substantially uncharged backbone and a target nucleic acid

It is a conjugate containing,

Here, two or more of the amino acid subunits are positively charged amino acids, and the carrier peptide contains a glycine (G) or proline (P) amino acid subunit at the carboxy terminus of the carrier peptide, and the carrier peptide is covalently applied to the nucleic acid analogue. It provides a conjugate that is attached. In some embodiments, no more than 7 contiguous amino acid subunits are arginine, for example, no more than 6 contiguous amino acid subunits are arginine. In some embodiments, the carrier peptide comprises a glycine amino acid subunit at the carboxy terminus. In another embodiment, the carrier peptide comprises a proline amino acid subunit at the carboxy terminus. In another embodiment, the carrier peptide comprises a single glycine or proline at the carboxy terminus (ie, does not contain a glycine or proline dimer or trimer at the carboxy terminus).

In certain embodiments, the carrier peptide, when conjugated to an antisense oligomer having a substantially uncharged backbone, is compared to the unconjugated form of the antisense oligomer as demonstrated by the following (i) or (ii). Effective in increasing the binding of antisense oligomers:

(i) when binding of the antisense oligomer to its target sequence is effective to block the translation start codon of the encoded protein, a decrease in the expression of the encoded protein compared to that provided by the unconjugated oligomer, or

(ii) When the binding of the antisense oligomer to its target sequence is correctly spliced, when it is effective to block an abnormal splice site in the pre-mRNA encoding the protein, the expression of the encoding protein compared to that provided by the unconjugated oligomer Increase in. Assays suitable for measuring these effects are further described below. In one embodiment, conjugation of the peptide provides this activity in cell-free translation assays as described herein. In some embodiments, activity is enhanced by at least 2 factors, at least 5 factors, or at least 10 factors.

Alternatively or additionally, carrier peptides are effective in increasing the transport of nucleic acid analogs into cells compared to the analogs in the unconjugated form. In certain embodiments, transport is enhanced by at least 2 factors, at least 5 factors or at least 10 factors.

In another embodiment, the carrier protein is effective in reducing the toxicity of the conjugate (i.e., increasing the maximum tolerated dose) with respect to the conjugate comprising a carrier peptide lacking a terminal glycine or proline amino subunit. In certain embodiments, toxicity is reduced by at least 2 factors, at least 5 factors, or at least 10 factors.

A further advantage of the peptide transport site is its expected ability to stabilize the duplex between the antisense oligomer and its target nucleic acid sequence. Without wishing to be bound by theory, this ability to stabilize the duplex can result from electrostatic interactions between positively charged transport sites and negatively charged nucleic acids.

The length of the carrier protein is not particularly limited and also varies in different embodiments. In some embodiments, the carrier peptide comprises 4 to 40 amino acid subunits. In other embodiments, the carrier peptide comprises 6 to 30, 6 to 20, 8 to 25 or 10 to 20 amino acid subunits. In some embodiments, the carrier peptide is straight chain, while in other embodiments it is branched.

In some embodiments, the carrier peptide is enriched in positively charged amino acid subunits, such as arginine amino acid subunits. Carrier peptides are "rich" in positively charged amino acids when at least 10% of the amiso acid subunits are positively charged. For example, in some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of the amino acid subunits are positively charged. In another embodiment, all amino acid subunits are positively charged, except for the glycine or proline amino acid subunit. In another embodiment, all of the positively charged amino acid subunits are arginine.

In other embodiments, the number of positively charged amino acid subunits in the carrier peptide ranges from 1 to 20, such as from 1 to 10 or from 1 to 6. In certain embodiments, the number of positively charged amino acids in the carrier peptide is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19 or 20.

Positively charged amino acids may be naturally occurring, non-naturally occurring, synthetic, modified, or analogs of naturally occurring amino acids. For example, modified amino acids having a pure positive charge can be specifically designed for use in the present invention in the more detailed description below. Many different types of modifications to amino acids are well known in the art. In certain embodiments, the positively charged amino acid is histidine (H), lysine (K), or arginine (R). In other embodiments, the carrier peptide contains only natural amino acid subunits (ie, does not contain unnatural amino acids). In other embodiments, the terminal amino acid can be capped at the N-terminus, for example with an acetyl, benzoyl or stearyl moiety, for example.

Any number, combination and/or sequence of H, K and/or R can be present in the carrier peptide. In some embodiments, all of the amino acid subunits are positively charged amino acids, except for the carboxyl terminal glycine or proline. In another embodiment, at least one of the positively charged amino acids is arginine. For example, in some embodiments, all of the positively charged amino acids are arginine, and in still other embodiments, the carrier peptide consists of arginine and a carboxy terminal glycine or proline. In another embodiment, the carrier peptide comprises no more than 7 contiguous arginines, for example no more than 6 contiguous arginines.

Other types of positively charged amino acids are also devised. For example, in certain embodiments, at least one of the positively charged amino acids is an arginine analog. For example, the arginine analog may be a cation α-amino acid comprising a side chain of the formula R ^a N=C(NH ₂ )R ^b , wherein R ^a is H or R ^c ; R ^b is R ^c , NH ₂ , NHR, or N(R ^c ) ₂ , R ^c is lower alkyl or lower alkenyl, and optionally contains oxygen or nitrogen, or R ^a and R ^b together form a ring And the side chain is linked to an amino acid through R ^a or R ^b . The carrier peptide can contain any number of these arginine analogs.

Positively charged amino acids can occur in any sequence within the carrier peptide. For example, in some embodiments, the positively charged amino acids may be alternating or may be sequential. For example, the carrier peptide may comprise the sequence (R ^d ) _m , where R ^d is an independently positively charged amino acid in each occurrence, and m is 2 to 12, 2 to 10, 2 to 8 or 2 to 6 It is an integer in the range. For example, in certain embodiments, R ^d is arginine and the carrier peptide is a sequence selected from (R) ₄ , (R) ₅ , (R) ₆ , (R) ₇ and (R) ₈ or (R) ₄ , (R) ₅ , (R) ₆ and (R) ₇ .For example, in a specific embodiment, the carrier peptide is sequence (R) ₆ , for example (R) ₆ G or (R ) Includes ₆ P.

In another embodiment, the carrier peptide comprises the sequence (R ^d ) _m and a carboxyl terminal glycine or proline, wherein R ^d is an independently positively charged amino acid at each occurrence, and m is 2-12, 2-10, It is an integer in the range of 2 to 8 or 2 to 6. In certain embodiments Rd is at each occurrence independently arginine, histidine or lysine. For example, in certain embodiments R ^d is arginine and the carrier peptide is a sequence selected from (R) ₄ , (R) ₅ , (R) ₆ , (R) ₇ and (R) ₈ and carboxy terminal glycine or It consists of proline. For example, in a specific embodiment, the carrier peptide consists of the sequence (R) ₆ G or (R) ₆ P.

In some other embodiments, the carrier peptide may comprise one or more hydrophobic amino acid subunits, wherein the hydrophobic amino acid subunit comprises a substituted or unsubstituted alkyl, alkenyl, alkynyl, aryl or aralkyl side chain, wherein the alkyl , Alkenyl and alkynyl side chains contain at most one heteroatom for every six carbon atom acids. In some embodiments, the hydrophobic amino acid is phenylalanine (F). For example, the carrier peptide may contain two or more contiguous hydrophobic amino acids such as phenylalanine (F), for example, two contiguous phenylalanine moieties. The hydrophobic amino acid(s) can be present at any point in the carrier peptide sequence.

In another embodiment, the carrier peptide has the sequence [(R ^d Y ^b R ^d ) _x (R ^d R ^d Y ^b ) _y ] _z , or [(R ^d R ^d Y ^b ) _y (R ^d Y ^b R ^d ) _x ] _z , wherein R ^d is at each occurrence independently a positively charged amino acid, x and y are independently 0 or 1 at each occurrence, provided that x + y is 1 or 2, and z is 1 , 2, 3, 4, 5 or 6 and Y ^b is the formula:

Where n is 2 to 7 and each R ^e is independently hydrogen or methyl at each occurrence. In some of these embodiments, R ^d is at each occurrence independently arginine, histidine, or lysine. In other embodiments, each R ^d is arginine. In another embodiment, n is 5 and Y ^b is an aminohexanoic acid moiety. In other embodiments, n is 2 and Y ^b is a β-alanine moiety. In yet other embodiments, R ^e is hydrogen.

In certain embodiments of the foregoing, x is 1 and y is 0, and the carrier peptide also comprises the sequence (R ^d Y ^b R ^d ) _z . In another embodiment, n is 5 and Y ^b is an aminohexanoic acid moiety. In other embodiments, n is 2 and Y ^b is a β-alanine moiety. In yet other embodiments, R ^e is hydrogen.

In another embodiment of the foregoing, x is 0 and y is 1 and the carrier peptide also comprises the sequence (R ^d R ^d Y ^b ) _z . In another embodiment, n is 5 and Y ^b is an aminohexanoic acid moiety. In other embodiments, n is 2 and Y ^b is a β-alanine moiety. In yet other embodiments, R ^e is hydrogen.

In another embodiment, the carrier peptide comprises the sequence (R ^d Y ^b ) _p , wherein R ^d and Y ^b are as defined above and p is an integer ranging from 2 to 8. In other embodiments, each R ^d is arginine. In another embodiment, n is 5 and Y ^b is an aminohexanoic acid moiety. In other embodiments, n is 2 and Y ^b is a β-alanine moiety. In yet other embodiments, R ^e is hydrogen.

In another embodiment, the carrier peptide comprises the sequence ILFQY. The peptide may comprise an ILFQY sequence in addition to any of the other sequences described herein. For example, the carrier peptide is ILFQY and [(R ^d Y ^b R ^d ) _x (R ^d R ^d Y ^b ) _y ] _z , [(R ^d R ^d Y ^b ) _y (R ^d Y ^b R ^d ) _x ] _z , (R ^d Y ^b ) _p or combinations thereof, where R ^d , x, y and Y ^b are as defined above. [(R ^d Y ^b R ^d ) _x (R ^d R ^d Y ^b ) _y ] _z , [(R ^d R ^d Y ^b ) _y (R ^d Y ^b R ^d ) _x ] _z or (R ^d Y ^b ) _{The p} sequence can be present at the amino terminus, carboxy terminus or both of the ILFQY sequence. In certain embodiments, x is 1 and y is 0 and the carrier peptide comprises (R ^d Y ^b R ^d ) _z linked to the ILFQY sequence via an optional Z linker.

In other related embodiments, the carrier peptide comprises the sequence ILFQ, IWFQ or ILIQ. Other embodiments include carrier peptides comprising the sequence PPMWS, PPMWT, PPMFS or PPMYS. The carrier peptide is, for example, the sequence [(R ^d Y ^b R ^d ) _x (R ^d R ^d Y ^b ) _y ] _z , [(R ^d R ^d Y ^b ) _y (R ^d Y ^b R ^d ) _x ] _z Or in addition to (R ^d Y ^b ) _p (where R ^d , x, y and Y ^b are as defined above), these sequences described herein may be included.

Some embodiments of the carrier peptide include modifications to naturally occurring amino acid subunits, for example the amino acid-terminal or carboxy-terminal amino acid subunits may be modified. Such modifications include capping free amino or free carboxy with hydrophobic groups. For example, the amino terminus can be capped with an acetyl, benzoyl or stearyl moiety. For example, any of the peptide sequences in Table 1 may have such modifications even if not specifically indicated in the table. In these embodiments, the amino terminus of the carrier peptide can be represented as follows:

또는

or

In another embodiment, the carrier peptide comprises at least one of alanine, asparagine, cysteine, glutamine, glycine, histidine, lysine, methionine, serine or threonine.

In some of the embodiments described herein, the carrier peptide consists of the described sequence and the carboxy terminal glycine or proline amino acid subunit.

In some embodiments, the carrier peptide has the following sequence (carboxy terminus at the amino terminus): R ₆ G, R ₇ G, R ₈ G, R ₅ GR ₄ G, R ₅ F ₂ R ₄ G, Tat-G, rTat It is not composed of -G, (RXR ₂ G ₂ ) ₂ or (RXR ₃ X) ₂ G. In another embodiment, the carrier peptide is not composed of R ₈ G, R ₉ G or R ₉ F ₂ G. In yet other embodiments, the carrier peptide is Tat-G, rTat-G, R ₉ F ₂ G, R ₅ F ₂ R ₄ , R ₄ G, R ₅ G, R ₆ G, R ₇ G, R ₈ G , R ₉ G, (RXR) ₄ G, (RXR) ₅ G, (RXRRBR) ₂ G, (RAR) ₄ F ₂ or (RGR) ₄ F ₂ . In other embodiments, the carrier peptide does not consist of “Penetratin” or “R ₂ Pen”.

In another aspect, the present invention provides a peptide-nucleic acid analog conjugate, a nucleic acid analog having a substantially uncharged backbone and a targeting nucleotide sequence, and covalently bound to the nucleic acid analog, carboxy terminal glycine or proline amino acid subunit And consisting of 8 to 16 additional other subunits selected from R ^d subunit, Y subunit, and optional Z subunit, and comprising at least 8 R ^d subunits, at least 2 Y subunits and at most 3 Z subunits. Including,

Here, >50% of the subunit is an R ^d subunit,

(a) each R ^d subunit independently represents an arginine or an arginine analog, wherein the arginine analog is a cationic α-amino acid comprising a side chain of the formula R ^a N=C(NH ₂ )R ^b , where R ^a Is H or R ^c ; R ^b is R ^c , NH ₂ , NHR, or N(R ^c ) ₂ , where R ^c is lower alkyl or lower alkenyl and optionally comprises nitrogen or R ^a or R ^b together form a ring And also the side chain is linked to an amino acid via R ^a or R ^b ;

(b) said at least two Y subunits are Y ^a or Y ^b , wherein:

(i) each Y ^a is a neutral α-amino acid subunit having a side chain independently selected from independently substituted or unsubstituted alkyl, alkenyl, alkynyl, aryl, and aralkyl, wherein the side chain is a substituted When selected from alkyl, alkenyl and alkynyl, every 2 carbon atoms, preferably every 4 carbon atoms, and more preferably every 6 carbon atoms contains at most one heteroatom, wherein the subunits are contiguous or Flank the linker moiety, and

(ii) Y ^b is

Is,

Where n is 2 to 7 and each R ^e is independently hydrogen or methyl at each occurrence, and

(c) Z is naturally occurring, excluding alanine, asparagine, cysteine, glutamine, glycine, histidine, lysine, methionine, serine, threonine and side chains negatively charged at physiological pH (e.g., carboxylate side chains). Represents an amino acid subunit selected from amino acids that are one or two carbon analogs of the side chain. In some embodiments, the side chain is neutral. In other embodiments, the Z side chain is a side chain of a naturally occurring amino acid. In some embodiments the optional Z subunit is selected from alanine, glycine, methionine, serine, and threonine. The carrier peptide may comprise 0, 1, 2, or 3 Z subunits, and in some embodiments at most 2 Z subunits.

In selected embodiments, the carrier peptide has exactly two Y subunits of type Y ^a , which are adjacent or flanking cysteine subunits. In some embodiments, two Y ^a subunits are contiguous. In other embodiments, the side chains of the Y ^a subunit include side chains of naturally occurring amino acids or one and two carbon analogs thereof, excluding side chains charged at physiological pH. Another possible side chain is the side chain of a naturally occurring amino acid. In a further embodiment, the side chain is an aryl or aralkyl side chain, for example each Y ^a is independently selected from phenylalanine, tyrosine, tryptophan, leucine, isoleucine and valine.

In selected embodiments, each Y ^a is independently selected from phenylalanine and tyrosine. In a further embodiment, each Y ^a is phenylalanine. This includes, for example, conjugates consisting of an arginine subunit, a phenylalanine subunit, a glycine or proline amino acid subunit, an optional linker moiety, and a nucleic acid analogue. One such conjugate includes a peptide having the formula Arg ₉ Phe ₂ aa, where aa is glycine or proline.

The aforementioned carrier peptides may also include ILFQY, ILFQ, IWFQ or ILIQ. Other embodiments include the aforementioned carrier peptides comprising the sequence PPMWS, PPMWT, PPMFS or PPMYS.

The peptide-oligomer conjugate of the present invention inhibits the expression of target mRNA in a protein expression system including a cell-free translation system; Inhibit splicing of target pre-mRNA; It is also more effective than unconjugated oligomers in a variety of functions, including inhibiting viral replication of viral nucleic acids or regulating mRNA transcription.

Also within the scope of the present invention are conjugates of other pharmacological agents (ie, not nucleic acid analogs) and carrier peptides. Specifically, some embodiments

(a) a carrier peptide containing an amino acid subunit; And

(b) pharmacological agents

It provides a conjugate comprising a;

here:

Two or more of the amino acid subunits are positively charged amino acids, the carrier peptide contains a glycine (G) or proline (P) amino acid subunit at the carboxy terminus of the carrier peptide, and the carrier peptide is covalently attached to the pharmacological drug. In these embodiments the carrier peptide may be any of the carrier peptides described herein. Also provided is a method of delivering a pharmacological agent by conjugating a pharmacological agent to a carrier peptide.

Although the pharmacological agent to be supplied may be a compound used for detection such as a fluorescent compound, it may be a physiologically active agent, for example, a therapeutic or prophylactic agent. Physiologically active agents include biomolecules, such as peptides, proteins, saccharides, or nucleic acids, particularly antisense oligonucleotides, or drugs selected from "small molecule" organic or inorganic compounds. “Small molecule” compounds can be broadly defined as organic, inorganic, or organometallic compounds other than biomolecules as described above. Typically, such compounds have a molecular weight of less than 1000, or in some embodiments less than 500.

In one embodiment, the pharmacological agent to be delivered does not comprise a single amino acid, dipeptide, or tripeptide. In another embodiment it does not include short oligopeptides, i.e. the oligopeptides have fewer than 6 amino acid subunits. In further embodiments no longer oligopeptides are included, ie the oligopeptides have 7 to 20 amino acid subunits. Further embodiments do not include polypeptides or proteins having 20 or more amino acid subunits.

Carrier peptides are effective in increasing the transport of pharmacological agents within cells compared to pharmacological agents with less toxic and/or unconjugated form, with respect to pharmacological agents conjugated to the corresponding peptides without glycine or proline subunits. . In some embodiments, transport is increased by a factor of at least 2, at least 5 or at least 10. In other embodiments, toxicity is reduced by at least 2, at least 5, or at least 10 factors (ie, the maximum tolerated dose is increased).

A. Peptide Linker

The carrier peptide can be linked to a drug to be delivered (eg, a nucleic acid analog, a pharmacological drug, etc.) by a variety of methods available to those skilled in the art. In some embodiments, the carrier peptide is linked directly to the nucleic acid analog without interfering linkers. In this regard, the formation of an amide bond between the terminal amino acid and the free amine of the free carboxy on the nucleic acid analog may be useful for forming the conjugate. In certain embodiments, the carboxy terminal glycine or proline subunit is directly linked to the 3'end of the nucleic acid analog. For example, the carrier peptide can be linked by forming an amide bond between the carboxy terminal glycine or proline moiety and the 3'morpholino ring nitrogen (see, e.g., Figure 1C).

In some embodiments, the nucleic acid analog is conjugated to the carrier through a linker moiety selected from ^a Y ^a or Y ^b subunit, a cysteine subunit, and an uncharged, non-amino acid linker moiety. In another embodiment, the nucleic acid analog is linked to the carrier peptide directly via glycine or proline at the 5'or 3'end of the nucleic acid analog. In some embodiments, the carrier peptide is linked directly to the 3'of the nucleic acid analogue via a glycine or proline amino acid subunit, for example via an amide bond to the 3'morpholino nitrogen.

In other embodiments, the conjugate comprises a binding moiety between the terminal glycine or proline amino acid subunits. In some of the embodiments, the linker is selected from alkyl, hydroxyl, alkoxy, alkylamino, amide, ester, carbonyl, carbamate, phosphorodiamidate, phosphoroamidate, phosphorothioate, and phosphodiester. It is up to 18 atoms in length, including bonds. In certain embodiments, the linker comprises a phosphorodiamidate and piperazine linkage. For example, in some embodiments the linker has Formula (XXIX):

In the above formula, R ²⁴ is absent or is H or C ₁ -C ₆ alkyl. In certain embodiments, R ²⁴ is absent and in other embodiments Formula (XXIX) connects the 5′ end of a nucleic acid analog (eg, morpholino oligomer) to a carrier peptide (see eg FIG. 1B). .

In some embodiments, the side chain portion of the R ^d subunit is independently gunanidyl (HN=C(NH ₂ )NH-), amidinyl (HN=C(NH ₂ )C<), 2-aminodihydropyridyl , 2-aminotetrahydropyrimidyl, 2-aminopyridinyl and 2-amino pyrimidinyl.

In some embodiments, the side chain portion of the R ^d subunit is independently guanidyl (HN=C(NH ₂ )NH-), amidinyl (HN=C(NH ₂ )C<), 2-aminodihydroxy Pyrimidyl, 2-aminotetrahydroxypyrimidyl, 2-aminopyridinyl and 2-amino pyrimidinyl.

Multiple carrier peptides can be attached to a single compound as needed, alternatively, multiple compounds can be conjugated to a single transporter. The linker between the carrier peptide and the nucleic acid analog may also be composed of natural or unnatural amino acids (eg, 6-aminohexanoic acid or β-alanine). Such linkers can also be formed between the amine or hydroxy group of the nucleic acid analog (e.g. in 3'morpholino nitrogen or 5'OH) formed by condensation promoted, for example by carbodiimide, and the carboxy terminus of the transporter peptide It may include direct bonding.

In general, the linker may contain any non-reactive moiety that does not interfere with the transport or function of the conjugate. The linker may be selected from those that are not cleaved under normal use conditions, for example containing ether, thioether, amide, or carbamate linkages. In other embodiments, it may be desirable to include a linkage between a carrier peptide that can be cleaved in vivo and a compound (eg, oligonucleotide analogue, pharmacological agent, etc.). Linkages that can be cleaved in vivo are known in the art and also include, for example, enzymatically hydrolyzed carboxylic acid esters, and disulfides that are cleaved in the presence of glutathione. It may also be feasible to cleave photolytic cleavable bonds such as ortho-nitrophenyl ether in vivo by applying radiation of an appropriate wavelength. Exemplary heterobifunctional binders further comprising a cleavable disulfide group include N-hydroxysuccinimidyl 3-[(4-azidophenyl)dithio]propionate and Vanin, EF and Ji, TH, Biochemistry 20 :6754-6760 (1981).

C. Exemplary Carrier Peptide

A table of exemplary carrier peptide and oligonucleotide sequences is provided in Table 1 below. In some embodiments, the invention provides a peptide oligomer, wherein the peptide comprises or consists of any one of the peptide sequences in Table 1. In another embodiment, the nucleic acid analog comprises or consists of any of the oligonucleotides in Table 1f. In yet another embodiment, the invention provides a peptide oligomer, wherein the peptide comprises or consists of any of the peptide sequences in Table 1, and the nucleic acid comprises or consists of any of the oligonucleotides in Table 1 Consists of In another embodiment, the invention provides a peptide comprising or consisting of any one of the sequences in Table 1.

Table 1. Exemplary carrier peptide and oligonucleotide sequences

aa = glycine or proline; B = β-alanine; X = 6-aminohexanoic acid; tg = unmodified amino terminus, or amino terminus capped with an acetyl, benzoyl or stearoyl group (i.e. acetyl amide, benzoyl amide or stearoyl amide) and Y ^b is of the formula -C(O)-(CHR ^e ) _n- NH-, where 2 to 7 and each R ^e is independently hydrogen or methyl at each occurrence. Briefly, not all sequences are noted with the terminal tg group. However, each of the above sequences may comprise an unmodified amino terminus or an amino terminus capped with an acetyl, benzoyl or stearoyl group.

III. Antisense oligomer

The nucleic acid analogs included in the conjugates of the present invention are substantially uncharged synthetic oligomers, such as antisense oligonucleotide analogs, capable of base-specific binding to the target sequence of the polynucleotide. Such analogs include, for example, methylphosphonates, peptide nucleic acids, substantially uncharged N3'→5' phosphoramidates and morpholino oligomers.

The base sequence of the nucleic acid analog provided as a base pair supported by the analog backbone is A, T, C, G and U bases or non-stranded inosine (I) and 7-deaza- It can be any sequence including a G base.

In some embodiments, the nucleic acid analog is a morpholino oligomer, i.e. an oligonucleotide analog composed of morpholino subunits of the form shown in FIG. 1, wherein (i) the structure is one on the 5′ exocyclic carbon of the adjacent subunit. The subunits of the morpholino nitrogen are linked together by phosphorus-containing bonds of 1 to 3 atoms in length, preferably 2 atoms in length, and (ii) Pi and Pj are attached to base-specific hydrogen bonds. Thus, it is a purine or pyrimidine base pair moiety that is effective for linking to a base in a polynucleotide. The purine or pyrimidine base pair moiety is typically adenyl, cytosine, guanine, uracil or thymine. The synthesis, structure, and binding properties of morpholino oligomers are further described below and are also detailed in U.S. Patent Nos. 5,698,685, 5,217,866, 5,142,047, 5,034,506, 5,166,315, 5,521,063 and 5,506,337. Are described, all of which are incorporated herein by reference.

The preferred chemical properties of morpholino-based oligomers are the ability to selectively hybridize using complementary base target nucleic acids comprising target RNAs with high Tm, even short oligomers with 8-14 bases, mammals And the ability to actively transport intracellularly, and the ability of an oligomer:RNA heteroduplex to resist RNAse degradation.

In a preferred embodiment, the morpholino oligomer is about 8-10 subunits in length. More preferably, the oligomer is about 8-20, about 8-16, about 10-30, or about 12-25 subunits in length. For some applications, such as antimicrobial properties, it may be particularly advantageous when short oligomers, for example subunits of about 8-12 in length, are attached to the peptide transporter as described herein.

A. Oligomers with linkers between modified subunits

One embodiment of the present invention relates to a peptide-oligomeric conjugate comprising a nucleic acid analog (eg, a morpholino oligomer) comprising linkages between modified subunits. In some embodiments, the conjugate has a higher affinity for DNA and RNA than for the corresponding unmodified oligomer, and also has improved cell delivery, efficacy, and/or tissue distribution properties compared to oligomers with other intersubunit binding. Prove it. In one embodiment, the conjugate comprises a linkage between one or more subunits of type (A) as defined below. In another embodiment, the conjugate comprises a linkage between one or more subunits of type (B) as defined below. In yet other embodiments, the conjugates comprise linkages between subunits of type (A) and type (B) as described in more detail below. In yet another embodiment, the conjugate comprises a morpholino oligomer as detailed below. The structural features and properties of the various bond types and oligomers are described in more detail in the following discussion.

1.Combination (A)

Applicants have found that the increase in antisense activity, biodispersity and/or other desirable properties can be optimized by preparing oligomers with various small molecule bonds. For example, the oligomer optionally comprises one or more type (A) small molecule intermolecular bonds, and in certain embodiments the oligomer comprises at least one type (A) bond, e.g., each bond It can be of type (A). In some embodiments, each type (A) bond has the same structure. Bonds of type (A) include the bonds described in shared US Pat. No. 7,943,762, which is incorporated herein by reference in its entirety. Bond (A) has the following formula (I) or a salt or isomer thereof, wherein 3'and 5'represent the points of attachment to the 3'and 5'of the morpholino ring, respectively (i.e. the formula ( I)):

In the above formula,

W is independently at each occurrence S or O;

X is in each case independently -N(CH ₃ ) ₂ , -NR ¹ R ² , -OR ³ or the following formula (II)

;

Y is at each occurrence independently O or -NR ² ;

R ¹ is at each occurrence independently hydrogen or methyl;

R ² is independently at each occurrence hydrogen or -LNR ⁴ R ⁵ R ⁷ ;

R ³ is independently at each occurrence hydrogen or C ₁ -C ₆ alkyl;

R ⁴ is independently at each occurrence hydrogen, methyl, -C(=NH)NH ₂ , -ZL-NHC(=NH)NH ₂ or -[C(=O)CHR'NH] _m H, where Z Is -C(=O)- or a direct bond, R'is a naturally occurring amino acid or a side chain of one or two carbon analogs thereof, and m is 1 to 6;

R ⁵ at each occurrence is independently hydrogen, methyl or an electron pair;

R ⁶ at each occurrence is independently hydrogen or methyl;

R ⁷ is independently at each occurrence hydrogen, C ₁ -C ₆ alkyl or C ₁ -C ₆ alkoxyalkyl;

L is an optional linker of up to 18 atoms in length comprising an alkyl, alkoxy or alkylamino group, or a combination thereof.

In some embodiments, the oligomer comprises at least one type (A) linkage. In some other embodiments, the oligomer comprises at least two consecutive type (A) bonds. In a further embodiment, at least 5% of the bonds in the oligomer are of type (A); For example, in some embodiments, 5%-95%, 10% to 90%, 10% to 50%, or 10% to 35% of the binding may be of binding type (A). In some specific embodiments, at least one type (A) bond is -N(CH ₃ ) ₂ , and in still other embodiments each bond in the oligomer is -N(CH ₃ ) ₂ . In another embodiment, at least one type (A) linkage is piperizin-1-yl, eg, unsubstituted piperazin-1-yl (eg, A2 or A3). In another embodiment, each type (A) bond is piperizin-1-yl, for example unsubstituted piperazin-1-yl.

In some embodiments, W is independently S or O at each occurrence, and in certain embodiments W is O.

In some embodiments, X is independently at each occurrence -N(CH ₃ ) ₂ , -NR ¹ R ² , -OR ³ . In some embodiments, X is -N(CH ₃ ) ₂ . In another aspect X is -NR ¹ R ² , and in another embodiment X is -OR ³ .

In some embodiments, R ¹ is independently hydrogen or methyl at each occurrence. In some embodiments, R ¹ is hydrogen. In other embodiments X is methyl.

In some embodiments, R ² is independently hydrogen at each occurrence. In other embodiments, R ² is in each case -LNR ⁴ R ⁵ R ⁷ . In some embodiments, R ³ is independently at each occurrence hydrogen or C ₁ -C ₆ alkyl. In other embodiments, R ³ is methyl. In yet other embodiments, R ³ is ethyl. In some other embodiments, R ³ is n-propyl or isopropyl. In some other embodiments, R ³ is C ₄ alkyl. In other embodiments, R ³ is C ₅ alkyl. In some embodiments R ³ is C ₆ alkyl.

In certain embodiments, R ⁴ is independently hydrogen at each occurrence. In other embodiments, R ⁴ is methyl. In yet other embodiments, R ⁴ is -C(=NH)NH ₂ , and in still other embodiments R ⁴ is -ZL-NHC(=NH)NH ₂ . In yet other embodiments, R ⁴ is -[C(=O)CHR'NH] _m H. Z is -C(=O)- in one embodiment and Z is a direct bond in another embodiment. R'is a side chain of a naturally occurring amino acid. In some embodiments, R'is one or two carbon analogs of the side chain of a naturally occurring amino acid.

m is an integer from 1 to 6. m may be 1. m may be 2. m may be 3. m can be 4. m can be 5. m may be 6.

In some embodiments, R ⁵ is independently hydrogen, methyl, or an electron pair at each occurrence. In some embodiments, R ⁵ is hydrogen. In other embodiments, R ⁵ is methyl. In yet other embodiments, R ⁵ is an electron pair.

In some embodiments, R ⁶ is independently hydrogen or methyl at each occurrence. In some embodiments, R ⁶ is hydrogen. In other embodiments, R ⁶ is methyl.

In other embodiments, R ⁷ is independently at each occurrence hydrogen C ₁ -C ₆ alkyl or C ₂ -C ₆ alkoxyalkyl. In some embodiments, R ⁷ is hydrogen. In other embodiments, R ⁷ is C ₁ -C ₆ alkyl. In yet other embodiments, R ⁷ is C ₂ -C ₆ alkoxyalkyl. In some embodiments, R ⁷ is methyl. In other embodiments, R ⁷ is ethyl. In yet other embodiments, R ⁷ is n-propyl or isopropyl. In some other embodiments, R ⁷ is C ₄ alkyl. In some embodiments, R ⁷ is C ₅ alkyl. In some embodiments, R ⁷ is C ₆ alkyl. In yet other embodiments, R ⁷ is C ₂ alkoxyalkyl. In some other embodiments, R ⁷ is C ₃ alkoxyalkyl. In yet other embodiments, R ⁷ is C ₄ alkoxyalkyl. In some embodiments, R ⁷ is C ₅ alkoxyalkyl. In other embodiments, R ⁷ is C ₆ alkoxyalkyl.

Linker group L as pointed out above has a bond in its skeleton selected from alkyl (e.g. -CH ₂ -CH ₂ -), alkoxy (e.g. -COC-), and alkylamino (e.g. -CH ₂ -NH-) With the proviso that the terminal atom in L (eg, those adjacent to carbonyl or nitrogen) is a carbon atom. Although branched bonds (eg -CH ₂ -CHCH ₃ -) are possible, the linker is generally not branched. In one embodiment, the linker is a hydrocarbon linker. Such linkers may have the formula (CH ₂ ) _n -, where n is 1 to 12, preferably 2 to 8, and more preferably 2 to 6.

Oligomers having any number of bond types (A) are provided. In some embodiments, the oligomer does not contain a linkage of type (A). In certain embodiments, 5, 10, 20, 30, 40, 50, 60, 70, 80 or 90 percent of the bonds are bonds (A). In selected embodiments, 10 to 80, 20 to 80, 20 to 60, 20 to 50, 20 to 40, or 20 to 35 percent of the bonds are bonds (A). In yet other embodiments, each bond is of type (A).

2. Combined (B)

In some embodiments, the oligomer comprises at least one type (A) linkage. For example, the oligomer may contain 1, 2, 3, 4, 5, 6 or more type (B) bonds. Type (B) bonds may be contiguous or may be disposed through oligomers. Bond type (B) has the following formula (I) or a salt or isomer thereof:

In the above formula,

W is independently at each occurrence S or O;

X is at each occurrence independently -NR ⁸ R ⁹ or -OR ³ ; In addition

Y is at each occurrence independently O or -NR ¹⁰ ,

R ³ is independently at each occurrence hydrogen or C ₁ -C ₆ alkyl;

R ⁸ is independently at each occurrence hydrogen or C ₂ -C ₁₂ alkyl;

R ⁹ is independently at each occurrence hydrogen, C ₁ -C ₁₂ alkyl, C ₁ -C ₁₂ aralkyl or aryl;

R ¹⁰ is at each occurrence independently hydrogen, C ₁ -C ₁₂ alkyl or -LNR ⁴ R ⁵ R ⁷ ;

Wherein R ⁸ and R ⁹ may be combined to form a 5 to 18 membered mono or bicyclic heterocycle or R ⁸ , R ⁹ or R ³ May be combined with R ¹⁰ to form a 5 to 7 membered heterocycle, furthermore X is 4-piperazino and X has the following formula (III):

In the above formula,

R ¹¹ is independently at each occurrence C ₂ -C ₁₂ alkyl, C ₁ -C ₁₂ aminoalkyl, C ₁ -C ₁₂ alkylcarbonyl, aryl, heteroaryl or heterocyclyl;

R is at each occurrence independently an electron pair, hydrogen or C ₁ -C ₁₂ alkyl; In addition

R ¹² is independently at each occurrence of hydrogen, C ₁ -C ₁₂ alkyl, C ₁ -C ₁₂ aminoalkyl, -NH ₂ , -CONH ₂ , -NR ¹³ R ¹⁴ , -NR ¹³ R ¹⁴ R ¹⁵ , C ₁ -C ₁₂ alkylcarbonyl, oxo, -CN, trifluoromethyl, amidyl, amidinyl, amidinylalkyl, amidinylalkylcarbonyl guanidineyl, guanidinylalkyl, guanidineylalkylcarbonyl , Cholate, deoxycholate, aryl, heteroaryl, heterocycle, -SR ¹³ or C ₁ -C ₁₂ alkoxy, and R ¹³ , R ¹⁴ and R ¹⁵ are at each occurrence independently C ₁ -C ₁₂ alkyl.

In some examples, the oligomer contains one bond of type (B). In some other embodiments, the oligomer comprises two bonds of type (B). In some other embodiments, the oligomer comprises three bonds of type (B). In some other embodiments, the oligomer comprises a bond of type (B). In yet other embodiments, the combination of type (B) is contiguous (ie, the combination of type (B) is adjacent to each other). In a further embodiment, at least 5% of the bonds in the oligomer are of type (B). For example, in some embodiments, 5% to 95%, 10% to 90%, 10% to 50%, or 10% to 35% of the bonds may be of the bond type (B).

In other embodiments, R ³ at each occurrence is independently hydrogen or C ₁ -C ₆ alkyl. In yet other embodiments, R ³ can be methyl. In some embodiments, R ³ can be ethyl. In some other embodiments, R ³ can be n-propyl or isopropyl. In yet other embodiments, R ³ can be C ₄ alkyl. In some embodiments, R ³ can be a C ₅ alkyl. In some embodiments, R ³ can be a C ₆ alkyl.

In some embodiments, R ⁸ at each occurrence is independently hydrogen or C ₂ -C ₁₂ alkyl. In some embodiments, R ⁸ is hydrogen. In yet other embodiments, R ⁸ is ethyl. In some other embodiments, R ⁸ is n-propyl or isopropyl. In some embodiments, R ⁸ is C ₄ alkyl. In yet other embodiments, R ⁸ is C ₅ alkyl. In other embodiments, R ⁸ is C ₆ alkyl. In some embodiments, R ⁸ is C ₇ alkyl. In yet other embodiments, R ⁸ is C ₈ alkyl. In other embodiments, R ⁸ is C ₉ alkyl. In yet other embodiments, R ⁸ is C ₁₀ alkyl. In some embodiments, R ⁸ is C ₁₁ alkyl. In yet other embodiments, R ⁸ is C ₁₂ alkyl. In some other embodiments R ⁸ is C ₂ -C ₁₂ alkyl and also the C ₂ -C ₁₂ alkyl comprises one or more double bonds (eg, alkene), triple bonds (eg, alkyne), or both. In some embodiments, R ⁸ is unsubstituted C ₂ -C ₁₂ alkyl.

In some embodiments, R ⁹ is independently at each occurrence hydrogen, C ₁ -C ₁₂ alkyl, C ₁ -C ₁₂ aralkyl, or aryl. In some embodiments, R ⁹ is hydrogen. In yet other embodiments, R ⁹ is C ₁ -C ₁₂ alkyl. In other embodiments, R ⁹ is methyl. In yet other embodiments, R ⁹ is ethyl. In some embodiments, R ⁹ is n-propyl or isopropyl. In some embodiments, R ⁹ is C ₄ alkyl. In some embodiments, R ⁹ is C ₅ alkyl. In yet other embodiments, R ⁹ is C ₆ alkyl. In some embodiments, R ⁹ is C ₇ alkyl. In some embodiments, R ⁹ is C ₈ alkyl. In some embodiments, R ⁹ is C ₉ alkyl. In some embodiments, R ⁹ is C ₁₀ alkyl. In some embodiments, R ⁹ is C ₁₁ alkyl. In yet other embodiments, R ⁹ is C ₁₂ alkyl.

In some other embodiments, R ⁹ is C ₁ -C ₁₂ aralkyl. For example, in some embodiments R ⁹ is benzyl and the benzyl can be optionally substituted on a phenyl ring or benzyl carbon. Substituents in this context include alkyl and alkoxy groups, for example methyl or methoxy. In some embodiments, the benzyl group is substituted with methyl on the benzyl carbon. For example, in some embodiments, R ⁹ has the following formula (XIV):

In other embodiments, R ⁹ is aryl. For example, in some embodiments R ⁹ is phenyl, and the phenyl can be optionally substituted. Substituents in this context include alkyl and alkoxy groups, for example methyl or methoxy. In other embodiments, R ⁹ is phenyl and the phenyl comprises a crown ether moiety, such as a 12-18 membered crown ether. In one embodiment the crown ether is 18 members and may further contain an additional phenyl moiety. For example in one embodiment R ⁹ has one of the following formulas (XV) or (XVI):

또는

or

In some embodiments, R ¹⁰ is independently at each occurrence hydrogen, C ₁ -C ₁₂ alkyl or -LNR ⁴ R ⁵ R ⁷ , wherein R ⁴ , R ⁵ and R ⁷ are defined above for bond (A) As it is. In other embodiments, R ¹⁰ is hydrogen. In other embodiments, R ¹⁰ is C ₁ -C ₁₂ alkyl, and in other embodiments R ¹⁰ is -LNR ⁴ R ⁵ R ⁷ . In some embodiments, R ¹⁰ is methyl. In yet other embodiments, R ¹⁰ is ethyl. In some embodiments, R ¹⁰ is C ₃ alkyl. In some embodiments, R ¹⁰ is C ₄ alkyl. In yet other embodiments, R ¹⁰ is C ₅ alkyl. In some other embodiments, R ¹⁰ is C ₆ alkyl. In other embodiments R ¹⁰ is C ₇ alkyl. In yet other embodiments, R ¹⁰ is C ₈ alkyl. In some embodiments, R ¹⁰ is C ₉ alkyl. In other embodiments, R ¹⁰ is C ₁₀ alkyl. In yet other embodiments, R ¹⁰ is C ₁₁ alkyl. In some other embodiments, R ¹⁰ is C ₁₂ alkyl.

In some embodiments, R ⁸ and R ⁹ combine to form a 5-18 membered mono or bicyclic heterocycle. In some embodiments the heterocycle is a 5 or 6 membered monocyclic heterocycle. For example, in some embodiments, bond (B) has formula (IV):

In the above formula,

Z represents a 5 or 6 membered monocyclic heterocycle.

In other embodiments, the heterocycle is a bicyclic, eg, 12-membered bicyclic heterocycle. The heterocycle may be piperizinyl. The heterocycle may be a morpholino. The heterocycle may be piperidinyl. The heterocycle may be decahydroisoquinoline. Representative heterocycles include the following formula:

In some embodiments, R ¹¹ is independently at each occurrence C ₂ -C ₁₂ alkyll, C ₁ -C ₁₂ aminoalkyl, aryl, heteroaryl, or heterocyclyl.

In some embodiments, R ¹¹ is C ₂ -C ₁₂ alkyl. In some embodiments, R ¹¹ is ethyl. In other embodiments, R ¹¹ is C ₃ alkyl. In yet other embodiments, R ¹¹ is isopropyl. In some other embodiments, R ¹¹ is C ₄ alkyl. In other embodiments, R ¹¹ is C ₅ alkyl. In some embodiments, R ¹¹ is C ₆ alkyl. In other embodiments, R ¹¹ is C ₇ alkyl. In some embodiments, R ¹¹ is C ₈ alkyl. In other embodiments, R ¹¹ is C ₉ alkyl. In yet other embodiments, R ¹¹ is C ₁₀ alkyl. In some other embodiments, R ¹¹ is C ₁₁ alkyl. In some embodiments, R ¹¹ is C ₁₂ alkyl.

In other embodiments, R ¹¹ is C ₁ -C ₁₂ aminoalkyl. In some embodiments, R ¹¹ is methylamino. In some embodiments, R ¹¹ is ethylamino. In other embodiments, R ¹¹ is C ₃ aminoalkyl. In yet other embodiments, R ¹¹ is C ₄ aminoalkyl. In some other embodiments, R ¹¹ is C ₅ aminoalkyl. In other embodiments, R ¹¹ is C ₆ aminoalkyl. In yet other embodiments, R ¹¹ is C ₇ aminoalkyl. In some embodiments, R ¹¹ is C ₈ aminoalkyl. In other embodiments, R ¹¹ is C ₉ aminoalkyl. In yet other embodiments, R ¹¹ is C ₁₀ aminoalkyl. In some other embodiments, R ¹¹ is C ₁₁ aminoalkyl. In other embodiments R ¹¹ is C ₁₂ aminoalkyl.

In other embodiments, R ¹¹ is C ₁ -C ₁₂ alkylcarbonyl. In yet other embodiments, R ¹¹ is C ₁ alkylcarbonyl. In other embodiments, R ¹¹ is C ₂ alkylcarbonyl. In some embodiments, R ¹¹ is C ₃ alkylcarbonyl. In yet other embodiments, R ¹¹ is C ₄ alkylcarbonyl. In some embodiments, R ¹¹ is C ₅ alkylcarbonyl. In some embodiments, R ¹¹ is C ₆ alkylcarbonyl. In other embodiments, R ¹¹ is C ₇ alkylcarbonyl. In yet other embodiments, R ¹¹ is C ₈ alkylcarbonyl. In some embodiments, R ¹¹ is C ₉ alkylcarbonyl. In yet other embodiments, R ¹¹ is C ₁₀ alkylcarbonyl. In some other embodiments, R ¹¹ is C ₁₁ alkylcarbonyl. In some embodiments, R ¹¹ is C ₁₂ alkylcarbonyl. In yet other embodiments, R ¹¹ is -C(=O)(CH ₂ ) _n CO ₂ H, where n is 1-6. For example, in some embodiments, n is 1. In other embodiments n is 2. In yet other embodiments, n is 3. In some other embodiments, n is 4. In yet other embodiments, n is 5. In other embodiments, n is 6.

In other embodiments, R ¹¹ is aryl. For example, in some embodiments, R ¹¹ is phenyl. In some embodiments, the phenyl is substituted with a nitro group, for example.

In other embodiments, R ¹¹ is heteroaryl. For example, in some embodiments, R ¹¹ is pyridinyl. In other embodiments, R ¹¹ is pyrimidinyl.

In other embodiments, R ¹¹ is heterocyclyl. For example, in some embodiments, R ¹¹ is piperidinyl, for example piperidin-4-yl.

In some embodiments, R ¹¹ is ethyl, isopropyl, piperidinyl, pyrimidinyl, cholate, deoxycholate, or -C(=O)(CH ₂ ) _n CO ₂ H, where n is 1-6 to be.

In some embodiments, R is an electron pair. In other embodiments, R is hydrogen and in embodiments R is C ₁ -C ₁₂ alkyl. In some embodiments, R is methyl. In some embodiments, R is ethyl. In other embodiments, R is C ₃ alkyl. In yet other embodiments, R is isopropyl. In some other embodiments, R is C ₄ alkyl. In yet other embodiments, R is C ₅ alkyl. In some embodiments, R is C ₆ alkyl. In other embodiments, R is C ₇ alkyl. In yet other embodiments, R is C ₈ alkyl. In other embodiments, R is C ₉ alkyl. In some embodiments, R is C ₁₀ alkyl. In yet other embodiments, R is C ₁₁ alkyl. In some embodiments, R is C ₁₂ alkyl.

In some embodiments, R ¹² is independently at each occurrence hydrogen, C ₁ -C ₁₂ alkyl, C ₁ -C ₁₂ aminoalkyl, -NH ₂ , -CONH ₂ ,-NR ¹³ R ¹⁴ , -NR ¹³ R ¹⁴ R ¹⁵ , oxo, -CN, trifluoromethyl, amidyl, amidinyl, amidinylalkyl, amidinylalkylcarbonyl guanidineyl, guanidinylalkyl, guanidineylalkylcarbonyl, cholate, de Oxycholate, aryl, heteroaryl, heterocycle, -SR ¹³ or C ₁ -C ₁₂ alkoxy, wherein R ¹³ , R ¹⁴ and R ¹⁵ independently at each occurrence include C ₁ -C ₁₂ alkyl.

In some embodiments, R ¹² is hydrogen. In some embodiments, R ¹² is C ₁ -C ₁₂ alkyl. In some embodiments, R ¹² is C ₁ -C ₁₂ aminoalkyl. In some embodiments, R ¹² is -NH ₂ . In some embodiments, R ¹² is -CONH ₂ . In some embodiments, R ¹² is -NR ¹³ R ¹⁴ . In some embodiments, R ¹² is -NR ¹³ R ¹⁴ R ¹⁵ . In some embodiments, R ¹² is C ₁ -C ₁₂ alkylcarbonyl. In some embodiments, R ¹² is oxo. In some embodiments, R ¹² is -CN. In some embodiments, R ¹² is trifluoromethyl. In some embodiments, R ¹² is amidyl. In some embodiments, R ¹² is amidinyl. In some embodiments, R ¹² is amidinylalkyl. In some embodiments, R ¹² is amidinylalkylcarbonyl. In some embodiments, R ¹² is guanidineyl, such as mono methylguanidineyl or dimethylguanidineyl. In some embodiments, R ¹² is guanidinylalkyl. In some embodiments, R ¹² is amidinylalkylcarbonyl. In some embodiments, R ¹² is cholate. In some embodiments, R ¹² is deoxycholate. In some embodiments, R ¹² is aryl. In some embodiments, R ¹² is heteroaryl. In some embodiments, R ¹² is a heterocycle. In some embodiments, R ¹² is -SR ¹³ . In some embodiments, R ¹² is C ₁ -C ₁₂ alkoxy. In some embodiments, R ¹² is dimethyl amine.

In other embodiments, R ¹² is methyl. In yet other embodiments, R ¹² is ethyl. In some embodiments, R ¹² is C ₃ alkyl. In some embodiments, R ¹² is isopropyl. In some embodiments, R ¹² is C ₄ alkyl. In other embodiments, R ¹² is C ₅ alkyl. In yet other embodiments, R ¹² is C ₆ alkyl. In some other embodiments, R ¹² is C ₇ alkyl. In some embodiments, R ¹² is C ₈ alkyl. In yet other embodiments, R ¹² is C ₉ alkyl. In some embodiments, R ¹² is C ₁₀ alkyl. In yet other embodiments, R ¹² is C ₁₁ alkyl. In other embodiments, R ¹² is C ₁₂ alkyl. In yet other embodiments, the alkyl moiety is substituted with one or more oxygens to form an ether moiety, such as a methoxymethyl moiety.

In some embodiments, R ¹² is methylamino. In other embodiments, R ¹² is ethylamino. In yet other embodiments, R ¹² is C ₃ aminoalkyl. In some embodiments, R ¹² is C ₄ aminoalkyl. In yet other embodiments, R ¹² is C ₅ aminoalkyl. In some embodiments, R ¹² is C ₆ aminoalkyl. In some embodiments, R ¹² is C ₇ aminoalkyl. In some embodiments, R ¹² is C ₈ aminoalkyl. In yet other embodiments, R ¹² is C ₉ aminoalkyl. In some other embodiments, R ¹² is C ₁₀ aminoalkyl. In yet other embodiments, R ¹² is C ₁₁ aminoalkyl. In other embodiments, R ¹² is C ₁₂ aminoalkyl. In some embodiments, the aminoalkyl is dimethylamino alkyl.

In yet other embodiments, R ¹² is acetyl. In some other embodiments, R ¹² is C ₂ alkylcarbonyl. In some embodiments, R ¹² is C ₃ alkylcarbonyl. In yet other embodiments, R ¹² is C ₄ alkylcarbonyl. In some embodiments, R ¹² is C ₅ alkylcarbonyl. In yet other embodiments, R ¹² is C ₆ alkylcarbonyl. In some other embodiments, R ¹² is C ₇ alkylcarbonyl. In some embodiments, R ¹² is C ₈ alkylcarbonyl. In yet other embodiments, R ¹² is C ₉ alkylcarbonyl. In some other embodiments, R ¹² is C ₁₀ alkylcarbonyl. In some embodiments, R ¹² is C ₁₁ alkylcarbonyl. In other embodiments, R ¹² is C ₁₂ alkylcarbonyl. The alkylcarbonyl is substituted with a carboxy moiety, for example the alkylcarbonyl is substituted to form a succinic acid moiety (i.e. 3-carboxyalkylcarbonyl). In another embodiment, the alkylcarbonyl is terminal -SH Is substituted with a group.

In some embodiments, R ¹² is amidyl. In some embodiments, the amidyl comprises an alkyl moiety, carbamate, or a combination thereof further substituted with, for example -SH. In another embodiment, the amidyl is substituted with an aryl moiety, such as phenyl. In certain embodiments, R ¹² can have formula (IX):

In the above formula, R ¹⁶ is independently at each occurrence hydrogen, C ₁ -C ₁₂ alkyl, C ₁ -C ₁₂ alkoxy, -CN, aryl or heteroaryl.

In some embodiments, R ¹² is methoxy. In other embodiments, R ¹² is ethoxy. In yet other embodiments, R ¹² is C ₃ alkoxy. In some embodiments, R ¹² is C ₄ alkoxy. In some embodiments, R ¹² is C ₅ alkoxy. In some other embodiments, R ¹² is C ₆ alkoxy. In other embodiments, R ¹² is C ₇ alkoxy. In some other embodiments, R ¹² is C ₈ alkoxy. In some embodiments, R ¹² is C ₉ alkoxy. In other embodiments, R ¹² is C ₁₀ alkoxy. In some embodiments, R ¹² is C ₁₁ alkoxy. In yet other embodiments, R ¹² is C ₁₂ alkoxy.

In certain embodiments, R ¹² is pyrrolidinyl, for example pyrrolidin-1-yl. In other embodiments, R ¹² is piperidinyl, for example piperidin-1-yl or piperidin-4-yl. In another embodiment, R ¹² is morpholino, for example morpholin-4-yl. In other embodiments, R ¹² is phenyl, and in further embodiments, the phenyl is substituted with, for example, a nitro group. In yet other embodiments, R ¹² is pyrimidinyl, for example pyrimidin-2-yl.

In other embodiments, R ¹³ , R ¹⁴ and R ¹⁵ are independently at each occurrence C ₁ -C ₁₂ alkyl. In some embodiments, R ¹³ , R ¹⁴ or R ¹⁵ is methyl. In yet other embodiments, R ¹³ , R ¹⁴ or R ¹⁵ is ethyl. In other embodiments, R ¹³ , R ¹⁴ or R ¹⁵ is C ₃ alkyl. In yet other embodiments, R ¹³ , R ¹⁴ or R ¹⁵ is isopropyl. In other embodiments, R ¹³ , R ¹⁴ or R ¹⁵ is C ₄ alkyl. In some embodiments, R ¹³ , R ¹⁴ or R ¹⁵ is C ₅ alkyl. In some embodiments, R ¹³ , R ¹⁴ or R ¹⁵ is C ₆ alkyl. In other embodiments, R ¹³ , R ¹⁴ or R ¹⁵ is C ₇ alkyl. In yet other embodiments, R ¹³ , R ¹⁴ or R ¹⁵ is C ₈ alkyl. In other embodiments, R ¹³ , R ¹⁴ or R ¹⁵ is C ₉ alkyl. In some embodiments, R ¹³ , R ¹⁴ or R ¹⁵ is C ₁₀ alkyl. In some embodiments R ¹³ , R ¹⁴ or R ¹⁵ is C ₁₁ alkyl. In yet other embodiments, R ¹³ , R ¹⁴ or R ¹⁵ is C ₁₂ alkyl.

As pointed out above, in some embodiments, R ¹² is amidyl substituted with an aryl moiety. In this regard, each instance of R ¹⁶ may be the same or different. In certain of these embodiments, R ¹⁶ is hydrogen. In other embodiments, R ¹⁶ is -CN. In other embodiments, R ¹⁶ is heteroaryl, such as tretrazolyl. In certain other embodiments, R ¹⁶ is methoxy. In other embodiments, R ¹⁶ is aryl, and the aryl is optionally substituted. Optional substitutions in this regard include C ₁ -C ₁₂ alkyl, C ₁ -C ₁₂ alkoxy, for example methoxy; Trifluoromethoxy; Halo, such as chloro; And trifluoromethyl.

In other embodiments, R ¹⁶ is methyl. In yet other embodiments, R ¹⁶ is ethyl. In some embodiments, R ¹⁶ is C ₃ alkyl. In some other embodiments, R ¹⁶ is isopropyl. In yet other embodiments, R ¹⁶ is C ₄ alkyl. In other embodiments, R ¹⁶ is C ₅ alkyl. In some embodiments, R ¹⁶ is C ₆ alkyl. In some embodiments, R ¹⁶ is C ₇ alkyl. In some embodiments, R ¹⁶ is C ₈ alkyl. In yet other embodiments, R ¹⁶ is C ₉ alkyl. In some embodiments, R ¹⁶ is C ₁₀ alkyl. In other embodiments, R ¹⁶ is C ₁₁ alkyl. In some embodiments, R ¹⁶ is C ₁₂ alkyl.

In some embodiments, R ¹⁶ is methoxy. In some embodiments, R ¹⁶ is ethoxy. In yet other embodiments, R ¹⁶ is C ₃ alkoxy. In some embodiments, R ¹⁶ is C ₄ alkoxy. In other embodiments, R ¹⁶ is C ₅ alkoxy. In some other embodiments, R ¹⁶ is C ₆ alkoxy. In yet other embodiments, R ¹⁶ is C ₇ alkoxy. In some embodiments, R ¹⁶ is C ₈ alkoxy. In yet other embodiments, R ¹⁶ is C ₉ alkoxy. In some other embodiments, R ¹⁶ is C ₁₀ alkoxy. In some embodiments, R ¹⁶ is C ₁₁ alkoxy. In some other embodiments, R ¹⁶ is C ₁₂ alkoxy.

In some other embodiments, R ⁸ and R ⁹ combine to form a 12-18 membered crown ether. For example, in some embodiments, the crown ether is 18 members, and in other embodiments the crown ether is 15 members. In certain embodiments R ⁸ and R ⁹ combine to form a heterocycle having one of the following formula (X) or (XI).

또는

or

In some embodiments, R ⁸ , R ⁹ or R ³ combines with R ¹⁰ to form a 5-7 membered heterocycle. For example, in some embodiments, R ³ combines with R ¹⁰ to form a 5-7 membered heterocycle. In some embodiments, the heterocycle is 5-membered. In another embodiment, the heterocycle is 7-membered. In some embodiments, the heterocycle is represented by Formula (XII):

In the above formula, Z'represents a 5-7 membered heterocycle. In certain embodiments of Formula (XI), R ¹² is hydrogen at each occurrence. For example, the bond (B) can have one of the following formulas (B1), (B2) or (B3):

또는

or

In certain other embodiments, R ¹² is C ₁ -C ₁₂ alkylcarbonyl or amidyl, which is further substituted with an arylphosphoryl moiety, such as a triphenyl phosphoryl moiety. Examples of bonds having this structure include B56 and B55.

In certain embodiments, bond (B) does not have any of structural formulas A1-A5. Table 2 shows representative combinations of types (A) and (B).

Table 2. Representative subunit bonds

In subsequent sequencing and reviews, this designation for binding is often used. For example, a base comprising a PMO ^apn bond is exemplified as ^apn B, where B is a base. Other combinations are marked similarly. In addition, an abbreviation mark may be used, for example, an abbreviation mark in parentheses above may be used (for example, ^a B represents ^apn B). Other readily identifiable abbreviations can also be used.

B. Oligomers with modified end groups

In addition to the carrier peptide, the conjugate may also comprise oligomers comprising modified end groups. Applicants have found that modification of the 3'and/or 5'end of oligomers with various chemical moieties provides beneficial therapeutic properties to the conjugate (e.g., increased cellular delivery, efficacy and/or distribution in tissues, etc.). . In various embodiments, the modified end group comprises a hydrophobic moiety, while in other embodiments the modified end group comprises a hydrophilic group. Modified end groups may be present with or without the aforementioned bonds. For example, in some embodiments, the oligomer to which the carrier peptide is conjugated comprises one or more modified end groups and a type (A) bond, such as a bond where X is -N(CH ₃ ) ₂ . In another embodiment, the oligomer comprises one or more modified end groups and a type (B) linkage, for example a linkage wherein X is 4-aminopiperidin-1-yl (ie, APN). In yet other embodiments, the oligomer comprises a mixture of one or more modified end groups and bonds (A) and (B). For example, the oligomer is one or more modified end groups (e.g., trityl or triphenyl acetyl) and a bond in which X is -N(CH ₃ ) _{2 and} a bond in which X is 4-aminopiperidin-1-yl It may include. Other combinations of modified end groups and modified bonds also provide beneficial therapeutic properties to the oligomer.

In one embodiment, the oligomer comprising a terminal modification has the formula (XVII) or a salt or isomer thereof:

In the above formula,

X, W and Y are as defined above for any of the bonds (A) and (B);

R ¹⁷ is independently absent at each occurrence or is hydrogen or C ₁ -C ₆ alkyl;

R ¹⁸ and R ¹⁹ are independently absent at each occurrence or are hydrogen, a carrier peptide, a natural or unnatural amino acid, a C ₂ -C ₃₀ alkylcarbonyl, -C(=O)OR ²¹ or R ²⁰ ;

R ²⁰ is at each occurrence independently of guanidineyl, heterocyclyl, C ₁ -C ₃₀ alkyl, C ₃ -C ₈ cycloalkyl; C ₆ -C ₃₀ aryl, C ₇ -C ₃₀ aralkyl, C ₃ -C ₃₀ alkylcarbonyl, C ₃ -C ₈ cycloalkylcarbonyl, C ₃ -C ₈ cycloalkylalkylcarbonyl, C ₇ -C ₃₀ Arylcarbonyl, C ₇ -C ₃₀ aralkylcarbonyl, C ₂ -C ₃₀ alkyloxycarbonyl, C ₃ -C ₈ cycloalkyloxycarbonyl, C ₇ -C ₃₀ aryloxycarbonyl, C ₈ -C ₃₀ Aralkyloxycarbonyl, or -P(=O)(R ²² ) ₂ ;

Pi is at each occurrence independently a base pair moiety;

L ¹ is selected from alkyl, hydroxyl, alkoxy, alkylamino, amide, ester, disulfide, carbonyl, carbamate, phosphorodiamidate, phosphoroamidate, phosphorothioate, piperazine and phosphodiester. Is an optional linker of up to 18 atoms in length including bonds; In addition

x is an integer of 0 or more; Also here at least one of R ¹⁸ or R ¹⁹ is R ²⁰ ; In addition

Wherein at least one of R ¹⁸ or R ¹⁹ is R ²⁰ , provided that both R ¹⁷ and R ¹⁸ are not present.

Oligomers with modified end groups may contain any number of bonds of type (A) and (B). For example, the oligomer may only contain a bond type (A). For example, in each bond, X may be -N(CH ₃ ) ₂ . Alternatively, the oligomer may only contain a bond (B). In certain embodiments, the oligomer comprises a mixture of bonds (A) and (B), for example 1 to 4 type (B) bonds and the remaining bonds are type (A). Bonds in this context include, but are not limited to, those where X is aminopiperidinyl for type (B) and dimethylamino for type (A).

In some embodiments, R ¹⁷ is absent. In some embodiments, R ¹⁷ is hydrogen. In some embodiments, R ¹⁷ is C ₁ -C ₆ alkyl. In some embodiments, R ¹⁷ is methyl. In yet other embodiments, R ¹⁷ is ethyl. In some embodiments, R ¹⁷ is C ₃ alkyl. In some embodiments, R ¹⁷ is isopropyl. In other embodiments, R ¹⁷ is C ₄ alkyl. In yet other embodiments, R ¹⁷ is C ₅ alkyl. In some other embodiments, R ¹⁷ is C ₆ alkyl.

In other embodiments, R ¹⁸ is absent. In some embodiments, R ¹⁸ is hydrogen. In some embodiments, R ¹⁸ is a carrier peptide. In some embodiments, R ¹⁸ is a natural or unnatural amino acid, such as trimethylglycine. In some embodiments, R ¹⁸ is R ²⁰ .

In other embodiments, R ¹⁹ is absent. In some embodiments, R ¹⁹ is hydrogen. In some embodiments, R ¹⁹ is a carrier peptide. In some embodiments, R ¹⁹ is a natural or unnatural amino acid, such as trimethylglycine. In some embodiments, R ¹⁹ is -C(=O)OR ¹⁷ , for example R ¹⁹ can have the following formula:

In another embodiment, R ¹⁸ or R ¹⁹ is C ₂ -C ₃₀ alkylcarbonyl, for example -C(=O)(CH ₂ ) _n CO ₂ H, where n is 1 to 6, for example 2 to be. In another example, R ¹⁸ or R ¹⁹ is acetyl.

In some embodiments, R ²⁰ is independently at each occurrence of guanidineyl, heterocyclyl, C ₁ -C ₃₀ alkyl, C ₃ -C ₈ cycloalkyl; C ₆ -C ₃₀ aryl, C ₇ -C ₃₀ aralkyl, C ₃ -C ₃₀ alkylcarbonyl, C ₃ -C ₈ cycloalkylcarbonyl, C ₃ -C ₈ cycloalkylalkylcarbonyl, C ₆ -C ₃₀ Arylcarbonyl, C ₇ -C ₃₀ aralkylcarbonyl, C ₂ -C ₃₀ alkyloxycarbonyl, C ₃ -C ₈ cycloalkyloxycarbonyl, C ₇ -C ₃₀ aryloxycarbonyl, C ₈ -C ₃₀ Aralkyloxycarbonyl, -C(=O)OR ²¹ , or -P(=O)(R ²² ) ₂ , wherein R ²¹ is C ₁ -C comprising one or more oxygen or hydroxyl moieties or combinations thereof ₃₀ alkyl, and each R ²² is C ⁶ -C ¹² aryloxy.

In certain other embodiments. R ¹⁹ is -C(=O)OR ²¹ and R ¹⁸ is hydrogen, guanidineyl, heterocyclyl, C ₁ -C ₃₀ alkyl, C ₃ -C ₈ cycloalkyl; C ₆ -C ₃₀ aryl, C ₃ -C ₃₀ alkylcarbonyl, C ₃ -C ₈ cycloalkylcarbonyl, C ₃ -C ₈ cycloalkylalkylcarbonyl, C ₇ -C ₃₀ arylcarbonyl, C ₇ -C ₃₀ aralkylcarbonyl, C ₂ -C ₃₀ alkyloxycarbonyl, C ₃ -C ₈ cycloalkyloxycarbonyl, C ₇ -C ₃₀ aryloxycarbonyl, C ₈ -C ₃₀ aralkyloxycarbonyl, or- P(=O)(R ²² ) ₂ , wherein each R ²² is C ⁶ -C ¹² aryloxy.

In other embodiments, R ²⁰ is independently at each occurrence of guanidineyl, heterocyclyl, C ₁ -C ₃₀ alkyl, C ₃ -C ₈ cycloalkyl; C ₆ -C ₃₀ aryl, C ₃ -C ₃₀ alkylcarbonyl, C ₃ -C ₈ cyclocarbonyl, C ₃ -C ₈ cycloalkylalkylcarbonyl, C ₇ -C ₃₀ arylcarbonyl, C ₇ -C ₃₀ Aralkylcarbonyl, C ₂ -C ₃₀ alkyloxycarbonyl, C ₃ -C ₈ cycloalkyloxycarbonyl, C ₇ -C ₃₀ aryloxycarbonyl, C ₈ -C ₃₀ aralkyloxycarbonyl, or -P (=O)(R ²² ) ₂ . In other instances R ²⁰ is independently at each occurrence of guanidineyl, heterocyclyl, C ₁ -C ₃₀ alkyl, C ₃ -C ₈ cycloalkyl; C ₆ -C ₃₀ aryl, C ₇ -C ₃₀ aralkyl, C ₃ -C ₈ cycloalkylcarbonyl, C ₃ -C ₈ cycloalkylalkylcarbonyl, C ₇ -C ₃₀ arylcarbonyl, C ₇ -C ₃₀ Aralkylcarbonyl, C ₂ -C ₃₀ alkyloxycarbonyl, C ₃ -C ₈ cycloalkyloxycarbonyl, C ₇ -C ₃₀ aryloxycarbonyl, C ₈ -C ₃₀ aralkyloxycarbonyl, or -P (=O)(R ²² ) ₂ .

In some embodiments, R ²⁰ is guanidineyl, such as mono methylguanidineyl or dimethylguanidineyl. In other embodiments, R ²⁰ is heterocyclyl. For example, in some embodiments, R ²⁰ is piperidin-4-yl. In some embodiments, piperidin-4-yl is substituted with a trityl or Boc group. In other embodiments, R ²⁰ is C ₃ -C ₈ cycloalkyl. In other embodiments, R ²⁰ is C ₆ -C ₃₀ aryl.

In some embodiments, R ²⁰ is C ₇ -C ₃₀ arylcarbonyl. For example, in some embodiments, R ²⁰ has the following formula (XVIII):

Wherein R ²³ is independently at each occurrence of hydrogen, halo, C ₁ -C ₃₀ alkyl, C ₁ -C ₃₀ alkoxy, C ₁ -C ₃₀ alkyloxycarbonyl, C ₇ -C ₃₀ aralkyl, aryl, Heteroaryl, heterocyclyl or heterocyclyl, wherein one R ²³ is combined with another R ²³ to form a heterocyclyl ring. In some embodiments, at least one R ²³ is hydrogen, for example in some embodiments each R ²³ is hydrogen. In other embodiments, at least one R ²³ is C ₁ -C ₃₀ alkoxy, eg, in some embodiments, each R ²³ is methoxy. In other embodiments, at least one R ²³ is heteroaryl, for example, in some embodiments, at least one R ²³ has one of the following formula (XVIIIa) or (XVIIIb):

또는

or

In yet other embodiments, one R ²³ is combined with another R ²³ to form a heterocyclyl ring. For example, in one embodiment R ²⁰ is 5-carboxyfluorescein.

In other embodiments, R ²⁰ is C ₇ -C ₃₀ aralkylcarbonyl. For example, in various embodiments, R ²⁰ has one of the following formulas (XIX), (XX) or (XXI):

또는

or

Wherein R ²³ is independently at each occurrence of hydrogen, halo, C ₁ -C ₃₀ alkyl, C ₁ -C ₃₀ alkoxy, C ₁ -C ₃₀ alkyloxycarbonyl, C ₇ -C ₃₀ aralkyl, aryl, Heteroaryl, heterocyclyl or heterocyclyl, wherein R ²³ is combined with another R ²³ to form a heterocyclyl ring, X is -OH or halo and m is an integer from 0 to 6. In some specific embodiments, m is 0. In other embodiments, m is 1, while in other embodiments m is 2. In other embodiments, at least one R ²³ is hydrogen, for example in some embodiments each R ²³ is hydrogen. In some embodiments, X is hydrogen. In other embodiments, X is -OH. In other embodiments X is Cl. In other embodiments, at least one R ²³ is C ₁ -C ₃₀ alkoxy, for example methoxy.

In yet other embodiments, R ²⁰ is C ₇ -C ₃₀ aralkyl, for example trityl. In other embodiments R ²⁰ is methoxy trityl. In some embodiments, R ²⁰ has the following formula (XXII):

Wherein R ²³ is independently at each occurrence of hydrogen, halo, C ₁ -C ₃₀ alkyl, C ₁ -C ₃₀ alkoxy, C ₁ -C ₃₀ alkyloxycarbonyl, C ₇ -C ₃₀ aralkyl, aryl, Heteroaryl, heterocyclyl or heterocyclyl, and one R ²³ is combined with another R ²³ to form a heterocyclyl ring. For example, in some embodiments each R ²³ is hydrogen. In other embodiments, at least one R ²³ Is C ₁ -C ₃₀ alkoxy, for example methoxy.

In another embodiment, R ²⁰ is C ₇ -C ₃₀ aralkyl and R ²⁰ has the following formula (XXIII):

In some embodiments, at least one R ²³ is halo, e.g. It is chloro. In some other embodiments, one R ²³ is chloro in the para position.

In other embodiments, R ²⁰ is C ₁ -C ₃₀ alkyl. For example, in some embodiments, R ²⁰ is C ₄ -C ₂₀ Alkyl and optionally contains one or more double bonds. For example, in some embodiments, R ²⁰ is C ₄ containing a triple bond, for example, the terminal triple bond is ₁₀ alkyl. In some embodiments, R ²⁰ is hexin-6-yl. In some embodiments, R ²⁰ has one of the following formulas (XXIV), (XXV), (XXVI) or (XXVII):

또는

or

In yet other embodiments, R ²⁰ is C ₃ -C ₃₀ alkylcarbonyl, for example C ₃ -C ₁₀ alkyl carbonyl. In some embodiments, R ²⁰ is -C(=O)(CH ₂ ) _p SH or -C(=O)(CH ₂ ) _p SSHet, where p is an integer from 1 to 6 and Het is heteroaryl. For example, p may be 1 or p may be 2. In another example Het is pyridinyl, such as pyridin-2-yl. In other embodiments, the C ₃ -C ₃₀ alkylcarbonyl is substituted with an additional oligomer, for example in some embodiments the oligomer comprises a C ₃ -C ₃₀ alkyl carbonyl at the 3′ position of the other oligomer. . Such terminal modifications are included within the scope of the present invention.

In other embodiments R ²⁰ is a C ₃ -C ₃₀ alkyl carbonyl further substituted with an arylphosphoryl moiety, such as triphenyl phosphoryl. Examples of such R ²⁰ groups include structural formula 33 in Table 3.

In another example, R ²⁰ is C ₃ -C ₈ cycloalkylcarbonyl, for example C ₅ -C ₇ alkylcarbonyl. In these embodiments, R ₂₀ has the following formula (XXVIII):

Wherein R ²³ is independently at each occurrence of hydrogen, halo, C ₁ -C ₃₀ alkyl, C ₁ -C ₃₀ alkoxy, C ₁ -C ₃₀ alkyloxycarbonyl, C ₇ -C ₃₀ aralkyl, aryl, Heteroaryl, heterocyclyl or heterocyclylalkyl, and one R ²³ is bonded to another R ²³ to form a heterocyclic ring. In some embodiments, R ²³ is heterocyclylalkyl, for example in some embodiments R ²³ has the formula:

In some other embodiments, R ²⁰ is C ₃ -C ₈ cycloalkylalkylcarbonyl. In other embodiments, R ²⁰ is C ₂ -C ₃₀ alkyloxycarbonyl. In other embodiments, R ²⁰ is C ₃ -C ₈ cycloalkyloxycarbonyl. In other embodiments, R ²⁰ is C ₇ -C ₃₀ aryloxycarbonyl. In other embodiments, R ²⁰ is C ₈ -C ₃₀ aralkyloxycarbonyl. In other embodiments, R ²⁰ is -P(=O)(R ²² ) ₂ , and each R ²² is C ⁶ -C ¹² aryloxy, for example, in some embodiments, R ²⁰ is of the formula (C24 ) Has:

In other embodiments, R ²⁰ contains one or more halo atoms. For example, in some embodiments R ²⁰ comprises a perfluoro analog of any one of the R ²⁰ moieties. In other embodiments, R ²⁰ is p-trifluoromethylphenyl, trifluoromethyltrityl, perfluoropentyl, or pentafluorophenyl.

In some embodiments, the 3'end comprises a modification, and in other embodiments the 5'end comprises a modification. In other embodiments, both the 3'and 5'ends comprise modifications. Thus, in some embodiments R ¹⁸ is absent and R ¹⁹ is R ²⁰ . In other embodiments R ¹⁹ is absent and R ¹⁸ is R ²⁰ . In yet other embodiments R ¹⁸ and R ¹⁹ are each R ²⁰ .

In some embodiments, the oligomer comprises a cell penetrating peptide in addition to the 3'or 5'modification. Thus, in some embodiments R ¹⁹ is a cell penetrating peptide and R ¹⁸ is R ²⁰ . In other embodiments, R ¹⁸ is a cell penetrating peptide and R ¹⁹ is R ²⁰ . In a further embodiment of the foregoing, the cell penetrating peptide is an arginine rich peptide.

In some embodiments, the linker L ¹ attaching the 5'end group (ie R ¹⁹ ) to the oligomer may be present or absent. The linker comprises any number of functional groups and lengths provided that the linker retains the ability to bind 5'end groups to the oligomer and the linker does not interfere with the ability of the oligomer to bind to the target sequence in a sequence specific manner. . In one embodiment, L includes a phosphorodiamidate and piperazine bond. For example, in some embodiments, L has the following formula (XXIX):

In the above formula, R ²⁴ is absent or is hydrogen or C ₁ -C ₆ alkyl. In some embodiments, R ²⁴ is absent. In some embodiments, R ²⁴ is hydrogen. In some embodiments, R ²⁴ is C ₁ -C ₆ alkyl. In some embodiments, R ²⁴ is methyl. In some embodiments, R ²⁴ is ethyl. In yet other embodiments, R ²⁴ is C ₃ alkyl. In some embodiments, R ²⁴ is isopropyl. In some further embodiments, R ²⁴ is C ₄ alkyl. In some embodiments, R ²⁴ is C ₅ alkyl. In yet other embodiments, R ²⁴ is C ₆ alkyl.

In yet other embodiments, R ²⁰ is C ₃ -C ₃₀ alkylcarbonyl and R ²⁰ has the following formula (XXX):

Wherein R ²⁵ is hydrogen or -SR ²⁶ , wherein R ²⁶ is hydrogen, C ₁ -C ₃₀ alkyl, heterocyclyl, aryl or heteroaryl and q is an integer from 0 to 6.

In a further embodiment of any of the above, R ²³ is independently at each occurrence hydrogen, halo, C ₁ -C ₃₀ alkyl, C ₁ -C ₃₀ alkoxy, aryl, heteroaryl, heterocyclyl or heterocyclyl. .

In some other embodiments, only the 3'end of the oligomer is conjugated to any of the groups indicated above. In some other embodiments, only the 5'end of the oligomer is conjugated to any of the groups indicated above. In other embodiments, both the 3'and 5'ends comprise one of the groups indicated above. The terminal group may be selected from any of the groups indicated above or from any of the specific groups illustrated in Table 3.

Table 3. Representative end groups

C. Properties of the conjugate

As pointed out above, the present invention relates to conjugates of carrier peptides and oligonucleotide analogues (ie, oligomers). Oligomers can contain various modifications that impart various properties (eg, increased antisense activity) to the oligomer. In a specific embodiment, the oligomer comprises a backbone comprising a sequence of a morpholino ring structure linked by a linkage between subunits, and the linkage between subunits is one molecule at the 5'-end of the adjacent morpholino ring structure. Connects the 3'end of the polyno ring structure, where each morpholino ring structure is bound to a base pair portion, so that the oligomer can bind to the target nucleic acid in a sequence specific manner. The morpholino ring structure can have the following formula (i):

In the above formula, Pi is in each case independently a base pair moiety.

Each morpholino ring structure supports a base pair portion (Pi) to form a base pair portion, which is typically designed to hybridize to a selected antisense target in the cell or in the subject being treated. The base pair moiety may be native DNA or RNA (A, G, C, T, or U) or analogues such as hypoxanthine (base compound of nucleoside indosine) or 5-methyl cytosine. Analog bases can also be used which impart improved binding affinity to the oligomer. Exemplary analogs in this regard include C5-propynyl-modified pyrimidine, 9-(aminoethoxy)phenoxazine (G-clamp), and the like.

As pointed out above, the oligomer is modified according to one aspect of the present invention so that one or more (B) bonds, e.g., up to about 1, typically 10 uncharged bonds for every 2 to 5 uncharged bonds. Each may contain 3 to 5 uncharged bonds. Certain embodiments also include one or more type (B) combinations. In some embodiments, the optimal improvement in antisense activity occurs when up to about half of the backbone binding is type (B). Some, although not the greatest improvement, typically appear in small numbers, for example 10-20% of (B) bonds.

In one embodiment, the binding types (A) and (B) are scattered along the skeleton. In some embodiments, the oligomer does not have a tightly alternating form of (A) and (B) along its entire length. In addition to the carrier peptide, the oligomer may optionally contain 5'and/or 3'modifications as described above.

Oligomers having blocks of (A) bonds and (B) blocks of bonds are also contemplated, for example (A) the central block of bonds can be flanked by blocks of bonds (B) or vice versa. have. In one embodiment, the oligomers have approximately the same length 5', 3; In addition, the percentage of (B) or (A) in the central region is about 50% or more and about 70% or more. Oligomers used for antisense applications generally range from about 10 to about 40 subunits in length, more preferably from about 15 to 25 subunits. For example, oligomers of the invention having 19 to 20 subunits of length useful for antisense oligomers are ideally 2 to 7, for example 4 to 6, or 3 to 5 (B) bonds and the remainder (A ) Can have a bond. Oligomers having 14 to 15 subunits may ideally have 2 to 5, for example 3 or 4 (B) bonds and the remaining (A) bonds.

The morpholino subunits may also be linked by linkages between non-phosphorus-basic subunits, as further described below.

Other oligonucleotide analog linkages that may have uncharged but branched amine substituents in their unmodified state may also be used. For example, a 5'nitrogen atom on the morpholino ring can be used in a sulfamide bond (or a urea bond when phosphorus is replaced by carbon or sulfur, respectively).

In some embodiments, for antisense applications, the oligomer may be 100% complementary to the nucleic acid target sequence, or the oligomer and nucleic acid target sequence maintain the action of cellular cellulase and other types of degradation that may occur in vitro. As long as it is sufficiently stable, it can include mismatches, for example to accommodate the variant. Mismatches, if present, are more unstable towards the end regions of the hybrid duplex than at the center. The number of mismatches allowed will depend on the length of the cleq oligomer, the percentage of G:C base pairs in the duplex, and the location of the mismatch(s) in the duplex according to the well-understood principles of duplex stability. Although these antisense oligomers are not necessarily 100% complementary to the nucleic acid target sequence, they are effective in stably and specifically binding to the target sequence so that the biological activity of the nucleic acid target, for example, the expression of the encoding protein(s), is regulated. .

The stability of the duplex formed between the oligomer and the target sequence is the irrigation of the binding T _m and the sensitivity of the duplex to cellular enzymatic cleavage. With respect to the complementary sequence RNA, the T _m of the antisense compound is determined by conventional methods, for example Hames et al. , Nucleic Acid Hybridization, IRL Press, 1985, pp. 107-108, or Miyada CG and Wallace RB, 1987, Oligonucleotide hybridization techniques, Methods Enzymol. Vol. 154 pp. It can be measured by the method described in 94-107.

In some embodiments, each antisense oligomer has a binding T _m to a complementary sequence RNA above body temperature or in other embodiments above 50°C. In other embodiments, T _m is in the range of 60-80°C or higher. According to well-known principles, for a complementary basic RNA hybrid, the T _m of an oligomer can be increased by increasing the ratio of C:G pair bases in the duplex and/or by increasing the length of the heteroduclex (in base pairs). At the same time, it may be advantageous to limit the size of the oligomers for the purpose of optimizing cell uptake. For this reason, compounds exhibiting a high Tm (50° C. or higher) at a length of 20 bases or less are generally preferred over those requiring 20 or more bases with a high Tm value. For some applications, longer oligomers, such as 20 or more long bases, may have certain advantages. For example, in certain embodiments longer oligomers may find special utility in use in exon skiffin or splice control.

The target sequence base may be a normal DNA base or an analog thereof, such as uracil and inosine capable of Watson-Crick base pairing to the target-sequence RNA base.

Oligomers can also incorporate a guanine base instead of adenine if the target nucleotide is a uracin residue. This is useful when the target sequence varies across different viral species and also the change at any given nucleotide residue is cytosine or uracil. By using guanyl in the targeting oligomer at the point of variability, the well-known ability of guanine (named C/U:G base pair) to base pairing with uracil can be exploited. By incorporating guanine at these positions, single oligomers can effectively target a wide range of RNA target variability.

The compounds (eg oligomers, subunit bonds, end groups) may exist in different isomeric forms, eg structural isomers (eg tautomers). As for stereoisomers, the compounds may have a chiral center and may also occur as racemates, enantiomeric mixtures, individual enantiomers, mixtures or diastereomers or individual diastereomers. All such isomeric forms are included within the scope of the present invention, including mixtures thereof. The compounds may also have axial chirality, which can lead to atropisomers. Moreover, some of the crystalline forms of the compounds may exist as polymorphs within the scope of the present invention. In addition, some of the compounds may form solvates with water or other organic solvents. Such solvates are similarly included within the scope of the present invention.

The oligomers described herein can be used in methods of inhibiting the production of proteins or replication of viruses. Thus, in one embodiment, the nucleic acid encoding such a protein is exposed to an oligomer as described herein. In a further embodiment of the foregoing, the antisense oligomer comprises a 5'or 3'modified end group as described herein, or a combination thereof, and the base portion B is of the nucleic acid at a position effective to inhibit production of the protein. It forms a sequence effective to hybridize some. In one embodiment, the position is an ATG start codon region of an mRNA, a splide portion of a pre-mRNA, or a viral target sequence as described herein.

In one embodiment, the oligomer has a T _m for binding to a target sequence of at least about 50° C. and is also taken up by mammalian cells or bacterial cells. In another embodiment, the oligomer can be conjugated to a transport moiety, for example an arginine rich peptide as described herein, to facilitate this uptake. In another embodiment, the terminal modifications described herein can act as a transport moiety to facilitate uptake by mammalian and/or bacterial cells.

The preparation and properties of morpholino oligomers are described in more detail below and are also described in US Patent No. 5,185,444 and International Application Publication No. WO/2009/064471, each of which is incorporated herein by reference in its entirety.

D. Formulation and administration of the conjugate

The invention also provides for the formulation and delivery of the described conjugates. Thus, in one embodiment the invention relates to a composition comprising a peptide-oligomeric conjugate as described herein and a pharmaceutically acceptable excipient.

Effective delivery of conjugates to target nucleic acids is an important aspect of therapy. Routes of antisense oligomer delivery include, but are not limited to, oral and parenteral routes, such as various systemic routes including intravenous, subcutaneous, intraperitoneal, and intramuscular, as well as inhalation, transdermal and local delivery. The appropriate route can be determined by a person skilled in the art as appropriate to the symptoms of the subject being treated. For example, in the treatment of viral infections of the skin, the appropriate route of delivery of antisense oligomers is local delivery, whereas for the treatment of viral respiratory infections the delivery of antisense oligomers is inhalation. Oligomers can also be delivered directly to the site of viral infection or into the bloodstream.

The conjugate can be administered physiologically and/or in any convenient pharmaceutically acceptable excipient. Such compositions may contain various pharmaceutically acceptable carriers used by those skilled in the art. Examples thereof include, but are not limited to, saline, phosphate buffered saline (PBS), water, aqueous ethanol, emulsions, such as oil/water emulsions or triglyceride emulsions, tablets and capsules. The selection of an appropriate physiologically acceptable carrier will depend on the mode of administration chosen.

The compounds of the present invention (eg, conjugates) can generally be used as free acids or free bases. Alternatively, the compounds of the present invention can be used in the form of acid or base addition salts. The acid addition salts of the free amino compounds of the present invention can be prepared by methods well known in the art and can also be formed from organic and inorganic acids. Suitable organic acids are malic acid, fumaric acid, benzoic acid, ascorbic acid, succinic acid, methanesulfonic acid, acetic acid, trifluoroacetic acid, oxalic acid, propionic acid, tartaric acid, salicylic acid, citric acid, gluconic acid, lactic acid, mandelic acid, cinnamic acid, aspartic acid, Stearic acid, palmitic acid, glycolic acid, glutamic acid, and benzenesulfonic acid. Suitable inorganic acids include hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid and nitric acid. Base addition salts include those salts that form with carboxylate anions and also organic and inorganic cations such as those selected from alkali and alkaline earth metals (e.g., lithium, sodium, potassium, manganese, barium and calcium). Salts formed with organic and inorganic cations such as those selected from ammonium ions and their substituted derivatives (eg dibenzyl ammonium, benzyl ammonium, 2-hydroxyethylammonium, etc.). Accordingly, the term "pharmaceutically acceptable salt" of formula (I) is intended to include any and all acceptable salt forms.

In addition, prodrugs are also included within the context of the present invention. A prodrug is any covalent carrier that releases a compound of formula (I) in vivo when such a prodrug is administered to a patient. Prodrugs are generally prepared by modifying a functional group in such a way that the modification is cleaved by routine manipulation or in vivo to produce the parent compound. Prodrugs include, for example, compounds of the invention in which a hydroxy, amine or sulfhydryl group is attached to any group that is cleaved when administered to form a hydroxy, amine or sulfhydryl group. Accordingly, representative examples of prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of alcohol and amine functional groups of the compound of formula (I). Additionally, in the case of carboxylic acid (-COOH), esters such as methyl ester, ethyl ester and the like can be used.

In some cases, liposomes can be used to promote the uptation of antisense oligonucleotides in cells (eg, Williams, SA, Leukemia 10(12):1980-1989, 1996; Lappalainen et al., Antiviral Res. 23 :119, 1994; Uhlmann et al., Antisense Oligonucleotides: New Therapeutic Principles, Chemical Reviews, Volume 90, No. 4, pages 544-584, 1990; Gregoriadis, G., Chapter 14, Liposomes, Drug Carriers in Biology and Medicine, pp. 287-341, Academic Press, 1979). Hydrogels can also be used as excipients for the administration of antisense oligomers, for example as described in international application WO 93/01286. Alternatively, oligonucleotides can be administered as microspheres or microparticles. (See, eg, Wu, G.Y. and Wu, C.H., J. Biol. Chem. 262:4429-4432, 1987). Alternatively, the use of gas-filled microbubbles complexed with antisense oligomers can increase delivery to target tissues as described in US Pat. No. 6,245,747. Sustained release compositions can also be used. They may comprise semi-permeable polymer matrices in the form of molded articles such as films or microcapsules.

In one embodiment, antisense inhibition is an antisense agent effective to inhibit replication of a specific virus, which is effective in treating infection of a host animal by contacting or by contacting infected cells with a virus. Antisense agents are administered in a suitable pharmaceutical carrier to a mammalian subject infected with a given virus, for example a human or livestock. Antisense oligonucleotides are considered to inhibit the growth of RNA viruses in the host. RNA viruses can be reduced in number or eliminated somewhat detrimental effects on the normal growth or development of the host.

In one aspect of the method, the subject is a human subject, eg, a patient diagnosed with a local or systemic viral infection. The patient's symptoms may also include, for example, (1) decreased immunity; (2) being a victim of burns; (3) have an indwelling catheter; Or (4) in the case of a patient who intends to undergo surgery or has recently performed surgery, it may affect the prophylactic administration of the antisense oligomer of the present invention. In one preferred embodiment, the oligomer is a phosphorodiamidate morpholino oligomer contained in a pharmaceutically acceptable carrier and is also delivered orally. In another preferred embodiment, the oligomer is a phosphorodiamidate morpholino oligomer contained in a pharmaceutically acceptable oligomer and is also delivered intravenously (i.v.).

In another application of the method, the subject is a livestock animal, for example a chicken, turkey, pig, cow or goat, and the like, and the treatment is prophylactic or therapeutic. The present invention also includes edible compositions for livestock and poultry containing edible grains supplemented with sub-therapeutic amounts of antiviral antisense compounds of the type described above. In addition, in the method of supplying edible grains supplemented to livestock and poultry at a level below the therapeutic amount of an antiviral agent, the improvement in which the edible grains are supplemented in an amount less than the therapeutic amount of antiviral oligonucleotides as described above is considered.

In one embodiment, the conjugate is administered in an amount and method effective to result in a peak blood concentration of at least 200-400 nM antisense oligomer. Typically, one or more doses of the antisense oligomer are administered for about 1-2 weeks, generally at regular intervals. A preferred dose for oral administration is about 1-1000 mg oligomer per 70 kg. In some cases, a dose of 1000 mg or more oligomer/patient may be required. For intravenous administration, the preferred dosage is about 0.5 mg to 1000 mg of oligomer per 70 kg. The conjugates are administered daily for a short period of time at regular intervals, for example 2 weeks or less. However, in some cases the conjugate is administered intermittently for a longer period of time. Administration can be followed or concurrently with the administration of antibiotics or other therapeutic treatments. The treatment regimen can be adjusted as directed (dosage, frequency, route, etc.) based on immunoassays, other biochemical tests, and physiological tests of the subject being treated.

Effective in vivo treatment regimens using the conjugates of the present invention may vary depending on the duration, dosage, frequency, and route of administration, as well as the symptoms of the subject being treated (i.e., prevention compared to administration in response to local or systemic infections. Enemy administration). Thus, in order to achieve optimal treatment results, such in vivo treatments will often require monitoring by tests suitable for the particular type of viral infection being treated and also corresponding adjustments in the dosage or treatment regimen. Treatment can be monitored by general signs of disease and/or infection, such as complete blood count (CBC), nucleic acid detection methods, immunodiagnostic tests, viral culture, or detection of heteroduplexes.

The effect of the in vivo administered antiviral conjugate of the present invention to inhibit or eliminate the growth of one or more types of RNA viruses is a biological sample (tissue, blood, urea, etc.) taken from the subject before, during and after administration of the antisense oligomer. Can be determined from Analysis of the sample may include (1) monitoring the presence or absence of heteroduplex formation with target and non-target sequences, using procedures known to those skilled in the art, for example electrophoretic gel mobility analysis; (2) monitoring viral protein production as measured by standard techniques such as ELISA or Western blotting; Or (3) measuring the effect on viral titer, for example by Spearman-Karber's method. (For example, Pari, GS et al., Antimicrob. Agents and Chemotherapy 39(5):1157-1161, 1995; Anderson, KP et al., Antimicrob. Agents and Chemotherapy 40(9):2004-2011, 1996 , Cottral, GE (ed) in: Manual of Standard Methods for Veterinary Microbiology, pp. 60-93, 1978).

E. Preparation of conjugate

Morpholino subunits, modified subunit bonds, and oligomers comprising them can be prepared as described in the Examples and U.S. Patent Nos. 5,185,444 and 7,943,762, all of which are incorporated herein by reference. The morpholino subunit can be prepared according to the following general scheme I.

Scheme 1. Preparation of morpholino subunit

Referring to Scheme 1, B represents a base pair portion, PG represents a protecting group, and a morpholino subunit can be prepared from the corresponding ribinucleoside (1) as shown. The morpholino subunit (2) can be selectively protected by reaction with a suitable protecting group precursor, for example trityl chloride. The 3'protecting groups are generally removed during solid state oligomer synthesis, as detailed below. The base pair moiety can be suitably protected during solid phase oligomer synthesis. Suitable protecting groups include benzoyl for adenyl and cytosine and pivaloyloxymethyl for hypoxanti(I). The pivaloyloxymethyl group can be introduced on the N1 position of the hypoxanthine heterocyclic base. Unprotected hypoxanthine subunits can be used, but the yield of the activation reaction is much better when the base is protected. Other suitable protecting groups are described in pending US patent application Ser. No. 12/271,040, which is incorporated herein by reference in its entirety.

Reaction of 3 with the activated phosphorus compound 4 yields a morpholino subunit with the desired bonding moiety (5). Compounds of formula 4 can be prepared using any number of methods known to those of skill in the art. For example, such compounds can be prepared by reaction of the corresponding amine with phosphorus oxychloride. In this regard, amine starting materials can be prepared using any method known in the art, for example the methods described in the Examples and US Pat. No. 7,943,762. Although the above scheme represents type (B) (eg, X is -NR ⁸ R ⁹ ), a bond of type (A) (eg, X is dimethylamine) can be prepared in a similar manner.

The compound of Structural Formula 5 can be used in the synthesis of solid-phase automated oligomers for the preparation of oligomers including small molecule bonds. Such methods are well known in the art. Briefly, the compound of formula 5 can be modified at the 5'end to contain a linker on a solid support. For example, compound 5 may be bonded to the solid support by a linker comprising L ¹ and/or R ¹⁹ . An exemplary method is demonstrated in Figures 3 and 4. In this way, the oligo may contain a 5'end modification after the oligo synthesis is complete and the oligomer is cleaved from the solid support. Once supported, the protecting group of 5 (eg trityl) is removed and the free amine is also reacted with the activated phosphorus moiety of the second compound of formula 5. This sequence is repeated until an oligomer of the desired length is obtained. The protecting group at the terminal 5'end can be removed or dropped if a 5'-modification is desired. Oligos can be removed from the solid support using any number of methods, for example treatment with a base to cleave the bonds to the solid support.

Peptide oligomer conjugates are prepared according to standard peptide synthesis methods known in the art with oligomers containing free NH (e.g. 3′ NH of amorpholino oligomers) and desired peptides in the presence of an appropriate activator (e.g. HATU). ) Can be prepared by coupling. Conjugates can be purified using a number of techniques known in the art, such as SCX chromatography.

The preparation of modified morpholino subunits and peptide oligomer conjugates is described in more detail in the Examples. Peptide oligomer conjugates comprising any number of modified linkages can be prepared using the methods described herein, methods known in the art, and/or described herein by reference. In addition, global modifications of the PMO+ morpholino oligomers prepared as described above are described in the Examples (see, for example, PCT Publication No. WO2008036127).

F. Antisense activity of oligomers

The invention also provides a method of inhibiting production of a protein comprising exposing a nucleic acid encoding the protein to a peptide-oligomeric conjugate as described herein. Thus, in one embodiment, the nucleic acid encoding such a protein is exposed to the conjugate as described herein, wherein the base pair portion Pi forms a sequence effective to hybridize to a portion of the nucleic acid at a position effective to inhibit the production of the protein. do. The oligomer can target, for example, the ATG start codon region of the mRNA, the splice site of the pre-mRNA, or a viral target sequence as described below.

In another embodiment, the present invention provides a method of increasing the antisense activity of a peptide oligomer conjugate comprising an oligonucleotide analog having a sequence of subunit bonds supporting a base pairing site, the method comprising: And conjugating a carrier peptide as described.

In some embodiments, the increase in antisense activity can be demonstrated by (i) or (ii):

(i) a reduction in the expression of the encoding protein relative to that provided by the corresponding unmodified oligomer if the binding of the antisense oligomer to its target sequence is effective to block the translation start codon for the encoding protein, or

(ii) when binding of the antisense oligomer to its target sequence is effective to block an abnormal splice site in the pre-mRNA encoding the protein when correctly spliced, with respect to that provided by the corresponding unmodified oligomer, Increased expression of the encoded protein. Assays suitable for the measurement of these effects are described further below. In one embodiment, the modification provides for such activity in a cell free translation assay, a splice modification translation assay in cell culture, or an increase in splice modification of a functioning animal model system as described herein. In one embodiment, the activity is increased by at least 2, at least 5 or at least 10 elements.

Various exemplary applications of the conjugates of the present invention are described below, including antiviral applications, treatment of neuromuscular diseases, bacterial infections, inflammation and multiple cystic kidney disease. This description is not meant to limit the invention in any way, but serves to illustrate a wide range of human and animal disease symptoms that can be explained using the conjugates described herein.

Exemplary therapeutic uses of G. conjugates

Oligomers conjugated to carrier peptides contain good potency and low toxicity, thus resulting in a better therapeutic window than those obtained using oligomers or peptide-oligomeric conjugates. The following description provides, but is not limited to, exemplary embodiments of the therapeutic use of the conjugate.

1.Targeting of the secondary structure of the stem loop of the ssRNA virus

One class of exemplary antisense antiviral compounds comprises a sequence of 12-40 subunits and a targeting sequence complementary to a region associated with the stem loop secondary structure within the 5'-terminal 40 bases of the positive-sense RNA strand of the targeted virus. Is a morphology oligomer as described herein. (See, for example, PCT Publications WO/2006/033933 or US Application Publication Nos. 20060269911 and 20050096291, which are all incorporated herein by reference).

The present invention includes first identifying a region as a viral target sequence within the 5'-terminal 40 bases of the positive strand of an infectious virus whose sequence can form a stem loop secondary structure. Next, a morpholino oligomer having a targeting sequence of at least 12 subunits that is complementary to a viral genomic region capable of forming an internal double structure by stepwise solid phase synthesis is constructed, wherein the oligomer is an oligonucleotide compound and a positive sense of the virus. A heteroduplex structure composed of strands and characterized by dissociation Tm of the stem loop structure of at least 45° C. and disruption of such stem loop structure can be formed together with the viral target sequence. The oligomer is conjugated to the carrier peptide described herein.

The target sequence is identified by a 5'-end sequence, e.g., a 5'-end 40 bases, by a computer program capable of performing secondary structure prediction based on the investigation of the minimum free energy state of the input RNA sequence. can do.

In a related aspect, the conjugate has a single-stranded positive sense genome in a mammalian host cell and also has Flaviviridae, Picornoviridae, Calicivirus, Togaviridae, Arterivirus. (Arteriviridae), Coronavirus (Coronaviridae), Astrovirus (Astroviridae), or Hepeviridae (Hepeviridae) can be used in a method of inhibiting the replication of an RNA virus selected from one of the family. The present method is disclosed herein having a target sequence of at least 12 subunits complementary to a region within the 5'-end 40 bases of the 5'-stranded viral genome of the positive stranded viral genome capable of forming an inner stem ring secondary structure. And administering to the infected host cell a viral inhibitory amount of the conjugate as described. The conjugate, when administered to a host cell, (i) consists of an oligonucleotide compound and a positive sense strand of a virus, and (ii) forms a heteroduplex structure that exhibits disruption of this stem loop secondary structure and dissociation of at least 45°C. It is effective to do. The conjugate can be administered to a mammalian subject infected with a virus or at risk of viral infection.

Exemplary targeting sequences targeting the terminal stem loop structures of dengue and Japanese encephalitis virus are listed below as SEQ ID NOs: 1 and 2, respectively.

Additional exemplary target sequences targeting the terminal stem loop structure of the ssRNA virus can also be found in U.S. Patent Application Nos. 11/801,885 and PCT Publication WO/2008/036127, which are incorporated herein by reference in their entirety.

2. Targeting of the primary open reading frame of the ssRNA virus

The second class of exemplary conjugates is picornavirus, calicivirus, togavirus, coronavirus, with a first open reading frame encoding a polyprotein containing a plurality of functional proteins and a single stranded positive sense genome of less than 12 kb, And to inhibit the growth of the flavivirus family. In a specific embodiment, the virus is an RNA virus from the coronavirus family or a West Nile, yellow fever, or dengue virus from the flavivirus family. The inhibitory conjugate comprises an antisense oligomer as described herein having a target base sequence that is substantially complementary to the viral target sequence spanning the AUG start site of the first open reading frame of the viral genome. In one embodiment of the method, the conjugate is administered to a mammalian subject infected with the virus. See, for example, PCT Publication No. WO/2005/007805 and US Patent Application Publication No. 2003224353, which are all incorporated herein by reference.

A preferred target sequence is the region spanning the AUG start of the first open reading frame (ORF1) of the viral genome. The first ORF generally encodes a polyprotein containing non-structural proteins such as polymerases, helicases and proteases. It is meant that the target sequence “spanning the AUG start site” comprises at least 3 bases on one side of the AUG start site and at least two bases (at least 8 bases in total) on the other side. Preferably, it contains at least 4 bases (at least 11 bases in total) on each side of the starting site.

More generally, preferred target sites include targets that are conserved between various viral isolates. Other advantageous sites include IRES (internal ribosome binding site), transactivation protein binding site, and initiation site of replication. Complexes and large viral genomes capable of providing multiple overlapping genes can be effectively targeted by targeting cellular genes encoding for viral invasion and host response to the presence of the virus.

A variety of viral genome sequences are available from well-known sources such as the NCBI Gene Bank database. The AUG start site of ORFI can also be identified in dependent genetic databases or references, or can be found by scanning the sequence for the AUG codon in the region of the expected ORFI start site.

General genomic organisation for each of the four viral families is provided below, followed by exemplary target sequences obtained for selected members (genus, species or strain) within each family.

3. Targeting of influenza virus

A third class of exemplary conjugates is used to inhibit viral growth or treat viral infections of the Orthomyxoviridae family. In one embodiment, the host cell is contacted with a conjugate as described herein, e.g., a conjugate comprising a sequence effective to hybridize to a target moiety selected from: 1) a negative sense viral RNA segment 5'or 3'terminal 25 bases; 2) the terminal 25 bases of the 5'or 3'end of the positive sense cRNA; 3) 45 bases surrounding the AUG start codon of influenza virus mRNA and; 4) 50 bases surrounding the splice donor or acceptor site of influenza mRNA in alternating splicing. (See, for example, PCT Publication No. WO/2006/047683; US Application Publication No. 20070004661; and PCT Application Nos. 2010/056613 and US Application Nos. 12/945,081, which are incorporated herein by reference in their entirety).

Exemplary conjugates in this regard include conjugates comprising an oligomer comprising SEQ ID NO: 3.

Table 4. Influenza target sequence introducing a binding or terminal group between modified subunits

**3'-benzhydryl; *+ bond is trimethyl glycine acylated in PMOplus, and PMOm represents a T base having a methyl group on the 3-nitrogen position.

Conjugates are particularly useful for treating influenza virus infections in mammals. The conjugate can be administered to a mammalian subject that is infected with the influenza virus or at risk of infection with the influenza virus.

4. Viral targeting of the Picornavirus family

A fourth class of exemplary conjugates is used to inhibit viral growth of the Picornavirus family and also to treat viral infections. Conjugates are particularly useful for treating Enterovirus and/or Rhinovirus in mammals. In this embodiment, the conjugate comprises a sequence of 12-40 subunits, comprising at least 12 subunits with a targeting sequence complementary to a region associated with the RNA virus within one of the 32 conserved nucleotide regions of the virus 5'untranslated region. It includes a morpholino oligomer having. (See, for example, PCT publications WO/2007/030576 and WO/2007/030691, or US applications 11/518,058 and 11/517,757 to pending co-applicants, which are incorporated by reference in their entirety). Exemplary targeting sequences are listed below as SEQ ID NO:6.

5. Virus targeting of flavivirus family

The fifth class of exemplary conjugates is used to inhibit the replication of flaviviruses in animal cells. Exemplary conjugates of this class are at least complementary to a region of the positive stranded RNA genome of the virus comprising at least a portion of the 3'-CS sequence or 5'-cycling sequence (5'-CS) of positive stranded flaviviral RNA It includes a propolyno oligomer of 8-40 nucleotide bases in length with a sequence of 8 bases. A very preferred target is 3'-CS and an exemplary target sequence of dengue viruses is listed below as SEQ ID NO: 7 (e.g., PCT International Publication WO/2005/030800, which is incorporated herein by reference in its entirety. Or see U.S. Application No. 10/913,996 of pending co-applicants).

6. Virus Targeting of the Nidovirus Family

The sixth class of exemplary conjugates is used to inhibit the replication of virus-infected animal cells. Exemplary conjugates of this class contain 8 to 25 nucleotide bases and are also capable of disrupting base pairs between the transcriptional regulatory sequences (TRS) in the 5'leader region of the positive stranded viral genome and the negative stranded 3'subgenomic region. Morpholino oligomers having (see, for example, PCT International Publication No. WO/2005/065268 or US Application Publication No. 20070037763, which is incorporated herein by reference in its entirety).

7. Pilovirus targeting

In another embodiment, one or more conjugates as described herein are conjugates as described herein, e.g., at least 12 contiguous within the AUG start region of the positive stranded mRNA, as further described below. It can be used in a method of inhibiting replication in the host cell by contacting a host cell of Ebola virus or Marburg virus with a conjugate having a target nucleotide sequence complementary to a target sequence composed of a base.

The pilovirus genome is approximately 19,000 bases of single-stranded RNA that is not segmented in the antisense sequence. The genome encodes 7 proteins from a single cistronic mRNA that is complementary to the vRNA.

The target sequence is a positive strand (sense) RNA sequence that spans 30 bases at the 3'end of the minus strand viral RNA or downstream (within 25 bases) or upstream (within 100 bases) of the AUG start codon of the selected Ebola virus protein. A preferred protein target is L. Although nucleoprotein NP and VP30 are also contemplated, they are the viral polymerase subunits VP35 and VP24. Among these, the early protein is preferred, for example VP35 is more preferred over the late expressed L polymerase.

In another embodiment, one or more conjugates as described herein have a target base sequence complementary to a target sequence consisting of at least 12 contiguous bases within the AUG start site region of the positive stranded mRNA of the pilovirus mRNA sequence. It can be used in a method of inhibiting replication in the host cell by contacting the host cell of Ebola virus or Marburg virus with the conjugate described in (e.g., PCT publication WO/2006/050414, which is incorporated herein by reference. Or US Pat. Nos. 7,524,829 and 7,507,196, and US applications 12/402,455; 12/402,461; 12/402,464; and 12/853,180 and serial applications).

8. Targeting of Arena Virus

In yet another embodiment, a conjugate as described herein can be used in a method of inhibiting viral infection of mammalian cells by species in the arenavirus family. In one aspect, the conjugate can be used to treat a mammalian subject infected with the virus (see, for example, PCT Publication WO/2007/103529 or US Patent No. 7,582,615, incorporated herein by reference). .

Table 5 is an exemplary list of target viruses targeted by the conjugates of the present invention, as organized by Old World or New World Arenavirus classification.

Table 5. Targeted arenavirus

The arenavirus genome consists of two single-stranded RNA segments designated S (small) and L (large). In virions, the molar ratio of S- to L-segment RNA is approximately 2:1. The complete S-segment RNA sequence is determined for several arenaviruses and also ranges from 3,366 to 3,535 nucleotides. The complete L-segment RNA sequence is also determined for several arenaviruses and also ranges from 7,102 to 7,279 nucleotides. The 3'end sequence of the S and L segments is identical at 17 of the last 19 nucleotides. These terminal sequences are conserved among all known arenaviruses. The 5'end 19 or 20 nucleotides at the beginning of each genomic RNA are incompletely complementary to each corresponding 3'end. Because of this complementarity, the 3'and 5'ends are considered to be base pairs and also form a panhandle structure.

Replication of infectious virions or viral RNA (vRNA) to form antigenome, viral complementary RNA (vcRNA) strands occurs in infected cells. Both vRNA and vcRNA encode complementary mRNA. Therefore, arenaviruses are classified as yin-yang coexistence RNA viruses rather than negative- or positive-sense RNA viruses. The yin-yang coexistence arrangement of viral genes is in both the L- and S-segments. The NP and polymerase genes are located 3'of the S and L vRNA segments, respectively, and are also encoded in the conventional negative sense (i.e., they are expressed through transcription of vRNA or genomic complementary mRNA). The genes located at the 5'end of the S and L vRNA segments, ie GPC and Z, are respectively expressed in the mRNA sense, but there is no evidence that they are translated directly from the genomic vRNA. Instead, these genes are expressed through transcription of genome-sense mRNA from the antigenome (ie vcRNA), and the full length complementary copy of the genomic vRNA acts as a replication intermediate.

An exemplary target sequence for the arenavirus family of viruses is listed as SEQ ID NO: 8.

9. Targeting of respiratory syncytial virus

Respiratory syncytial virus (RSV) is one of the most important pathogens in young children. RSV-causing lower respiratory symptoms, such as bronchiolitis and pneumonia, often require hospitalization in children younger than one year old. Children with cardiopulmonary disease and children born early are particularly prone to severe illness from these infections. RSV infection is also an important disease in senior high-risk adults, and is also the second most commonly identified cause of viral pneumonia in the elderly (Falsey, Hennessey et al. 2005). The World Health Organization estimates that RSV is responsible for 64 million clinical infections and 160,000 deaths worldwide each year. There is currently no vaccine available for the prevention of RSV infection. Although many major advances in our understanding of RSV biology, epidemiology, pathophysiology and host immune responses have occurred over the past few decades, considerable debate continues regarding the optimal management of infants and children with RSV infection. Labaririn is the only licensed antiviral drug to treat RSV infection, but its use is limited to infants with high risk or severe illness. The utility of ribavirin is limited by its cost, variable efficacy, and tendency to develop resistant viruses (Marquardt 1995; Prince 2001). The current need for additional effective anti-RSV drugs is well recognized.

It is well known that peptide conjugated PMO (PPMO) can be effective in inhibiting RSV both in tissue culture and in an in vivo animal model system (Lai, Stein et al. 2008). Two antisense PPMOs designed to target sequences comprising the 5'-terminal region and translation start region of RSV L mRNA were tested for anti-RSV activity in the culture of two human airway cell lines. One of these, namely (RSV-AUG-2; SEQ ID NO: 10), reduced the viral titer by >2.0 log ₁₀ . Intranasal (in) treatment of BALB/c mice with RSV-AUG-2 PPMO prior to RSV vaccination was performed on 5 days after infection (pi), a decrease in viral titer of 1.2 log ₁₀ in lung tissue and attenuated lung infection after 7 days infection. Was created. These data showed that RSV-AUG-2 produces potent anti-RSV activity that is worth further investigation as a candidate for potential therapeutic applications (Lai, Stein et al. 2008). Despite the success with RSV-AUG-2 PPMO as described above, it is preferred to use the conjugates described herein to account for the toxicity associated with conventional peptide conjugates. Thus, in another embodiment of the present invention, one or more conjugates as described herein are at least 12 within the AUG initiation region of the anmRNA from the conjugates described herein, e.g., from RSV, as detailed below. By contacting the RSV host cell with a conjugate having a target base sequence complementary to a target sequence composed of adjacent bases, it can be used in a method of inhibiting replication in the host cell.

The L gene of RSV encodes an important component of the viral RNA-dependent RNA polymerase complex. Antisense PPMO, designed for a sequence spanning the AUG translation start codon of RSV L gene mRNA in the form of RSV-AUG-2 PPMO, is 13 nt in the "gene start" sequence (GS) located at the 5'end of the L mRNAt within the coding sequence. Is complementary to the sequence until. Therefore, the preferred L gene target sequence is any 12 contiguous bases from the 5'end of the L gene mRNA extending 22 bases or 40 bases in the 3'direction in the L gene encoding sequence as shown in SEQ ID NO:9 in Table 6. Is complementary to Exemplary RSV L gene target sequences are listed below as SEQ ID NOs: 10-14 in Table 6. Any of the subunit modifications described herein are incorporated into oligomers to provide tissue specificity for antisense activity, increased intracellular delivery and/or improved therapeutic activity. Exemplary oligomon sequences comprising linkages between subunits of the invention are listed in Table 6 below.

Table 6. RSV target and target sequence

10. Neuromuscular disease

In another embodiment, the therapeutic conjugate is provided for use in treating a disease condition associated with a neuromuscular disease in a mammalian subject. Antisense oligomers (eg, SEQ ID NO: 16) have been shown to have activity in the MDX mouse model of Duchene muscular dystrophy (DMD). Exemplary oligomer sequences that introduce bonds used in some embodiments are listed in Table 7. In some embodiments the conjugate comprises an oligomer selected from (a) and (b):

(a) Antisense targeted against human myostatin having a base sequence complementary to at least 12 contiguous bases in the target region of human myostatin mRNA identified as SEQ ID NO: 18 for the treatment of muscle breakdown symptoms as described above. Oligomers (see, for example, US Patent Application No. 12/493,140, and PCT Publication No. WO2006/086667, which are incorporated herein by reference). Exemplary murine target sequences are listed as SEQ ID NOs: 19-20; And

(b) Antisense capable of producing exon skipping in DMD protein (dystrophine) such as PMO having a sequence selected from SEQ ID NOs: 22 to 35 to restore partial activity of dystrophin protein for treating DMD as described above Oligomers (see, for example, PCT International Publications WO/2010/048586 and WO/2006/000057 or US Patent Publication No. 09/061960, which are incorporated herein by reference).

Several other neuromuscular diseases can be treated using the modified linkage and end groups of the present invention. Exemplary compounds for treating spinal muscular contraction (SMA) and muscular dystrophy (DM) are discussed below.

SMA is a common chromosomal recessive disease caused by chronic loss of alpha-motor neurons in the spine, and can affect children and adults. Reduced expression of survival motor neurons (SMNs) is responsible for disease (Hua, Sahashi et al. 2010). The mutation responsible for SMA is found in the SMN1 gene, but the binary gene SMN2 can allow viability by compensating for the loss of SMN1 when expressed from an alternative splice form without exon 7 (delta SMN2). Antisense compounds targeted with inton 6, exon 7 and intron 7 have all been shown to induce exon 7 inclusion bodies to varying degrees. Antisense compounds targeted with intron 7 are preferred (see, for example, PCT International Publications WO/2010/148249, WO/2010/120820, WO/2007/002390 and US Patent No. 7838657). Exemplary antisense sequences targeting SMN2 pre-mRNA and leading to improved exon 7 are listed as SEQ ID NOs: 36-38. Selected modifications of these oligomeric sequences using the modified linkages and end groups described herein are considered to have improved properties over those known in the art. Furthermore, any oligomers targeted to intron 7 of the SMN2 gene and comprising features of the invention have the potential to induce exon 7 inclusion bodies and are also considered to have potential in SMA patients. Muscular dystrophy type 1 (DM1) and type 2 (DM2) are dominant inherited diseases caused by the expression of toxic RNA that induces neuromuscular degeneration. DM1 and DM2 are associated with long poly CUG and polyCCUG repeats in the 3'-UTR and intron 1 regions of transcriptional dystropy myotonica protein kinase (DMPK) and zinc finger protein 9 (ZNF9), respectively (e.g., International publication WO2008/036406). While normal subjects have a whopping 30 CTG repetitions, DM1 patients have multiple repetitions ranging from 50 to thousands. The severity of the disease and the age of onset are related to the number of repetitions. Patients with adult onset show milder symptoms and have fewer than 100 repetitions. Juvenile-initiated DM1 patients have as many as 500 repetitions, and congenital cases generally have thousands of CTG repetitions. Extended transcription containing CUG repeats forms a secondary structure, condenses in the nucleus in the form of an intranuclear focal point and also sequesters RNA-binding protein (RNA-BP). Several RNA-BPs have been implicated in diseases, including muscle blide phase (MBNL) protein and CUG-binding protein (CUGBP). MBNL protein corresponds to photoreceptor and Drosophila muscleblind (Mbl) protein required for muscle differentiation. MBNL and CUGBP have been identified as antagonistic splicing modulators of transcription affected in DM1 such as cardiac troponin T (cTNT), insulin receptor (IR), and muscle specific chloride ion channel (ClC-1).

Antisense oligonucleotides targeted with extended repetitions of the DMPK gene can displace RNA-BP differentiation and reverse muscle tone symptoms in an animal model of DM1 (International Publication WO2008/036406). Oligomers comprising features of the invention are contemplated to provide improved activity and therapeutic potential for DM1 and DM2 patients. Exemplary sequences targeted with the polyCUG and polyCCUG repeats described above are listed below as SEQ ID NOs: 39-55 and are further described in U.S. Application Serial No. 13/101,942, which is incorporated by reference in its entirety.

Additional embodiments of the present invention for treating neuromuscular disorders are contemplated and also include oligomers designed to treat other DNA repeat instability gene disorders. These diseases include Huntington's disease, spinal cerebellar ataxia, X-linked vertebrae and respiratory muscle atrophy type 10 (SCA10) as described in International Publication WO2008/018795.

Table 7. M23D sequence introducing modified subunits and/or 3'and/or 5'end groups (SEQ ID NO:15)

* Dimerization indicates that it is dimerized by a bond connecting the 3'ends of two monomers. For example, the bond can be -COCH ₂ CH ₂ -S-CH(CONH ₂ )CH ₂ -CO-NHCH ₂ CH ₂ CO- or any other suitable bond. EG3 represents triethylene glycol tail (see, for example, conjugates in Examples 30 and 31).

11. Antibacterial application

The invention in another embodiment includes conjugates comprising antimicrobial antisense oligomers for use in treating bacterial infections in mammalian hosts. In some embodiments, the oligomer comprises 10-20 bases and also comprises acyl carrier protein (acpP), gyrase A subunit (gyrA), ftsZ, ribosomal protein S10 (rpsJ), leuD, mgtC, pirG, pcaA, And a target sequence of at least 10 contiguous bases complementary to the target region of the mRNA of the infectious bacteria for the cma1 gene, wherein the target region is the translation start codon of the bacterial mRNA, or upstream of the translation start codon (i.e., 5' ) Or downstream (i.e., 3') direction within 20 bases, and the oligomer binds to mRNA to form a heteroduplex, thereby inhibiting bacterial replication.

12. Regulation of nuclear hormone receptors

In another embodiment, the present invention is a composition that modulates the expression of nuclear hormone receptor (NHR) from nuclear hormone receptor super family (NHRSF), primarily by modulating or modifying the splicing of the pre-mRNA encoding the receptor. And a method. Examples of specific NHRs include the glucocorticoid receptor (GR), progesterone receptor (PR), and androgen receptor (AR). In certain embodiments, the conjugates described herein induce increased expression of ligand-independent or other selected forms of the receptor and reduced expression of inactive forms.

Embodiments of the present invention are conjugates comprising oligomers, e.g., selected from among the other NHR-regions described herein, the "lagand-binding exons" of NHRSF pre-mRNAs and/or of NHRs comprising adjacent introns. Conjugates comprising oligomers complementary to exon or intron sequences. The term “ligand-binding exon” is present in wild-type mRNA, but is removed from the primary transcript (“pre-mRNA”) to create a ligand-independent form of the mRNA. In certain embodiments, complementarity may be based on a sequence within the sequence of a pre-mRNA spanning a splice site, which includes, but is not limited to, complementarity based on a sequence spanning an exon-intron junction. Does not. In other embodiments, complementarity may be based solely on the sequence of an intron. In other embodiments, complementarity may be based solely on the sequence of an exon (see, eg, US application Ser. No. 13/046,356, which is incorporated herein by reference).

NHR modulators may be useful for treating NHR-related diseases, including those in which gene transcription is related to the expression product of a gene that is stimulated or inhibited by NHR. For example, modulators of NHR that inhibit AP-1 and/or NF-κB are, among other things described herein and known in the art, inflammatory and immune diseases and disorders such as osteoarthritis, rheumatoid arthritis, It may be useful in treating multiple sclerosis, asthma, inflammatory bowel disease, transplant rejection and graft host disease. Compounds that antagonize transactivation may be useful in treating metabolic diseases associated with elevated concentrations of glucocorticoids, such as diabetes, osteoporosis and glaucoma, among others. In addition, compounds that antagonize transactivation may be useful in treating metabolic diseases associated with deficiency of glucorotticoids such as Addison's disease and others.

An embodiment of the present invention comprises an antisense oligomer and a carrier protein composed of a morpholino subunit connected by a phosphorus-containing subunit bond that binds one subunit morpholino nitrogen to an adjacent subunit 5′ exocyclic carbon. A method of modulating nuclear NHR activity or expression of a cell comprising the step of contacting the cell with a conjugate, wherein the oligonucleotide contains a target sequence of at least 10 contiguous bases complementary to the target sequence and 10-40 bases. In addition, the target sequence is a pre-mRNA transcript of NHR, thus regulating the activity or expression of NHR. In certain embodiments, the oligomer alters the splicing of pre-mRNA transcripts and also increases the expression of variants of NHR. In some embodiments, the oligomer induces full or partial exon skipping of one or more exos of a pre-mRNA transcript. In certain embodiments, the one or more exons encode at least a portion of the ligand binding domain of NHR and the variant is a ligand independent form of NHR. In certain embodiments, the one or more exons encode at least a portion of the trans activation domain of NHR and the variant has reduced transcriptional activation. In certain embodiments, the one or more exons encode at least a portion of the DNA-binding domain of NHR. In certain embodiments, the one or more exons encode at least a portion of the N-terminal activation domain of NHR. In certain embodiments, the one or more exons encode at least a portion of the carboxy-terminal domain of NHR. In a specific embodiment, the variant binds to NF-KB, AP-l, or both and also reduces the transcription of one or more of their pro-inflammatory target genes.

In certain embodiments, the oligomer stimulates the transactivation transactivation of NHR. In another embodiment, the oligomer antagonizes the transactivation transactivation of NHR. In certain embodiments, the oligomer stimulates the trans inhibitory activity of NHR. In another embodiment, the oligomer antagonizes the trans inhibitory activity of NHR. In a specific embodiment, the oligomer antagonizes the transactivation transcriptional activity of NHR and also stimulates the transinhibitory activity of NHR (see, for example, US Patent Application No. 61/313,652, which is incorporated herein by reference),

Example

Unless otherwise indicated, all chemicals were obtained from Sigma-Aldrich-Fluka. Benzoyl adenosine, benzoyl cytidine and phenylacetyl guanosine were obtained from Carbosynth Limited, UK.

Synthesis of PMO, PMO+, PPMO and PMO comprising additional binding modifications as described herein are known in the art and pending U.S. Patent Application Nos. 12/271,036 and 12/271,040 and PCT International Publication WO It was carried out using the methods described in /2009/064471, all of which are incorporated herein by reference.

PMO having a 3'trityl modification was synthesized substantially as described in PCT Publication No. WO/2009/064471, except that the detritylation step was omitted.

Example 1.

tert -Butyl 4-(2,2,2-trifluoroacetamido)piperidine-1-carboxylate

To a suspension of tert -butyl 4-aminopyreridine-1-carboxylate (48.7 g, 0.243 mol) and DIPEA (130 mL, 0.749 mol) in DCM (250 mL) while stirring ethyl trifluoroacetate (35.6 mL , 0.300 mol) was added. After 20 hours, the solution was washed with citric acid solution (200 mL x 3, 10% w/v aq ) and sodium bicarbonate solution (200 mL x 3, concentrated aqueous), dried (MgSO ₄ ), and silica (24 g) Filtered through. The silica was washed with DCM and the combined eluate was partially concentrated (100 mL) and used directly in the next step. APCI/MS calculated C ₁₂ H ₁₉ F ₃ N ₂ O ₃ 296.1, found m / z = 294.9 (M-1).

Example 2

2,2,2-trifluoro-N-(piperidin-4-yl)acetamide hydrochloride

A solution of hydrogen chloride (250 mL, 1.0 mol) in 1,4-dioxane (4 M) was added dropwise to the stirred DCM solution of the title compound of Example 1 (100 mL). Stirring was continued for 6 hours, then the suspension was filtered and the solid was washed with diethyl ether (500 mL) to give the title compound (54.2 g, 96% yield) as a white solid. APCI/MS calculated C ₇ H ₁₁ F ₃ N ₂ O 196.1, found m / z = 196.9 (M+1).

Example 3

(4-(2,2,2-trifluoroacetamido)piperidin-1-yl)phosphonic dichloride

Phosphorous oxychloride (23.9 mL, 0.256 mol) and DIPEA (121.7 mL, 0.699 mol) were added dropwise to a cooling (ice/water bath) suspension of the compound of Example 2 (54.2 g, 0.233 mol) in DCM (250 mL) and stirred. I did. After 15 minutes, the bath was removed and the mixture was continued to stir to warm to room temperature. After 1 hour, the mixture was partially concentrated (100 mL), the suspension was filtered and the solid was washed with diethyl ether to give the title compound (43.8 g, yield 60%) as a white solid. The eluate was partially concentrated (100 mL), the obtained suspension was filtered, and the solid was washed with diethyl ether to give the additional title compound (6.5 g, yield 9%). ESI/MS calculated value: 1-(4-nitrophenyl)pyrerazine derivative C ₁₇ H ₂₂ ClF ₃ N ₅ O ₄ P 483.1, found m / z = 482.1 (M-1).

Example 4

((2S,6S)-6-((R)-5-methyl-2,6-dioxo-1,2,3,6-tetrahydropyridin-3-yl)-4-tritylmorpholine-2 -Yl)methyl(4-(2,2,2-trifluoroacetamido)piperidin-1-yl)phosphonochloride

To a stirred, cooled (ice/water bath) solution of the title compound (29.2 g, 93.3 mmol) of Example 3 in DCM (100 mL), Mo(Tr)T # (22.6 g, 46.7 mmol), 2,6- DCM solution (100 mL) of lutidine (21.7 mL, 187 mmol), and 4-(dimethylamino) pyridine (1.14 g, 9.33 mmol) was added dropwise over 10 minutes. The bath was warmed to room temperature. After 15 hours, the solution was washed with citric acid solution (200 mL x 3, 10% w/v aq ), dried (MgSO ₄ ), concentrated and the crude oil was loaded directly onto the column. Chromatography [SiO ₂ column (120 g), hexane/EtOAc eluate (gradient 1:1 to 0:1), repeat x 3] The title compound as a white solid by concentrating the fractions (27.2 g, yield 77%) was produced. ESI/MS calculated: 1-(4-nitrophenyl)feperazine derivative C ₄₆ H ₅₀ F ₃ N ₈ O ₈ P 930.3, found m / z = 929.5 (M-1).

Example 5

((2S,6R)-6-(6-Benzamido-9H-purin-9-yl)-4-tritylmorpholin-2-yl)methyl(4-(2,2,2-trifluoroa) Setamido)piperidin-1-yl)phosphonochloridate

The title compound was synthesized in a manner similar to that described in Example 4 to give the title compound (15.4 g, yield 66%) as a white solid. ESI/MS calculated: 1-(4-nitrophenyl)piperazine derivative C ₅₃ H ₅₃ F ₃ N ₁₁ O ₇ P 1043.4, found m / z = 1042.5 (M-1).

Example 6

(R)-methyl (1-phenylethyl) phosphoramidic dichloride

2,6-lutidine (7.06 mL, 60.6 mmol) and (R)-(+)- in a cooled (ice/water bath) solution of phosphorus oxychloride (2.83 mL, 30.3 mmol) in DCM (30 mL) while stirring A DCM solution of N ,a-dimethylbenzylamine (3.73 g, 27.6 mmol) was continuously added dropwise. After 5 minutes, the bath was removed and the reaction mixture was allowed to warm to room temperature. After 1 hour, the reaction solution was washed with citric acid solution (50 mL x 3, 10% w/v aq ), dried (MgSO ₄ ), filtered through SiO ₂ and concentrated to give the title compound (3.80 g) as a white foam. Provided. ESI/MS calculated 1-(4-nitrophenyl)piperazine derivative C ₁₉ H ₂₅ N ₄ O ₄ P 404.2, found m / z = 403.1 (M-1).

Example 7

(S)-methyl (1-phenylethyl) phosphoramidic dichloride

The title compound was synthesized in a manner similar to that described in Example 6 to give the title compound (3.95 g) as a white foam. ESI/MS calculated 1-(4-nitrophenyl)piperazine derivative C ₁₉ H ₂₅ N ₄ O ₄ P 404.2, found m / z = 403.1 (M-1).

Example 8

((2S,6R)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methyl Methyl ((R)-1-phenylethyl) phosphoramidochloridate

The title compound was synthesized in a manner similar to that described in Example 4 to give the title chlorophosphoroamidate (4.46 g, yield 28%) as a white solid. ESI/MS calculated C ₃₈ H ₄ OClN ₄ O ₅ P 698.2, found m / z = 697.3 (M-1).

Example 9

((2S,6R)-6-(5-methyl-2,4-dioxo-3,4-dihydropyridin-1(2H)-yl)-4-tritylmorpholin-2-yl)methyl methyl ((S)-1-phenylethyl) phosphoramidochloridate

The title compound was synthesized in a manner similar to that described in Example 4 to give the title chlorophosphoramidate (4.65 g, yield 23%) as a white solid. ESI/MS calculated: C ₃₈ H ₄ OClN ₄ O ₅ P 698.2, found m / z = 697.3 (M-1).

Example 10

(4-(pyrrolidin-1-yl)piperidin-1-yl)phosphonicdichloride hydrochloride

2,6-lutidine (19.4 mL, 167 mmol) and 4-(1-pyrrolidinyl)- in a cooled (ice/water bath) solution of phosphorus oxychloride (5.70 mL, 55.6 mmol) in DCM (30 mL) DCM solution (30 mL) of piperidine (8.58 g, 55.6 mmol) was added and stirred for 1 hour. The suspension was filtered and the solid was washed with excess diethyl ether to give the title pyrrolidine (17.7 g, 91% yield) as a white solid. ESI/MS calculated 1-(4-nitrophenyl)piperazine derivative C ₁₉ H ₃₀ N ₅ O ₄ P 423.2, found m / z = 422.2 (M-1).

Example 11

((2S,6R)-6-(5-methyl-2,4-dioxo-3,4-dihydroxypyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl) Methyl(4-(pyrrolidin-1-yl)piperidin-1-yl)phosphonochloridate hydrochloride

DCM solution of Mo(Tr)T # (24.5 g, 50.6 mmol) in a stirred, cooled (ice/water bath) solution of dichlorophosphoramidate 8 (17.7 g, 50.6 mmol) in DCM (100 mL) (100 mL), 2,6-lutidine (17.7 mL, 152 mmol), and 1-methylimidazole (0.401 mL, 5.06 mmol) were added dropwise over 10 minutes. The bath was warmed to room temperature and the suspension was stirred. After 6 hours, the suspension was poured into diethylether (1 L), stirred for 15 minutes, filtered and the solid was washed with more ethanol to give a white solid (45.4 g). The crude product was purified by chromatography [SiO ₂ column (120 gram), DCM/MeOH eluate (Gradient 1:0 to 6:4)], and the bound fraction was poured into diethyl ether (2.5 L), and stirred for 15 minutes. Then, the obtained solid was washed with additional ether to give the title compound (23.1 g, yield 60%) as a white solid. ESI/MS calculated 1-(4-nitrophenyl)piperazine derivative C ₄₈ H ₅₇ N ₈ O ₇ P 888.4, found m / z = 887.6 (M-1).

Example 12

3-(tert-butyldisulfanyl)-2-(isobutoxycarbonylamino)propanoic acid

K ₂ CO ₃ (16.5 g, 119.5 mmol) in H ₂ O (20 mL) was added to S- tert -butylmercapto-L-cysteine (10 g, 47.8 mmol) in CH ₃ CN (40 mL). After stirring for 15 minutes, iso-butylchloroformate (9.4 mL, 72 mmol) was slowly injected. The reaction was carried out for 3 hours. The white solid was filtered through celite and the filtrate was concentrated to remove CH ₃ CN. The residue was dissolved in ethyl acetate (200 mL), washed with 1N HCl (40ml X 3), brine (40 X 1), and dried over Na ₂ SO ₄ , the desired product ( 2 ) was chromatographed (5% MeOH/ DCM).

Example 13

tert-butyl 4-(3-(tert-butyldisulfanyl)-2-(isobutoxycarbonylamino)propanamido)piperidine-1-carboxylate

HATU (8.58 g, 22.6 mmol) was added to an acid (compound 2 from Example 12, 6.98 g, 22.6 mmol) in DMF (50 ml). After 30 minutes, Hunig base (4.71 ml, 27.1 mmol) and 1-Boc-4-amino piperidine (5.43 g, 27.1 mmol) were added to the mixture. The reaction was continued to stir for 3 more hours at RT. DMF was removed under high vacuum. The crude residue was dissolved in EtAc (300ml) and washed with H ₂ O (50ml X 3). The final product ( 3 ) was obtained after ISCO purification (5% MeOH/DCM).

Example 14

Isobutyl 3-(tert-butyldisulfanyl)-1-oxo-1-(piperidin-4-ylamino)propan-2-ylcarbamate

To compound 3 (7.085g, 18.12mmol) prepared in Example 13, 30ml of 4M HCl/dioxane was added. The reaction was complete after 2 hours at room temperature. The HCl salt ( 4 ) was used for the next step without further purification.

Example 15

Isobutyl 3-(tert-butyldisulfanyl)-1-(1-(dichlorophosphoryl)piperidin-4-ylamino)-1-oxopropan-2-ylcarbamate

POCl ₃ (1.69ml, 18.12mmol) was slowly injected into the compound 4 (7.746g, 18.12mmol) prepared in Example 15 in DCM (200ml) under argon at -78°C, followed by Et ₃ N (7.58ml, 54.36). mmol) was added. The reaction was stirred at room temperature for 5 hours and concentrated to remove excess base and solvent. The product ( 5 ) was provided after ISCO purification (50% EtAc/hexane).

Example 16

Isobutyl 3-(tert-butyldisulfanyl)-1-(1-(chloro(((2S,6R)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidine) -1(2H)-yl)-4-tritylmorpholin-2-yl)methoxy)phosphoryl)piperidin-4-ylamino)-1-oxopropan-2-ylcarbamate

1-((2R,6S)-6-(hydroxymethyl)-4-tritylmorpholin-2-yl)-5-methylpyrimidine-2,4(1H,3H)-dione in DCM (100ml) Lutidine (1.92ml, 16.47mmol) and DMAP (669mg, 5.5mmol) were added to (moT(Tr)) (5.576g, 10.98mmol) at 0 °C, followed by 4 (6.13g, 12.08mmol). . The reaction was stirred at room temperature for 18 hours. The desired product ( 6 ) was obtained after ISCO purification (50% EtAc/hexane).

Example 17

((2S,6R)-6-(5-methyl-2,4-dioxo-3,4-dihydropyridin-1(2H)-yl)-4-tritylmorpholin-2-yl)methyl hexyl (Methyl) phosphoramidochloridate

In a DCM (80ml) solution of N-hydroxymethylamine (4.85ml, 32mmol) was cooled at -78°C under N2. A solution of phosphoryl chloride (2.98 ml, 32 mmol) in DCM (10 ml) was added slowly followed by a solution of Et ₃ N (4.46 ml, 32 mmol) in DCM (10 ml). With continued stirring, the reaction was allowed to warm to room temperature overnight. The desired product ( 1 ) was obtained as a clear oil after ISCO purification (20% EtAc/hexane).

Lutidine (3.68ml, 31.6mmol) and DMAP (642mg, 5.27mmol) were added to moT(Tr) (5.10g, 10.54mmol) in DCM (100ml) at 0°C, followed by 1 (4.89g, 21.08mmol) Was added. The reaction was stirred at room temperature for 18 hours. The desired product ( 2 ) was obtained after ISCO purification (50% EtOAc/hexane).

Example 18

((2S,6R)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methyl Dodecyl (methyl) phosphoramidochloridate

The title compound was prepared according to the general procedure described in Examples 6 and 8.

Example 19

((2S,6R)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methyl Morpholinophosphonochloridate

The title compound was prepared according to the general procedure described in Examples 6 and 8.

Example 20

((2S,6R)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methyl (S)-2-(methoxymethyl)pyrrolidin-1-ylphosphonochloridate

The title compound was prepared according to the general procedure described in Examples 6 and 8.

Example 21

((2S,6R)-6-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-tritylmorpholin-2-yl)methyl 4-(3,4,5-trimethoxybenzamido)piperidin-1-ylphosphonochloridate

Hunig base (1.74ml, 10mmol) was added to 1-Boc-4-piperidine (1g, 5mmol) in DCM (20ml), followed by 3,4,5-trimethoxybenzoyl chloride (1.38g, 6mmol). Added. The reaction was carried out at room temperature for 3 hours and concentrated to remove the solvent and excess base. The residue was dissolved in EtAc (100ml), washed with 0.05N HCl (3 X 15ml), saturated NaHCO ₃ (2 X 15ml) and dried over Na ₂ SO ₄ . Product (1) was obtained after ISCO purification (5% MeOH/DCM).

To 7 was added 15 ml of 4N HCl/dioxane, and the reaction was stopped after 4 hours. 8 was obtained as a white solid.

A solution of 8 (1.23 g, 4.18 mmol) of DCM (20 ml) was cooled to -78 °C under N ₂ . A solution of phosphoryl chloride (0.39 ml, 4.18 mmol) was added slowly followed by a solution of Et ₃ N (0.583 ml, 4.18 mmol) in DCM (2 ml). With continued stirring, the reaction was allowed to warm to room temperature overnight. The desired product ( 9 ) was obtained after ISCO purification (50% EtAc/hexane).

Lutidine (0.93ml, 8mmol) and DMAP (49mg, 0.4mmol) were added to moT(Tr) (1.933g, 4.0mmol) in DCM (20ml) at 0°C, followed by 9 (1.647g, 4mmol). I did. The reaction was kept stirring overnight at room temperature. The desired product ( 10 ) was obtained after ISCO purification (50% EtAc/hexane).

Example 22

Synthesis of cyclophosphoramide-containing subunit ( ^cp T)

The moT subunit (25 g) was suspended in DCM (175 ml) and NMI (N-methylimidazole, 5.94 g, 1.4 equivalent) was added to obtain a clear solution. Tosyl chloride was added to the reaction mixture and the reaction progress was monitored by TCL until it was carried out (about 1 hour). The aqueous workup was washed with 0.5 M citric acid buffer (pH=5) followed by brine. The organic layer was separated and dried over Na ₂ SO ₄ . The solvent was removed by rotary evaporator to give the crude product and used for the next step without further purification.

The prepared moT tosylate was mixed with propanolamine (1 g/10 ml). The reaction mixture was then placed in an oven at 45° C. overnight and then diluted with DCM (10 ml). Aqueous workup was performed by washing with 0.5 M citric acid buffer (pH=5) followed by brine. The organic layer was separated and dried over Na ₂ SO ₄ . The solvent was removed by rotary evaporator to obtain a crude product. The crude product was analyzed and measured by NMR and HPLC to prepare for the next step without further purification.

The crude product was dissolved in DCM (2.5 ml DCM/g, 1 eq) and mixed with DIEA (3 eq). This solution was cooled with dry ice-acetone and POCl ₃ was added dropwise (1.5 equivalents). The resulting mixture was stirred at room temperature overnight. Aqueous workup was performed by washing with 0.5 M citric acid buffer (pH=5) followed by brine. The organic layer was separated and dried over Na ₂ SO ₄ . The solvent was removed by rotary evaporator to give the product as a yellow solid. The crude product was purified by silica gel chromatography (crude product/silica=1 to 5 ratio, gradient DCM to 50% EA/DCM), and fractions were pooled according to TLC analysis. Removal of the solvent gave the desired product as a mixture of diastereomers. The purified product was analyzed by HPLC (NPP quench) and NMR (H-1 and P-31).

The diastereomer mixture was analyzed according to the following procedure. The mixture (2.6 g) was dissolved in DCM. These samples were loaded onto a RediSepRf column (80 g normal, manufactured by Teledyne Isco) and eluted with 10% EA/DCM to 50% EA/DCM over 20 minutes. Fractions were collected and analyzed by TLC. Fractions were collected according to TLC analysis and the solvent was removed by rotary evaporator at room temperature. The diastereomer ratio of the collected fractions was determined by P-31 NMR and NPP-TFA analysis. If necessary, the above procedure was repeated until the diastereoisomer ratio reached 97%.

Example 23

PMOplus' global cholic acid

The succinimide activated cholic acid derivative was prepared according to the following procedure. Cholic acid (12 g, 29.4 mmol), N-hydroxysuccinimide (4.0 g, 34.8 mmol), EDCI (5.6 g, 29.3 mmol), and DMAP (1 g, 8.2 mmol) were charged to a round bottom flask. DCM (400 ml) and THF (40 ml) were added to dissolve. The reaction mixture was stirred at room temperature overnight. Then water (400 ml) was added to the reaction mixture, and the organic layer was separated and washed with water (2X 400 ml), followed by saturated NaHCO ₃ (300 ml) and brine (300 ml). Then, the organic layer was dried over Na ₂ SO ₄ . The solvent was removed by rotary evaporator to obtain a white solid. The crude product was dissolved in chloroform (100 ml) and precipitated in heptane (1000 ml). The solid was collected by filtration, analyzed by HPLC and NMR and used without further purification.

An appropriate amount of PMOplus (20 mg, 2.8 μmol) was expanded into a vial (4 ml) and dissolved in DMSO (500 ul). Activated cholate ester (13 mg, 25 μmol) was added to the reaction mixture according to the ratio of 2 equivalents of active ester per deformation state, and then stirred at room temperature overnight. The reaction progress was determined according to MALDI and HPLC (C-18 or SAX).

After the reaction was complete (as determined by the disappearance of starting PMOplus), 1 ml of concentrated ammonia was added to the reaction mixture when the reaction was complete. The reaction vial was then placed in an oven (45° C.) overnight (18 hours), then cooled to room temperature and diluted with 1% ammonia in water (10 ml). This sample was loaded onto an SPE column (2 cm) and the vial was rinsed with 1% ammonia solution (2X 2ml). The SPE column was washed with 1% ammonia in water (3X 6 ml) and the product was eluted with 45% acetonitrile in 1% ammonia in water (6 ml). Fractions containing oligomers were identified by UV light density measurement. The product was separated by lyophilization. Purity and identity were determined by MALDI and HPLC (C-18 and/or SAX).

This same procedure is applicable to deoxycholic acid activation and conjugation to PMO ⁺ .

Example 24

Global Guanidinylation of PMOplus

An appropriate amount of PMOplus (25 mg, 2.8 μmol) was increased in a vial (6 ml). 1H-Pyrazole-1-carboxamide chloride (15 mg, 102 μmol) and potassium carbonate (20 mg, 0.15 mmol) were added to the vial. Water was added (500 ul) and the reaction mixture was stirred at room temperature overnight (about 18 hours). The completion of the reaction was determined by MALDI.

When the reaction was complete, the reaction was diluted with 1% ammonia in water (10 ml) and loaded onto an SPE column (2 cm). The vial was rinsed with 1% ammonia solution (2X 2ml) and the SPE column was washed with 1% ammonia in water (3X 6ml). The product was eluted with 45% acetonitrile in 1% ammonia in water (6 ml). Fractions containing oligomers were identified by UV light density measurement. The product was isolated by lyophilization. Purity and identity were determined by MALDI and HPLC (C-18 and/or SAX).

Example 25

Global thioacetyl modification of PMOplus (M23D)

An appropriate amount of PMOplus (20 mg, 2.3 μmol) was expanded into a vial (4 ml) and dissolved in DMSO (500 ul). N-succinimidyl-S-acetylthioacetate (SATA) (7 mg, 28 μmol) was added to the reaction mixture and stirred at room temperature overnight. The reaction progress was monitored by MALDI and HPLC.

Once complete, 1% ammonia in water was added to the reaction mixture and stirred at room temperature for 2 hours. This solution was loaded onto an SPE column (2 cm). The vial was rinsed with 1% ammonia solution (2X 2ml) and the SPE column was washed with ammonia in water (3X 6ml). The product was washed with 45% acetonitrile in 1% ammonia in water (6 ml). Fractions containing oligomers were identified by UV light density measurement. The product was isolated by lyophilization. Purity and identity were determined by MALDI and HPLC (C-18 and/or SAX).

Example 26

Global succinic acid variant of PMOplus

An appropriate amount of PMOplus (32 mg, 3.7 μmol) was expanded into a vial (4 ml) and dissolved in DMSO (500 ul). N-ethyl morpholino (12 mg, 100 μmol) and succinic anhydride (10 mg, 100 μmol) were added to the reaction mixture and allowed to warm at room temperature overnight. Reaction progress was monitored by MALDI and HPLC.

Once complete, 1% ammonia in water was added to the reaction mixture and stirred at room temperature for 2 hours. This solution was loaded onto an SPE column (2 cm). The vial was rinsed with 1% ammonia solution (2X 2ml) and the SPE column was washed with 1% ammonia in water (3X 6ml). The product was eluted with 45% acetonitrile in 1% ammonia in water (6 ml). Fractions containing oligomers were identified by UV light density measurement. The product was isolated by lyophilization. Purity and identity were determined by MALDI and HPLC (C-18 and/or SAX).

The above procedure is likewise applicable to the modification of glutaric acid (glutaric anhydride) and tetramethyleneglutaric acid (tetramethyleneglutaric anhydride) of PMOplus.

Example 27

Preparation of oligonucleotide analogs containing modified end groups

Farnesyl bromide (1.75 μl, 6.452 μmol) and diisopropylethylamine (2.24 μl, 12.9 μmol) in a solution of 25-mer PMO containing the free 3'-end (27.7 mg, 3.226 μmol) in DMSO (300 μl) ) Was added. The reaction mixture was stirred at room temperature for 5 hours. The crude reaction mixture was diluted with 10 mL of 1% aqueous NH ₄ OH and then poured onto a 2 mL Amberchrome CG300M column. The column was then rinsed with 3 column volumes of water, and the product was eluted with 6 mL of 1:1 acetonitrile and water (v/v). Subsequently, the solution was lyophilized to obtain the title compound as a white solid.

Example 28

Preparation of morpholino oligomer

Preparation of trityl piperazine phenyl carbamate 35 (see FIG. 3): potassium carbonate (3.2 equivalents) in water (4 mL/g potassium carbonate) to a cooled solution of compound 11 in dichloromethane (6 mL/g 11) Was added. To this two-stage mixture was slowly added a solution of phenyl chloroformate (1.03 eq) in dichloromethane (2 g/g phenyl chloroformate). The reaction mixture was warmed to 20°C. At the end of the reaction ((1-2 hours), the layers were separated. The organic layer was washed with water and dried over anhydrous potassium carbonate Product 35 was separated from acetonitrile by crystallization, yield = 80%.

Preparation of carbamate alcohol 36: Sodium hydride (1.2 eq) was suspended in 1-methyl-2-pyrrolidinone (32 mL/g sodium hydride). To this suspension were added triethylene glycol (10.0 eq) and compound 35 (1.0 eq). The resulting slurry was heated to 95°C. At the end of the reaction (1 to 2 hours), the mixture was cooled to 20°C. To this mixture 30% dichloromethane/methyl tert-butyl ether (v:v) and water were added. The product-containing organic layer was washed successively with aqueous NaOH, aqueous succinic acid, and saturated aqueous sodium chloride. Product 36 was isolated by crystallization from dichloromethane/methyl tert-butyl ether/heptane. Yield = 90%.

Preparation of tail acid 37: To a solution of compound 36 in tetrahydrofuran (7 mL/g 36) was added succinic anhydride (2.0 eq) and DMAP (0.5 eq). The mixture was heated to 50°C. At the end of the reaction (5 hours), the mixture was cooled to 20° C. and adjusted to pH 8.5 with aqueous NaHCO3. Methyl tert-butyl ether was added and the product was extracted into the aqueous layer. Dichloromethane was added and the mixture was adjusted to pH 3 with aqueous citric acid. The product-containing organic layer was washed with a mixture of pH=3 citrate buffer and saturated aqueous sodium chloride. This dichloromethane solution of 37 was used without separation in the preparation of compound 38.

Preparation 38: N-hydroxy-5-norbornene-2,3-dicarboxylic acid imide (HONB) (1.02 equivalent), 4-dimethylaminopyridine (DMAP) (0.34 equivalent) to the solution of compound 37 , And 1-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC) (1.1 eq) were added. The mixture was heated to 55°C. Upon completion of the reaction (4-5 hours), the mixture was cooled to 20° C. and washed successively with 1:1 0.2 M citric acid/brine and brine. The dichloromethane solution was subjected to solvent exchange with acetone followed by N,N-dimethylformamide and the product was separated by precipitation from acetone/N,N-dimethylformamide in saturated aqueous sodium chloride. The crude product was re-slurried several times in water to remove residual N,N-dimethylformamide and salt. The yield of 38 from compound 36 = 70%. Introduction of the activated tail onto the disulfide anchor resin was carried out in NMP by the procedure used for the introduction of subunits during solid phase synthesis.

Preparation of solid support for the synthesis of morpholino oligomers:

This procedure was performed in a landscaped porous (40-60 μm) glass frit, an overhead stirrer, and silanization with a 3-way Teflon stopcock, a jacketed peptide vessel (made to order from ChemGlass, NJ, USA) to extract frit or vacuum. N2 was bubbled through. Temperature control was carried out in the reaction vessel by means of a circulating water bath.

The resin treatment/washing step in the following procedure consists of two basic operations: resin fluidization and solvent/solution extraction. In the case of resin fluidization, a stopcock is placed to flow N2 through the frit and specified resin treatment/wash, added to the reactor, and permeated to completely wet the resin. Mixing was then started and the resin slurry was mixed for the specified time. In the case of solvent/solution extraction, mixing and N2 flow are stopped, a vacuum pump is started, and a stopcock is placed to treat/wash the resin to discharge the residue. All resin treatment/wash volumes were 15 mL/g of resin unless otherwise indicated.

1-methyl-2-pyrroly in aminomethylpolystyrene resin (100-200 mesh; ~1.0 mmol/g N2 substitution; 75 g, 1 equivalent, Polymer Labs, UK, Part #1464-X799) in a silanized jacketed peptide container Don (NMP; 20 ml/g resin) was added and the resin swelled while mixing for 1-2 hours. After draining of the swollen solvent, the resin was washed with 25% isopropanol/dichloromethane (2 x 3-4 min) and dichloromethane (2 x 1-2 min). After discharge of the final wash, the resin was fluidized with a solution of disulfide anchor 34 in 1-methyl-2-pyrrolidinone (0.17 M; 15 mL/g resin, -2.5 equivalents), and the resin/reagent mixture was 60 at 45°C. Heated for hours. Upon completion of the reaction, heating was stopped, the anchor solution was discharged, and the resin was washed with 1-methyl-2-pyrrolidinone (4 x 3-4 min) and dichloromethane (6 x 1-2 min). The resin was treated with a solution of 10% (v/v) diethyl dicarbonate in dichloromethane (16 mL/g; 2 x 5-6 min) and then washed with dichloromethane (6 x 1-2 min). Resin 39 (see FIG. 4) was dried under N2 flow for 1-3 hours and then under vacuum to constant weight (±2%). Yield by weight of initial resin: 110-150%.

Determination of the loading of aminomethylpolystyrene-disulfide resin:

The load of the resin (number of potentially available reactive moieties) was determined by spectrometric analysis for the number of triphenylmethyl per gram of resin.

A known weight of dry resin (25±3 mg) was transferred to a silanized 25 ml volumetric flask and -5 mL of 2% (v/v) trifluoroacetic acid in dichloromethane was added. The contents were mixed with light stirring and then allowed to stand for 30 minutes. The volume was raised to 25 mL with an additional 2% (v/v) trifluroacetic acid in dichloromethane and the contents were thoroughly mixed.

An aliquot of trityl-containing solution (500 μL) was transferred to a 10 mL volumetric flask using a positive displacement pipette and the volume was raised to 10 mL using methanesulfonic acid.

The trityl cation content in the final solution was measured by UV absorption at 431.7 nm, and the resin loading was determined by using an appropriate volume, dilution, extinction coefficient (ε: 41 μmol-1 cm-1) and resin weight, and trityl groups per gram resin (μmol). /g). The analysis was performed three times and the average load was calculated.

The resin loading in this example provides a loading of approximately 500 μmol/g to the resin. A load of 300-400 μmol/g was obtained when the disulfide anchor introduction step was carried out at room temperature for 24 hours.

Tail loading: Using the same setup and volume for the preparation of aminomethylpolystyrene-disulfide resin, the tail can be introduced into the molecule. For the coupling step, a solution of 38 (0.2 M) in 4-ethylmorpholine (NEM, 0.4 M) containing NMP was used instead of the disulfide anchor solution. After 2 hours at 45° C., Resin 39 was washed twice with 25% isopropanol/5% diisopropylethylamine in dichloromethane and also once with DCM. To the resin was added a solution of benzoic anhydride (0.4 M) and NEM (0.4 M). After 25 minutes the reaction jacket was cooled to room temperature and the resin was washed twice with 25% isopropanol/5% diisopropylethylamine in dichloromethane and once with DCM. Resin 40 was filtered and dried under high vacuum. The load on resin 40 is defined as being the load of the earliest aminomethylpolystyrene-disulfide resin 39 used in the tail load.

Solid phase synthesis: The morpholino oligomer was prepared on a Gilson AMS-422 automated peptide synthesizer in a 2 mL Gilson polypropylene reaction column (Part # 3980270). Aluminum blocks with channels for water flow are placed around the column as they are fixed on the synthesizer. AMS-422 alternately adds reagent/wash solutions, holds for a specified period of time, and evacuates the column using vacuum.

For oligomers in the range of up to about 25 subunits in length, aminomethylpolystyrene-disulfide resins having a loading of around 500 μmol/g of the resin are preferred. For larger oligomers. Aminomethylpolystyrene-disulfide resins having a load of 300-400 μmol/g of the resin are preferred. If a molecule with a 5'-tail is desired, the resin loaded with the tail is chosen with the same loading guidelines.

The following reagent solutions were prepared:

Detritylation solution: 10% cyanoacetic acid in 4:1 dichloromethane/acetonitrile (w/v); Neutralization solution: 5% diisopropylethylamine in 3:1 dichloromethane/isopropanol; Coupling solution: 0.18 M (or 0.24 M for oligomers grown longer than 20 subunits) activated morpholino subunits of the desired base and binding type, and 0.4 M N ethyl morpholine in 1,3-dimethylimidazolidinone. Dichloromethane (DCM) was used as an intermediate wash to separate washings of different reagent solutions.

On a synthesizer, using a block fixed at 42° C., 2 mL of 1-methyl-2-pyrrolidinone was added to each column containing 30 mg of aminomethylpolystyrene-disulfide resin (or tail resin) and room temperature Let stand for 30 minutes. After washing twice with 2 mL of dichloromethane, the following synthesis cycle was used:

Phase Volume Delivery Duration

Detritylation 1.5 mL manifold 15 seconds

Detritylation 1.5 mL manifold 15 seconds

Detritylation 1.5 mL manifold 15 seconds

Detritylation 1.5 mL manifold 15 seconds

Detritylation 1.5 mL manifold 15 seconds

Detritylation 1.5 mL manifold 15 seconds

DCM 1.5 mL manifold 30 sec

Neutralized 1.5 mL manifold 30 sec

Neutralized 1.5 mL manifold 30 sec

Neutralized 1.5 mL manifold 30 sec

Neutralized 1.5 mL manifold 30 sec

Neutralized 1.5 mL manifold 30 sec

Neutralized 1.5 mL manifold 30 sec

DCM 1.5 mL manifold 30 sec

Coupling 350 uL-500 uL syringe 40 minutes

DCM 1.5 mL manifold 30 sec

Neutralized 1.5 mL manifold 30 sec

Neutralized 1.5 mL manifold 30 sec

DCM 1.5 mL manifold 30 sec

DCM 1.5 mL manifold 30 sec

DCM 1.5 mL manifold 30 sec

The sequences of the individual oligomers were programmed in the synthesizer so that each column received the appropriate coupling solution (A,C,G,T,I) in the appropriate sequence. When the oligomer in the column had completed the introduction of its final subunit, the column was removed from the block and the final cycle was a couple of 4-methoxytriphenylmethyl chloride (0.32 M in DMI) containing 0.89M 4-ethylmorpholine. This was done manually with the ring solution.

Cleavage from the resin and removal of base and backbone protecting groups: After methoxytritylation, the resin was washed 8 times with 2 mL 1-methyl-2-pyrrolidinone. 1 mL of cleavage solution consisting of 0.1 M 1,4-dithiopreitol (DTT) and 0.73 M triethylamine in 1-methyll-2-pyrrolidinone was added, the column was capped, and at room temperature for 30 min. Let it stand for a while. Afterwards, the solution was drained into a 12 mL Wheaton vial. The greatly contracted resin was washed twice with 300 µl of cutting solution. To the solution was added 4.0 mL concentrated aqueous ammonia (stored at -20° C.), the vial was capped tightly (with a Teflon line screw cap) and the mixture was stirred to mix the solution. The vial was placed in an oven at 45° C. for 16-24 hours to effect cleavage of the base and backbone protecting groups.

Initial oligomer separation: The vial ammonolisis solution was removed from the oven and cooled to room temperature. The solution was diluted with 20 mL of 0.28% aqueous ammonia and passed through a 2.5x10 cm column containing Macroprep HQ resin (BioRad). A salt gradient (A: 0.28% ammonia with B: 1 M sodium chloride in 0.28% ammonia; 0-100% B 60 min) was used to elute the methoxytrityl containing peak. The combined fractions were collected and further processed depending on the desired product.

Demethoxytritylation of morpholino oligomers: Fractions collected from Macroprep purification were treated with 1 M H3PO4 to lower the pH to 2.5. After initial mixing, the samples were allowed to stand at room temperature for 4 minutes at which time they were neutralized to pH 10-11 with 2.8% ammonia/water. The product was purified by solid phase extraction (SPE).

Amberchrome CG-300M (Rohm and Haas; Philadelphia, PA) (3 mL) was packaged in a 20 mL frit column (BioRad Econo-Pac Chromatography Columns (732-1011)) and the resin was rinsed with 3 ml of the following reagents: 0.28% NH4OH/80% acetonitrile; 0.5M NaOH/20% ethanol; water; 50 mM H3PO4/80% acetonitrile; water; 0.5 NaOH/20% ethanol; water; 0.28% NH4OH.

The solution from demethoxytritylation was loaded onto a column and the resin was rinsed three times with 3-6 mL 0.28% aqueous ammonia. A Wheaton vial (12 mL) was placed on the column and the product was eluted by washing twice with 2 mL of 45% acetonitrile in 0.28% aqueous ammonia. The solution was frozen on dry ice and the vial was placed in a freeze dryer to produce a fluffy white powder. The sample is dissolved in water, filtered through a 0.22 micron filter (Pall Life Sciences, Acrodisc 25 mm syringe filter, with 0.2 micron HT Tuffryn membrane) using a syringe and the optical density (OD) is measured on a UV spectrometer to determine the oligomer present. The OD units of as well as the variance samples for analysis were determined. The solution was then put back into the Wheaton vial for lyophilization.

Analysis of morpholino oligomers: A MALDI-TOF mass spectrometer is used to determine the composition of the fractions in purification as well as provide evidence for the identity (molecular weight) of the oligomers. Samples were 3,5-dimethoxy-4-hydroxycinnamic acid (cinnapic acid), 3,4,5-trihydroxyacetophenone (THAP) or alpha-cyano-4-hydroxycinnamic acid (HCCA) as a matrix. ) Was used after dilution.

Cation exchange (SCX) HPLC is performed at 25 mM pH=5 sodium acetate 25% acetonitrile (buffer A) and 25 mM pH=5 sodium acetate 25% acetonitrile 1.5 M potassium chloride (buffer B) (gradient 10-100% B in 15 min) or 25 mM KH2PO4 25% acetonitrile (buffer A) at pH=3.5 and 25 mM KH2PO4 25% acetonitrile (buffer B) at pH 3.5 with 1.5 M potassium chloride (gradient 0-35% B in 15 min) It was carried out using a used Dionex ProPac SCX-10, 4x250mm column (Dionex Corporation; Sunnyvale, CA). The former system is used for positively charged oligomers that do not have an attached peptide, while the latter system is used for peptide conjugates.

Purification of morpholino oligomers by cation exchange chromatography:

Samples were dissolved in 20 mM sodium acetate, pH=4.5 (buffer A) and applied to a source 30 cation exchange resin column (GE Healthcare) and 20 mM sodium acetate and 40% acetonitrile, 0.5 M in pH=4.5 (buffer B). It was eluted with a gradient of sodium chloride. The combined fractions containing the product were neutralized with concentrated aqueous ammonia and applied to an Amberchrome SPE column. The product was eluted, frozen, and lyophilized as above.

Example 29

Preparation of exemplary conjugates

The peptide sequence AcR ₆ G was prepared according to a standard peptide synthesis method known in the art. PMO in DMSO (3 mL) (NG-05-0225, 3'-H: M23D: 5'-EG3, sequence for binding to exon 23 of mdx mouse, 350 mg, 1 equivalent), AcR6G (142 mg, 2 eq), to a solution of HATU (31 mg, 2 eq) was added diisopropylethylamine (36 μl, 5 eq) at room temperature. After 1 hour, the reaction was worked up and the desired peptide-oligomeric conjugate was subjected to SCX chromatography (A: 25% acetonitrile/20 mM NaH2PO4 in H2O, pH 7.0; B: 1.5 M guanidine HCl and 20 in 25% acetonitrile/H2O. mM NaH2PO4, eluting with a gradient of pH 7.0). The combined fractions were subjected to solid phase extraction (1M NaCl, then water elution). The conjugate was obtained as a white powder (257 mg, yield 65.5%) after lyophilization.

Example 30

Treatment of MDX mice of exemplary conjugates of the invention

The MDX mouse is an acceptable and well characterized animal model for Ducsen-type muscular dystrophy (DMD) containing a mutation in exon 23 of the dystrophin gene. The M23D antisense sequence (SEQ ID NO:15) is known to induce exon 23 skipping and restoration of functional dystrophin formation. MDX mice were administered once by tail vein glance as one of the following conjugates (50 mg/kg):

1. 5'-EG3-M23D-BX(RXRRBR) ₂ (AVI5225);

2. 5'-EG3-M23D-G(R) ₅ (NG-11-0045);

3. 5'-EG3-M23D-G(R) ₆ (NG-11-0009);

4. 5'-EG3-M23D-G(R) ₇ (NG-11-0010); or

5. 5'-EG3-M23D-G(R) ₈ (NG-11-0216)

Where M23D is a morpholine oligonucleotide with the sequence GGCCAAACCTCGGCTTACCTGAAAT and also "EG3" has the following structural formula (XXIX) linked to the 5'end of the oligomer via a peptide linker:

One week after injection, MDX mice were sacrificed and RNA was extracted from various muscle tissues. End-point PCR was used to determine the relative abundance of mRNA without exon 23 and dystrophin mRNA containing exon 23 due to antisense-induced exon skipping. Percent exon 23 skipping is a measure of antisense activity in vivo. Figures 5 and 6 show the results from the quadriceps muscle (QC, Figures 5A and 6A), the diaphragm (DT, Figures 5B and 6B) and the heart (HT, Figures 5C and 6C) after one week treatment, respectively. The dose response between AVI-5225 and the other conjugates was similar. Among the arginine family, the R ₆ G peptide has the highest efficacy in the quadriceps and diaphragm and was also similar to other arginine families in the heart.

Example 31

BUN levels and survival of mice treated with exemplary conjugates

Mice were treated with the conjugates described in Example 30, and KIM-1 levels, BUN levels and survival rates were determined according to the general procedures described in Example 32 below and known in the art. Surprisingly, Figure 7A shows that all glycine binding conjugates had significantly lower BUN levels than the XB binding conjugate (AVI-5225). In addition, mice treated with the glycine-binding conjugate survived longer at higher doses than the XB-binding conjugate (FIG. 7B ), and the R ₈ G conjugate is the least tolerant of the arginine polymer. All mice treated with the R ₆ G conjugate (NG-11-0009) survived at doses up to 400 mg/kg (data not shown).

KIM-1 (Figure 8A) and clusterin (Figure 8B) of mice treated with glycine binding conjugates were significantly lower than mice treated with AVI-5225. These data indicate that the conjugates of the present invention have a lower toxicity than the prior art conjugates, and the efficacy of the conjugates is not reduced as shown above in Example 30. Thus, this conjugate has a better treatment window than other known conjugates and is also a potentially better drug candidate.

Example 32

Toxicology of exemplary conjugates

Four exemplary conjugates of the invention were tested for their toxicology in mice. The conjugate was as follows:

1. 5'-EG3-M23D-BX(RXRRBR) ₂ (AVI5225);

2. 5'-EG3-M23D-G(RXRRBR) ₂ (NG-11-0654);

3. 5'-EG3-M23D-BX(R) ₆ (NG-11-0634); And

4. 5'-EG3-M23D-G(R) ₆ (NG-11-0009)

Where M23D is a morpholino oligonucleotide having the sequence GGCCAAACCTCGGCTTACCTGAAAT and also "EG3" has the following structural formula (ie structural formula XXIX) linked to the 5'end of the oligomer via a piperazine linker:

8 week old male mice (C57/BL6; Jackson Laboratories, 18-22 grams) were treated with the conjugate formulated in saline. Mice were acclimated for a minimum of 5 days prior to initiation of the experimental procedure.

Animals were housed up to 3 per cage in transparent polycarbonate microisolator cages with certified contact bedding. Cages were identified with the standards described in the Animal Protection Act (including all amendments) and the Guide to Care and Use of Laboratory Animals, National Academy Press, Washington, D.C., 2010.

Animals were randomly ordered into treatment groups based on cage weights specified in the table below. Group assignments were documented in test records.

Table 8. Toxicology study design

The administration day for this test was designated as test day 1. The conjugate was administered to the tail vein as a slow push mass (~5 sec). All animals were administered over 2 days. Groups 1 to 8 were administered on the first day and groups 9 to 16 were administered on the second day. Treatment groups (TG) 13-16 were administered according to the table below. Results from these TGs did not affect the progression of other TGs. The first 2 TGs of each conjugate were administered according to the table above. When all animals died in the 100 mg/kg group, the test was ended without administration of the remaining TG of the test product. At least one animal survived after 2 hours of administration in the 100mg/kg group, followed by the 150mg/kg group. Next, when all animals died in the 150 mg/kg group, the test was ended without administration of the remaining TG of the test product. At least one animal survived after 2 hours in the 150mg/kg group, followed by the 200mg/kg group.

Animals were observed for mortality and mortality once daily. Any animals showing signs of distress, especially when death is imminent, are humanely comforted according to the standard Numira Biosciences treatment procedures. Body weight was recorded on the date of arrival, administration and necropsy. Detailed clinical observations were performed and recorded after 0 minutes, 15 minutes and 2 hours of administration to evaluate the tolerability of the administration.

Blood samples (maximum volume, approximately 1 mL) were obtained from all animals via cardiac puncture after 3 days of administration prior to necropsy. Blood samples were collected in red top microtainer tubes and held at room temperature for 30 minutes but within 10 minutes prior to centrifugation. Samples were centrifuged at approximately 1500-2500 rpm for 15-20 minutes to obtain serum.

Animals that were unlikely to survive until the next planned observation were increased and euthanized. Animals found to be killed were increased and the time of death was assessed as closely as possible. Blood and tissue samples were not collected.

On day 3 (day 2 after dosing), all animals were humanely euthanized with carbon dioxide. Euthanasia was performed in June 2007 in accordance with the approved American Veterinary Medical Association (AVMA) guidelines for euthanasia.

A partial full autopsy included examination and documentation of the findings. All outer surfaces and holes were evaluated. All abnormalities observed during tissue collection were fully described and recorded. No additional organization was taken.

Right and left kidneys were collected. Tissue was collected within 15 minutes or less of euthanasia. All instruments and tools used varied between treatment groups. All tissues were flash frozen and stored at <-70°C as soon as possible after collection.

Kidney damage markers were obtained as follows. RNA from mouse kidney tissue was purified using Quick Gene Mini80 Tissue Kit SII (Fujifilm). Briefly, approximately 40 mg of tissue is added to 0.5 ml lysis buffer (5 μl 2-mercaptoethanol in 0.5 ml lysis buffer) in a MagnaLyser green bead vial (Roche), 2 sets of 3x 3800 RPM and 3 sets of 1x Homogenized using MagNA Lyser (Roche) with 6500 RPM. Samples were cooled in 3-4 minutes between each low speed set and between each high speed run. The homogenate was centrifuged at 400 x g for 5 minutes at room temperature. The homogenate was processed immediately for RNA purification according to the Quick Gene Mini80 protocol. Samples were subjected to on-column DNA digestion with DNase I (Qiagen) for 5 minutes. Total RNA was quantified with a NanoDrop 2000 spectrometer (Thermo Scientific).

qRT-PCR was performed using Applied Bioscience reagent (1-step RT-PCR), and a primer/probe set (ACTB, GAPDH, KIM-1, Clusterin-FAM reporter) was designed in advance.

Each reaction contained the following (total 30 ul):

15ul 2x qRT-PCR buffer from ABI One-Step Kit

1.5ul primer/probe mix

8.75 ul nuclease-free water

0.75ul 40x multiscript + RNase inhibitor

4 ul RNA template (100 ng/ul)

The qRT Phase 1 program was performed as follows:

1.48C for 30 minutes

2. 95C for 10 minutes

3. 95C for 15 seconds

4. 60C for 1 minute

5. Repeat steps 3-4 39 times for a total of 40 cycles

Samples were run in 3 wells and averaged for further analysis. Analysis was performed using the ΔΔCt method. In short, experimental ΔCt [Ct (target)-Ct (reference)] was subtracted by control ΔCt [Ct (target)-Ct (reference)] = ΔΔCt. The range of fold change was calculated as follows: 2^-(ΔΔCt+SD) to 2^-(ΔΔCt-SD). Control=excipient treated animal group (collected), target=KIM-1; Reference=GAPDH; SD= Sqrt[(SD target^2)+(SDref^2)].

The results of the KIM data are shown in FIG. 10. Conjugates comprising a carrier peptide with terminal glycine have a low KIM concentration using the lowest R ₆ G peptide. The presence of the terminal G and the unnatural amino acid (aminohexanoic acid) appears to play a role in the toxicity of the conjugate.

Frozen serum samples were sent on dry ice to IDEXX laboratories (West Sacramento, CA) for processing. Serum dilution was performed according to IDEXX standard processing procedures (SOP) as needed. Blood chemistry results were analyzed. Hematuria nitrogen levels are shown in Figure 11. Again, the G-linked conjugate had a low BUN level and also the terminal G and the entire peptide sequence both appear to play a role in the toxicology profile of the conjugate.

Kidney tissue (approximately 150 mg) was accurately weighed in 2 mL screw cap vials partially filled with ceramic beads. 5 volumes of Tissue PE LB buffer (G Biosciences) containing 10 U/mL protease K (Sigma) was added to 1 part tissue. Samples were homogenized with Roche MagnaLyser (4 x 40 sec @ 7,000 rpm, cooling between runs) and incubated at 40° C. for 30 minutes. If necessary, the tissue homogenate was diluted with BSAsal (3mg/mL BSA + 20mM NaCl) to bring a high sample concentration within the calibration range.

Calibration samples were prepared by spiking a solution of 3 mg/mL of BSA in 20 mM NaCl using a known amount of an appropriate analytical reference standard. Two sets of 8 samples were prepared each. ULOQ was 40 μg/mL and LLOQ was 0.065536 μg/mL. An internal standard (NG-07-0775) was added to all samples except some blank samples designated as double blanks (no drug, no internal standard). Samples were extracted by stirring 100 μL aliquots with 3 volumes of methanol.

After centrifugation (15 minutes, 14,000 rpm), the supernatant was transferred to a new tube and dried in Speedvac. The dried samples were reconstituted with an appropriate amount of FDNA (5' d FAM-ATTTCAGGTAAGCCGAGGTTTGGCC 3') in [10 mM Tris pH 8.0 + 1 mM EDTA + 100 mM NaCl]-acetonitrile (75-25).

Samples were run on a Dionex UltiMate 3000 HPLC using anion exchange chromatography (Dionex DNAPac 4x250 mm column). The injection volume was 5 μL. The mobile phase consisted of a gradient of 80% water containing 20% acetonitrile and 25 mM Tris pH 8.0 and increasing NaCl concentration. The flow rate was 1 mL/min, and the number of runs was 10 minutes per sample. The fluorescence detector was fixed at EX 494 nm and EM 520 nm. Peak identification was based on retention time. Peak height ratio (analyte:internal standard) was used for quantification. The calibration curve was calculated based on the average response factor of the two test samples (one set run at the beginning of the batch, and another set run at the end of the batch). A linear curve matching the 1/x basis weight factor was used. A blank sample (a test sample without addition of a reference compound) and two blank samples (added internal standard) were used to ensure the specificity of the assay and the absence of residuals.

12 shows that the kidney concentration is similar among the tested conjugates.

The data show that the conjugates of the present invention have similar efficacy and improved toxicity compared to other conjugates. 9A-D summarize these results for the R ₆ G conjugate (NG-11-0009).

Further embodiments may be provided by combining the various embodiments described above. All US patents, US patent application publications, foreign patents, foreign patent applications, and non-patent publications cited herein and/or listed in the application data sheet are incorporated herein by reference in their entirety. Aspects of the embodiments may be modified as necessary to use the concepts of various patents, applications, and publications to provide further embodiments. These and other changes to the embodiments may be made in view of the detailed description above. In general, the terms used in the following claims should not be construed as limiting the claims to the specific embodiments described in the specification and claims, but the scope and all scopes of equivalents to which such claims are subject Together, it should be interpreted as including all possible embodiments. Therefore, the scope of the claims is not limited to the technical content.

Claims (65)

(a) a carrier peptide comprising 4 to 40 amino acid subunits; And
(b) a nucleic acid analog comprising a substantially uncharged backbone and a target nucleotide sequence for sequence-specific binding to a target nucleic acid
It is a conjugate containing,
Here, the two or more amino acid subunits are positively charged amino acids, the carrier peptide includes a glycine (G) amino acid at the carboxy terminus of the carrier peptide, and 7 or less contiguous amino acid subunits are arginine. , The carrier peptide is covalently attached to the nucleic acid analog,
The uncharged skeleton includes a sequence of a morpholino ring structure linked by a bond between subunits, and the bond between the subunits is 3′ of one morpholino ring structure at the 5′-end of the adjacent morpholino ring structure -Terminals are connected, wherein each morpholino ring structure is bound to a base pair portion, so that the nucleic acid analog can bind to the target nucleic acid in a sequence-specific manner, wherein the binding between the subunits is represented by the following formula (I) Or a conjugate, having a salt thereof:

In the above formula, each of the subunit bonds (I) is independently a bond (A) or a bond (B),
Here in bond (A),
W is at each occurrence independently S or O;
X is independently at each occurrence -N(CH ₃ ) ₂ , -NR ¹ R ² , -OR ³ or

ego;
Y is at each occurrence independently O or -NR ² ;
R ¹ is independently at each occurrence hydrogen or methyl;
R ² is independently at each occurrence hydrogen or -LNR ⁴ R ⁵ R ⁷ ;
R ³ is independently at each occurrence hydrogen or C ₁ -C ₆ alkyl;
R ⁴ is in each case independently hydrogen, methyl, -C(=NH)NH ₂ , -ZL-NHC(=NH)NH ₂ or -[C(O)CHR'NH] _m H, where Z is Carbonyl (C(O)) or a direct bond, R'is a side chain of a naturally occurring amino acid or one- or two-carbon homolog thereof, and m is 1-6;
R ⁵ at each occurrence is independently hydrogen, methyl or an electron pair;
R ⁶ at each occurrence is independently hydrogen or methyl;
R ⁷ is independently at each occurrence hydrogen, C ₁ -C ₆ alkyl or C ₁ -C ₆ alkoxyalkyl;
L is an optional linker of up to 18 elements in length comprising an alkyl, alkoxy or alkylamino group or combinations thereof; In addition
Where in bond (B):
W is at each occurrence independently S or O;
X is at each occurrence independently -NR ⁸ R ⁹ or -OR ³ ; In addition
Y is at each occurrence independently O or -NR ¹⁰ ,
R ⁸ at each occurrence is independently hydrogen or C ₂ -C ₁₂ alkyl;
R ⁹ is independently at each occurrence hydrogen, C ₁ -C ₁₂ alkyl, C ₁ -C ₁₂ aralkyl or aryl;
R ¹⁰ is at each occurrence independently hydrogen, C ₁ -C ₁₂ alkyl or -LNR ⁴ R ⁵ R ⁷ ;
Wherein R ⁸ and R ⁹ may be bonded to form a 5-18 membered mono or bicyclic heterocycle, or R ⁸ , R ⁹ or R ³ may be combined with R ¹⁰ to form a 5-7 membered heterocycle. Can, and when X is 4-piperazino, X has the following structural formula (III):

In the above formula,
R ¹¹ is independently at each occurrence C ₂ -C ₁₂ alkyl, C ₁ -C ₁₂ aminoalkyl, C ₁ -C ₁₂ alkylcarbonyl, aryl, heteroaryl or heterocyclyl;
R is at each occurrence independently an electron pair, hydrogen or C ₁ -C ₁₂ alkyl;
R ¹² is independently at each occurrence of hydrogen, C ₁ -C ₁₂ alkyl, C ₁ -C ₁₂ aminoalkyl, -NH ₂ , -CONH ₂ , -NR ¹³ R ¹⁴ , -NR ¹³ R ¹⁴ R ¹⁵ , C ₁ -C ₁₂ alkylcarbonyl, oxo, -CN, trifluoromethyl, amidyl, amidinyl, amidinylalkyl, amidinylalkylcarbonyl guanidineyl, guanidinylalkyl, guanidineylalkylcarbonyl , Cholate, deoxycholate, aryl, heteroaryl, heterocycle, -SR ¹³ or C ₁ -C ₁₂ alkoxy, wherein R ¹³ , R ¹⁴ and R ¹⁵ are independently at each occurrence C ₁ -C ₁₂ alkyl . The conjugate of claim 1, wherein the carrier peptide comprises 6 to 20 amino acid subunits. The conjugate of claim 1, wherein the positively charged amino acid is histidine (H), lysine (L), arginine (R), or a combination thereof. The conjugate of claim 1, wherein at least one of the positively charged amino acids is arginine. The conjugate according to claim 1, wherein each of the amino acid subunits is a positively charged amino acid, except for the carboxy terminal glycine. The conjugate of claim 1, wherein each of the positively charged amino acids is arginine. The method of claim 1, wherein at least one of the positively charged amino acids is an arginine analog, and the arginine analog is a cationic α-amino acid comprising a side chain of the structure R ^a N=C(NH ₂ )R ^b , wherein R ^a is H or R ^c ; R ^b is R ^c , NH ₂ , NHR or N(R ^c ) ₂ , where R ^c is C ₁ -C ₆ alkyl or C ₂ -C ₆ alkenyl, and also contains or does not contain oxygen or nitrogen, Or R ^a and R ^b may together form a ring, and the side chain is linked to an amino acid through R ^a or R ^b . The conjugate of claim 1, wherein at least 20% of the amino acid subunits are positively charged amino acids. The conjugate of claim 1, wherein at least 50% of the amino acid subunits are positively charged amino acids. The conjugate of claim 1, wherein at least 80% of the amino acid subunits are positively charged amino acids. The conjugate of claim 1, wherein the carrier peptide comprises the sequence (R ^d ) _m , wherein R ^d is an independently positively charged amino acid in each occurrence, and m is an integer ranging from 2 to 12. 12. The conjugate of claim 11, wherein R ^d is at each occurrence independently arginine, histidine or lysine. 12. The conjugate of claim 11, wherein each R ^d is arginine. The conjugate of claim 1, wherein each of the amino acid subunits is arginine, except for the carboxy terminal glycine. The method of claim 1, wherein the carrier peptide comprises at least one hydrophobic amino acid, and the hydrophobic amino acid comprises an alkyl, alkenyl, alkynyl, aryl or aralkyl side chain, wherein the alkyl, alkenyl and alkynyl side chains Conjugates containing at most 1 heteroatom every 6 carbon atoms. 16. The conjugate of claim 15, wherein the carrier peptide comprises two or more hydrophobic amino acids. 16. The conjugate of claim 15, wherein the carrier peptide comprises two or more contiguous hydrophobic amino acids. The conjugate of claim 15, wherein at least one of the hydrophobic amino acids is phenylalanine. The conjugate of claim 15, wherein each of the hydrophobic amino acids is phenylalanine. The conjugate of claim 1, wherein the carrier peptide comprises at least one neutral amino acid having the formula (Y ^b ):

Where n is 2 to 7 and each R ^e is independently hydrogen or methyl at each occurrence. The method of claim 20, wherein the carrier peptide comprises the sequence [(R ^d Y ^b R ^d ) _x (R ^d R ^d Y ^b ) _y ] _z , wherein R ^d is in each case independently a positively charged amino acid , x and y are at each occurrence independently 0 or 1, provided that x + y is 1 or 2, and z is an integer ranging from 1 to 6. The conjugate of claim 21, wherein R ^d is at each occurrence independently arginine, histidine or lysine. 22. The conjugate of claim 21, wherein each R ^d is arginine. 22. The conjugate of claim 21, wherein at least one Y ^b is 6-aminohexanoic acid or β-alanine. The conjugate of claim 1, wherein the carrier peptide comprises the sequence ILFQY. The conjugate of claim 1, wherein the carrier peptide comprises the sequence ILFQ, IWFQ or ILIQ. The conjugate of claim 1, wherein the carrier peptide comprises the sequence PPMWS, PPMWT, PPMFS or PPMYS. The conjugate according to claim 1, wherein at least one of the subunit bonds is a bond (A). The conjugate of claim 1, wherein X in at least one bond (A) is -N(CH ₃ ) ₂ . The conjugate according to claim 1, wherein X in at least one bond (A) has the following structural formula:

. The conjugate of claim 1, wherein X in at least one bond (B) has the following structural formula:

. The conjugate of claim 1, wherein X in at least one bond (B) has the following structural formula:

. The conjugate of claim 1, wherein W and Y are each O in each case. The conjugate of claim 1, wherein the nucleic acid analog has the structure of the following formula (XVII) or a salt thereof:

(XVII)
In the above formula,
R ¹⁷ is independently absent at each occurrence or is hydrogen or C ₁ -C ₆ alkyl;
R ¹⁸ and R ¹⁹ are independently absent at each occurrence, or are hydrogen, carrier peptide, C ₂ -C ₃₀ alkylcarbonyl, -C(=O)OR ²¹ or R ²⁰ ;
R ²⁰ is at each occurrence independently of guanidineyl, heterocyclyl, C ₁ -C ₃₀ alkyl, C ₃ -C ₈ cycloalkyl; C ₆ -C ₃₀ aryl, C ₇ -C ₃₀ aralkyl, C ₃ -C ₃₀ alkylcarbonyl, C ₃ -C ₈ cycloalkylcarbonyl, C ₃ -C ₈ cycloalkylalkylcarbonyl, C ₇ -C ₃₀ Arylcarbonyl, C ₇ -C ₃₀ aralkylcarbonyl, C ₂ -C ₃₀ alkyloxycarbonyl, C ₃ -C ₈ cycloalkyloxycarbonyl, C ₇ -C ₃₀ aryloxycarbonyl, C ₈ -C ₃₀ Aralkyloxycarbonyl, or -P(=O)(R ²² ) ₂ ;
R ²¹ is one or more ether linkages, hydroxyl moieties Or C ₁ -C ₃₀ alkyl including combinations thereof;
Each R ²² is independently C ⁶ -C ¹² aryloxy,
Pi is a base pair moiety;
L ¹ and L ² is each a direct bond or a bond selected from alkyl, hydroxyl, alkoxy, alkylamino, amide, ester, carbonyl, carbamate, phosphorodiamidate, phosphoroamidate, phosphorothioate and phosphodiester A linker of up to 18 atoms in length including
x is an integer of 0 or more;
Wherein R ¹⁷ and R ¹⁸ are not both absent and at least one of R ¹⁸ or R ¹⁹ is the carrier peptide. A pharmaceutical composition for treating a viral infection or neuromuscular disease, comprising the conjugate of claim 1 and a pharmaceutically acceptable excipient. 36. The composition of claim 35, wherein the viral infection is influenza. 36. The composition of claim 35, wherein the neuromuscular disease is Duchenne muscle dystrophy. A method for enhancing in vitro transport of the nucleic acid analog of claim 1 into a cell, comprising the step of conjugating the carrier peptide of claim 1 to a nucleic acid analog, wherein the transport of the nucleic acid analog to a cell is a non-conjugated form of a nucleic acid analog. How to increase compared to. The method of claim 34, wherein the carrier peptide is SEQ ID NO: 60, 69, 70, 89-121, 125, 130-160, 162-257, 276, 277, 281-288, 293-297, 300, 302-412 , 419-552, and 554-566. The conjugate of claim 34, wherein the carrier peptide is selected from SEQ ID NOs: 130, 157-160, 251, 256, 386-388, and 540. The conjugate of claim 34, wherein the carrier peptide is SEQ ID 159. The conjugate of claim 1, wherein the carrier peptide is a carrier peptide of the formula selected from:

;

;

; And

;
Where Y is an integer of 4 to 7; R is selected from H, acetyl, benzoyl and stearoyl. The conjugate of claim 42, wherein the carrier peptide is a carrier peptide of the formula:

Where Y is 6. The method of claim 1, wherein the conjugate is

,

, Or a pharmaceutically acceptable salt of any of these,
Wherein Z is an integer from 0 to 38;
R is selected from H, acetyl, benzoyl and stearoyl;
R ¹ is selected from H, acetyl, benzoyl and stearoyl;
R ² is selected from H, acetyl, benzoyl, stearoyl, trityl and 4-methoxytrityl;
X is independently in each case

,

, And

Wherein R ³ is selected from H, methyl, and an electron pair;
Each Pi is a purine or pyrimidine base-pairing moiety, with each Pi together forming a target base sequence,
Carrier peptides are SEQ ID NOs: 60, 69, 70, 89-121, 125, 130-160, 162-257, 276, 277, 281-288, 293-297, 300, 302-412, 419-552, and 554 Is selected from -566,
Xaa is a carboxy-terminal glycine, conjugate. The conjugate of claim 44, wherein the carrier peptide is selected from SEQ ID NOs: 130, 157-160, 251, 256, 386-388, and 540. 45. The conjugate of claim 44, wherein the carrier peptide is SEQ ID 159. The method of claim 1, wherein the conjugate is

,

, Or a pharmaceutically acceptable salt of any of these,
here,
X is an integer from 0 to 38;
R is selected from H, acetyl, benzoyl and stearoyl;
R ¹ is selected from H, acetyl, benzoyl and stearoyl;
R ² is selected from H, acetyl, benzoyl, stearoyl, trityl and 4-methoxytrityl;
Each Pi is a purine or pyrimidine base-pairing moiety, each Pi together forming a target base sequence;
Carrier peptides are SEQ ID NOs: 60, 69, 70, 89-121, 125, 130-160, 162-257, 276, 277, 281-288, 293-297, 300, 302-412, 419-552, and 554 Is selected from -566;
Xaa is a carboxy-terminal glycine, conjugate. 48. The conjugate of claim 47, wherein the carrier peptide is selected from SEQ ID NOs: 130, 157-160, 251, 256, 386-388, and 540. 48. The conjugate of claim 47, wherein the carrier peptide is SEQ ID 159. 48. The conjugate of claim 47, wherein each Pi is independently selected from adenine, cytosine, guanine, uracil, thymine and inosine.

;

;

;

And

As a compound selected from, or a pharmaceutically acceptable salt thereof,
here,
X is an integer from 0 to 38;
Y is an integer from 4 to 9;
Z is 6 or 9;
R is selected from H, acetyl, benzoyl and stearoyl;
R ¹ is selected from H, acetyl, benzoyl and stearoyl;
R ² is selected from H, acetyl, benzoyl, stearoyl, trityl and 4-methoxytrityl;
Each Pi is a purine or pyrimidine base-pairing moiety, wherein each Pi together forms a target base sequence. 52. The compound of claim 51, wherein each Pi is independently selected from adenine, cytosine, guanine, uracil, thymine and inosine. The method of claim 51, wherein the compound is

Or a pharmaceutically acceptable salt thereof. 54. The compound of claim 53, wherein R is H. 54. The compound of claim 53, wherein R is acetyl. 54. The compound of claim 53, wherein each Pi is independently selected from adenine, cytosine, guanine, uracil, thymine and inosine. delete delete delete delete delete delete delete delete delete

Images