KR102146359B1 - A primer for the diagnosis of parasitic and bacterial diseases of bees, a method and kit for diagnosing parasitic and bacterial diseases of bees using the same - Google Patents

Abstract

The present invention relates to a primer set for diagnosing parasitic and bacterial diseases of bees, a method and kit for diagnosing parasitic and bacterial diseases of bees using the same, American foul brood (AFB), European buzzer disease (EFB, european foulbrood), Porid and Acarine mites.
According to the present invention as described above, by effectively detecting bacterial and parasitic diseases of bees with high sensitivity, high specificity, and high precision (high repetition, high reproducibility), it is possible to reduce time and cost spent thereon. There is an effect that is usefully used in the evaluation of pathogenicity of the sample.

Description

A primer set for diagnosing parasitic and bacterial diseases of bees, methods and kits for diagnosing parasitic and bacterial diseases of bees using the same OF BEES USING THE SAME}

It relates to a primer set for diagnosing parasitic and bacterial diseases of bees, a method and kit for diagnosing parasitic and bacterial diseases of bees using the same, and in more detail, American foul brood (AFB), European buzzer disease (EFB, European foulbrood), porid, and acarine mites primer set and diagnostic method for diagnosing bacterial and parasitic diseases in bees, and using the same to simultaneously diagnose bacterial and parasitic diseases in bees It relates to providing a diagnostic kit.

Bees play an important role in pollination of various plant resources and are useful insects as industrial livestock that can increase farm household income by producing honey, royal jelly, and propolis.

Honeybees ( Apis mellifera ) are highly likely to develop various infectious diseases according to the characteristics of group life in a small place with tens of thousands of individuals, and once an infectious or parasitic disease occurs, it spreads rapidly throughout the reef army due to the nature of group life and is treated. As long as the action is not carried out, not only the damage of individual rebels, but it can spread to neighboring rebels, greatly expanding the damage.

The causes of viral diseases of bees that are a problem in beekeepers include sacbrood virus (SBV), deformed wing virus (DWV), black queen cell virus (BQCV), There are acute bee paralysisvirus (ABPV) and kashmir bee virus (KBV).

In addition, bacterial diseases of bees include American buzzer disease (AFB) and European buzzer disease (EFB), parasitic diseases such as porid and acarian mite (ACAR), fungal diseases such as Chalkbrood, and gypsum. Stonebrood and Nosema are also contagious diseases that can cause massive deaths of adult insects and larvae, and decrease productivity of beekeepers.

These various diseases can damage the entire rebel army, and in many cases, first of all, it can inflict decisive damage to its productivity.

However, it is known that antibiotic peptides exist as the bee's own defense in bee diseases, but the occurrence of the disease is beyond basic defense, and human disease control efforts are essential for successful beekeeping. The most fundamental in controlling bees' diseases is a quick and accurate diagnosis and correct treatment.

The diagnosis of honeybee disease has been largely dependent on experience and intuition, which has caused many misdiagnosis, and as a result, the most convenient method of treatment based on experience has led to the use of large amounts of antibiotics, which is also a pathogen that develops antibiotic resistance. It has appeared, making it more difficult to control the name of the disease.

Existing methods for diagnosing bee diseases include MLPA (Multiplex Ligation-dependent Probe Amplification) analysis, microarray, and PCR (Polymerase chain reaction). Among them, MLPA analysis and diagnosis using microarrays are very sophisticated techniques and A lot of cost is required.

In contrast, the PCR analysis method is a simple and can be performed in most laboratories, and has been mainly used to diagnose bee diseases. In addition, since the general PCR analysis method uses a single target RT-PCR method that can diagnose only one type of disease using one type of primer set, each type of bee disease is diagnosed in one sample. Since the PCR method for a disease must be performed several times, a faster disease diagnosis method is urgently required.

Korean Patent Application Publication No. 10-2010-0024539

De Smet L1, Ravoet J, de Miranda JR, Wenseleers T, Mueller MY, Moritz RF, de Graaf DC.,2012, BeeDoctor, a versatile MLPA-based diagnostic tool for screening bee viruses.Plos ONE 7(10):e47953. doi: 10.1371/journal.pone.0047953. Glover RH1, Adams IP, Budge G, Wilkins S, Boonham N., 2011. Detection of honey bee (Apis mellifera) viruses with an oligonucleotide microarray.J Invertebr Pathol. 2011 Jul;107(3):216-9.) Korean J. Apiculture 23(2);153-159 (2008) Journal of the Korean Beekeeping Society Vol. 23, No. 4, Vol. 48 pp.241-249 (2008); Journal of the Korean Society of Livestock Hygiene Vol. 36, No. 2 pp.147-150 (2013)

It is an object of the present invention to provide a primer set for diagnosing parasitic and bacterial diseases of bees, and a method and kit for diagnosing parasitic and bacterial diseases of bees using the same, thereby providing four major bacterial and parasitic pathogens causing diseases in bees. To provide diagnostic methods and diagnostic kits that can accurately, quickly and effectively diagnose (AFB, EFB, Porid and Acarian Mite).

In order to achieve the above object, a primer pair consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2; A primer pair consisting of a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4; A primer pair consisting of a forward primer of SEQ ID NO: 5 and a reverse primer of SEQ ID NO: 6; And it provides a primer set for diagnosing bacterial and parasitic diseases of bees, comprising a primer pair consisting of a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8.

The primer pair consisting of the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 2 may be used for diagnosis of US buzz disease.

The primer pair consisting of the forward primer of SEQ ID NO: 3 and the reverse primer of SEQ ID NO: 4 may be used for diagnosis of European blight disease.

The primer pair consisting of the forward primer of SEQ ID NO: 5 and the reverse primer of SEQ ID NO: 6 may be used for diagnosis of a porid.

The primer pair consisting of the forward primer of SEQ ID NO: 7 and the reverse primer of SEQ ID NO: 8 may be used for diagnosis of acarian mite.

According to the present invention as described above, by providing a primer set for diagnosing parasitic and bacterial diseases of bees, and a method and kit for diagnosing parasitic and bacterial diseases of bees using the same, major bacterial and parasitic pathogens causing diseases in bees It has the effect of accurately, promptly and effectively diagnosing 4 types (AFB, EFB, Porid and Acarian Mite).

Figure 1a shows the Amplification Curve of Real-Time PCR as a result of a sensitivity test for US buzz disease (AFB).
Figure 1b shows a conventional PCR result as a result of a sensitivity test for American buzz disease (AFB).
Figure 2a shows the Amplification Curve of Real-Time PCR as a result of a sensitivity test for European buzz disease (EFB).
Figure 2b shows the conventional PCR result as a sensitivity test result of European buzz disease (EFB).
Figure 3a shows the Amplification Curve of Real-Time PCR as a result of the sensitivity test of Poride.
Figure 3b shows the conventional PCR result as a result of the sensitivity test of the poride.
Figure 4a shows the Amplification Curve of Real-Time PCR as a result of the sensitivity test of Acarian Mite (ACAR).
Figure 4b shows a conventional PCR result of the sensitivity test result of akarian mite (ACAR).
FIG. 5 shows the Amplification Curve of Real-Time PCR performed on a sample infected with US buzz disease as a result of a specificity test for US buzz disease (AFB).
6 shows the Amplification Curve of Real-Time PCR performed on a specimen infected with European buzz disease as a result of a specificity test for European buzz disease (EFB).
7 shows the Amplification Curve of Real-Time PCR performed on a specimen infected with Poride as a result of the specificity test of Poride.
FIG. 8 shows the Amplification Curve of Real-Time PCR performed on a sample infected with Acarian Mite (ACAR) as a result of the specificity test of Acarian Mite (ACAR).
9A shows the results of the first precision (repeatability) test of the American buzzer disease (AFB).
9B shows the results of the second precision (repeatability) test of the American buzzer disease (AFB).
9C shows the results of the third precision (repeatability) test of the American buzzer disease (AFB).
10A shows the results of the first precision (repeatability) test of the European buzzer disease (EFB).
Fig. 10b shows the results of the second precision (repetition) test of the European buzzer disease (EFB).
Fig. 10c shows the results of the 3rd precision (repeatability) test of the European buzzer disease (EFB).
Fig. 11A shows the results of the primary test of the precision (repeatability) of the polyde.
Fig. 11B shows the results of the secondary test of the precision (repeatability) of the polyde.
Fig. 11C shows the results of the 3rd test of the precision (repeatability) of the polyde.
Fig. 12A shows the results of a primary test of accuracy (repeatability) of Acarian Mite (ACAR).
12B shows the results of a secondary test of accuracy (repeatability) of Acarian Mite (ACAR).
Fig. 12C shows the results of a third test of accuracy (repeatability) of Acarian Mite (ACAR).
13A shows the results of the first precision (reproducibility) test of the American buzzer disease (AFB).
13B shows the results of the second precision (reproducibility) test of the American buzzer disease (AFB).
13C shows the results of the 3rd precision (reproducibility) test of the American buzzer disease (AFB).
14A shows the results of the first precision (reproducibility) test of the European buzzer disease (EFB).
14B shows the results of the secondary test of precision (reproducibility) of the European buzzer disease (EFB).
14C shows the results of the 3rd precision (reproducibility) test of the European buzzer disease (EFB).
15A shows the results of the first test of the precision (reproducibility) of the porid.
15B shows the results of the secondary test of the precision (reproducibility) of the porid.
Fig. 15C shows the results of the third test of the precision (reproducibility) of the porid.
Fig. 16A shows the results of a primary test of accuracy (reproducibility) of Acarian Mite (ACAR).
16B shows the results of the secondary test of accuracy (reproducibility) of Acarian Mite (ACAR).
Fig. 16C shows the results of the 3rd precision (reproducibility) test of Acarian Mite (ACAR).

Hereinafter, the present invention will be described in detail.
According to one aspect of the present invention, a primer set for diagnosing bee diseases is provided.

The disease of the bee is American buzzer disease, European buzzer disease, Porid or Acarian mite, and the primer set is A primer pair consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2; A primer pair consisting of a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4; A primer pair consisting of a forward primer of SEQ ID NO: 5 and a reverse primer of SEQ ID NO: 6; And a primer pair consisting of a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8.

In the present invention, "primer" is a single-stranded oligonucleotide, under suitable conditions (the presence of four different nucleoside triphosphates and polymerases such as DNA or RNA polymerase), a template-indicative under a suitable temperature and a suitable buffer It means that it acts as a starting point from which DNA synthesis can be initiated.

The primer pair consisting of the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 2 may be used for diagnosis of US buzz disease.

The primer pair consisting of the forward primer of SEQ ID NO: 3 and the reverse primer of SEQ ID NO: 4 may be used for diagnosis of European blight disease.

The primer pair consisting of the forward primer of SEQ ID NO: 5 and the reverse primer of SEQ ID NO: 6 may be used for diagnosis of a porid.

The primer pair consisting of the forward primer of SEQ ID NO: 7 and the reverse primer of SEQ ID NO: 8 may be used for diagnosis of acarian mite.

The primer set for diagnosing bacterial and parasitic diseases of bees further includes an internal positive control consisting of a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10.

The base sequence of the primer set for diagnosing bacterial and parasitic diseases of bees is shown in Table 1 below, and the base sequence of the probe is shown in Table 2 below.

disease primer Base sequence (5' → 3') Sequence number American type
Buzzer AFB_S (forward) AAATCATCATGCCCCTTATG One AFB_AS (reverse) CGATTACTAGCAATTCCGACT 2 European buzz name EFB-S (forward direction) TGTTGTTAGAGAAGAATAGGGGAA 3 EFB_AS (reverse) CGTGGCTTTCTGGTTAGA 4 Forrid Phorid-S (forward) CCTCTGTTCTACTTTCATTGGTTTAT 5 Phorid_AS (reverse) GAGRGCCATAAAAGTAGCTACACC 6 Akarian Mite ACAR-S (forward direction) CAGTAGGGCTAGATATCGATACCCGAGCTT 7 ACAR_AS (reverse) TGAGCTACAACATAATATCTGTCATGAAGA 8 IPC BeeIPC-S (forward) TGTTTTCCCTGGCCGGAAAG 9 BeeIPC_AS (reverse) CCCCAATCCCTAGCACGAA 10

disease Probe name Base sequence (5' → 3') Sequence number American buzzer AFB_P FAM-CGTACTACAATGGCCGGTACAACG 11 European buzz name EFB_P Cy5-AGAGTAACTGTTTTCCTCGTGACGGT 12 Forrid Phorid_P JOE-GGCATTAGTATTACGACGCGAGAGGTG 13 Akarian Might ACAR_P TexasRed-CAATCCACCTACAGAAAATAAAAATAAAAATCC 14 IPC BeeIPC_P Cy5-CCCGGGTAACCCGCTGAACCTC 15

The American foul brood (AFB) is the most terrifying bacterial disease among the diseases of larva bees, and the pathogen is Paenibacillus larvae, and the process of dying and transmission of larva bees is similar to that of European buzz disease (EFB).

Bacillus alvei , once thought to be a pathogen of US buzz disease, is only a secondary infectious bacteria that lives by infecting the bees' dead bodies, and is not a pathogen. P. larvae is a gram-positive bacillus (2.5~5.0㎛ × 0.7~0.8㎛), has mobility due to flagella, and makes endospores, so it has strong heat resistance and resistance to chemical disinfectants. It is known to possess infectious power for years.

The larvae infected with American buzzer disease gradually change color from milky white to brown and die 10 to 15 days after infection, and the dead larva becomes darker and softer and bursts, and the carcass emits a characteristic smell of sour meat and rotting. Dead body fluid with adhesive power flows out.

The transmission of U.S. buzzer disease is transferred from larva to larva, from one reef to another, and from one apiary to another, either by reuse of contaminated honey from infectious flocks, the use or exchange of contaminated instruments, or by dowels. .

The infectivity of P. larvae endospores is limited to only one species of honeybee ( Apis mellifera ), and does not infect or multiply in other organisms. In addition, in the case of Seongbong, it hardly develops even in an environment where many spores exist, and in the case of larvae, larvae that are 1 day old after hatching are infected by an average of 35 spores, but thousands of larvae that have passed 2 days or more It occurs only when the above endospores are infected, and larvae that have passed 53 hours after hatching are hardly infected.

Infected endospores hatch into active cells (nutrition cells) within 24 hours after reaching the midgut through the oral cavity of the larva and proliferate rapidly. The active cells spread and proliferated throughout the body of the larva are transformed into endospores as the larva is killed, and the number of endospores of P. Larvae in one carcass is known to be between 5 million and 10 million.

The European foulbrood (EFB) is a bacterial disease, and the process of death and transmission of larvae bees is similar to that of the American buzzer, but it is known to be less severe than the American buzzer.

Melissococcus plutonius , a pathogen of European buzz disease, is a bacterium that infects the middle mass of bee larvae. Although not spore-forming bacteria, the bacterial cells can survive on the wax foundation for several months.

Symptoms of the European buzz disease include dead and dying larvae and may be more pronounced with upward bent, brown or yellow, melted or shrunk tracheal tubes, or dry and rubbery.

The porid is a small parasitic fly native to North America, and lays eggs in the belly of bees to induce abandonment of the beehive. Viruses, fungi, or combinations of these have been cited. However, the peculiar behavior of the collapse of a bee colony where worker bees abandon their hives and leave remains a mystery.

The parasitic flies were known to be parasitic to rear bees or double bees, but it was found that honey bees are also used as hosts. In addition, when a parasitic fly sits on a bee's belly, it inserts a spawning tube into a spawning tube within 2 to 4 seconds to lay eggs, and the infected bee leaves the hive in the middle of the night and flies toward the light after performing strange behaviors such as hovering in place.

The eggs of the parasitic flies wake up one week later and crawl out of the neck of the bees up to 13 procrastinators, and other parasites and viruses were detected together in the hives infected with the parasitic flies, and the parasitic flies were revealed to be their propagators.

Parasitic flies have a relatively larger group size than rear young bees and thrive greatly thanks to their host of bees, which are active all year round, can pose a great threat to bee farms, and the possibility of introducing them into Korea cannot be excluded.

Acarine mites (ACAR) is a small parasitic mite that infects the airways of bees, grows and reproduces in the organs of bees, affects only adult bees, lays eggs in the airways, and moves from one bee to another. It is only when it is outside.

Once in a new bee, the parasitic mites move in the airways and begin to lay eggs, so all adult bees in the hive, including the queen bee, can become infected with the tick mite and quickly spread from one bee to another through direct contact. Therefore, separation from the infected group is necessary.

The present invention relates to a method for diagnosing bacterial and parasitic diseases of bees using the primer set according to another aspect of the present invention.

Amplifying the DNA extracted from the sample by using the primer set by real-time PCR; And

It relates to a method for diagnosing bacterial and parasitic diseases of bees, comprising the step of diagnosing diseases of bees by analyzing the Ct value of the amplified products generated by the above steps.

The real time PCR is preferably a multiplex RT-PCR method, which is more advanced than the single target RT-PCR method, which can diagnose only one disease with a single experiment. The multiple real-time polymerase chain reaction (Multiplex RT-PCR) method is a PCR method capable of simultaneously diagnosing several diseases at once.

In the step of analyzing the Ct value, a method for diagnosing bacterial and parasitic diseases of bees, characterized in that a positive Ct value of 35 or less is diagnosed.

However, since the multiple real-time polymerase chain reaction (Multiplex RT-PCR) performs PCR using several types of primers in one tube, interference may occur between the primers, and the types may increase. The higher the possibility, the higher the possibility, so it is important to establish optimal conditions by modifying various conditions in performing the PCR method.

In the method for diagnosing bacterial and parasitic diseases of bees, the disease of bees may be selected from the group consisting of American buzzer disease, porid, Acarian mite, and European buzz disease.

In the method for diagnosing bacterial and parasitic diseases of bees, the reverse transcription polymerase chain reaction is a method of selectively amplifying a specific DNA fragment, and the information is disclosed in Miller, HI (WO 89/06700), , The document is incorporated herein by reference.

In the method for diagnosing bacterial and parasitic diseases of bees, the reverse transcription polymerase chain reaction can be used for amplification reactions of various DNA polymerases, for example the "Klenow fragment of E. coli DNA polymerase I" ", may include a thermostable DNA polymerase and bacteriophage T7 DNA polymerase.

In the method for diagnosing bacterial and parasitic diseases of bees, preferably, the polymerase is a thermostable DNA polymerase obtained from various bacterial species, which is Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis , and Pyrococcus furiosus (Pfu).

In the method for diagnosing bacterial and parasitic diseases of bees, the amplification reaction solution may include a dNTP mixture (dATP, dCTP, dGTP, dTTP), a PCR buffer, and a DNA polymerase cofactor.

In the method for diagnosing bacterial and parasitic diseases of bees, when performing an amplification reaction by polymerase chain reaction, it is preferable to provide an excess amount of components necessary for the reaction in the reaction vessel. The excessive amount of components required for the amplification reaction means an amount such that the amplification reaction is not substantially limited to the concentration of the component.

In the method of diagnosing bacterial and parasitic diseases of honey bees, it is required to provide a cofactor such as Mg2+, dATP, dCTP, dGTP and dTTP to the reaction mixture to such an extent that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, it is desirable for the buffer to bring all enzymes close to optimal reaction conditions.

In the method for diagnosing bacterial and parasitic diseases of bees, the amplification process can be carried out in a single reactant without changing conditions such as addition of reactants.

It relates to a kit for diagnosing bacterial and parasitic diseases of bees comprising the primer set according to another aspect of the present invention.

In the kit for diagnosing bacterial and parasitic diseases of bees, the disease of bees may be selected from the group consisting of American buzzer disease, porid, Acarian mite, and European buzzer disease.

When the kit for diagnosing bacterial and parasitic diseases of bees is applied to the PCR amplification process, reagents necessary for PCR amplification, such as buffers, DNA polymerases (e.g., Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermisflavus, Thermococcus literalis, or thermostable DNA polymerase obtained from Pyrococcus furiosus (Pfu)), DNA polymerase cofactors, dNTPs, and the like, but are not limited thereto.

The kit for diagnosing bacterial and parasitic diseases of bees may be manufactured in a plurality of separate packaging or compartments including the reagent components described above.

The kit for diagnosing bacterial and parasitic diseases of bees includes, for example, a primer/probe mix, a real-time PCR kit consisting of a mixture of a 2X master mix and a real time PCR buffer, a positive sample diluted to a certain concentration as a control DNA ( Bee plasmid DNA), and a flat cap of a strip tube used for performing real-time PCR.

Hereinafter, the present invention will be described in more detail through examples. These examples are for illustrative purposes only, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not construed as being limited by these examples.

Example 1. Sensitivity test of bees to four major bacterial and parasitic pathogens

In order to confirm the minimum pathogen DNA concentration that can be amplified by each of the four pathogen primers (AFB, EFB, poride, ACAR), a sensitivity test of each pathogen primer was performed using single target PCR.

Each pathogen DNA was diluted 10-fold (10 ^-3 µg/µl to 10 ^-6 µg/µl or 10 ^-1 µg/µl to 10 ^-4 µg/µl) and then PCR (conventional PCR) by a conventional method. ) And real time PCR (real time PCR) and the results of the sensitivity test are shown in Tables 3 to 6 below, and the graphs of the sensitivity test are shown in FIGS. 1A to 4B. At this time, 10 ^-5 and 10 ^-6 of the result values in Table 6 had no amplification, so Ct values were not described.

American foul brood (AFB) Serial Dilution# Real-Time PCR Conventional PCR Ct value Size 10 ^-3 27.58 232bp 10 ^-4 29.97 10 ^-5 33.12 10 ^-6 36.8

European foulbrood (EFB) Serial Dilution# Real-Time PCR Conventional PCR Ct value Size 10 ^-3 24.92 583bp 10 ^-4 28.50 10 ^-5 34.81 10 ^-6 -

Phorid Serial Dilution# Real-Time PCR Conventional PCR Ct value Size 10 ^-3 24.06 500bp 10 ^-4 27.85 10 ^-5 31.56 10 ^-6 36.40

Acarine mites (ACAR) Serial Dilution# Real-Time PCR Conventional PCR Ct value Size 10 ^-3 31.72 247bp 10 ^-4 35.52 10 ^-5 - 10 ^-6 -

At this time, PCR according to the conventional method is pre-denaturation 95 ℃, 5 minutes; 40 cycles of denaturation 95° C., 30 seconds; kidney; Expansion was carried out at 72° C., 10 minutes.

As shown in Tables 3 to 6 and FIGS. 1A to 4D, in the case of real-time PCR, Ct values are 35 or less even at a high dilution factor, indicating that the sensitivity is excellent.

The Ct (threshold of cycle) value means the number of cycles in which the desired gene is amplified by a certain amount (initial 10 times), and the more target genes are, the more the target genes are initially amplified. In other words, the lower Ct, the higher the infection. Therefore, it can be judged as a value to check how much (quantitative) the target (pathogen) gene is.

Example 2. Specificity test for four major bacterial and parasitic pathogens of bees

In order to verify the specificity of the four DNA target pathogens (AFB, EFB, Porid, ACAR), the results of the specificity test only for the samples in which infection with each pathogen alone was confirmed are shown in Figs. It is shown in 8.

At this time, in the case of phorid, since it is difficult to measure specificity because there is no single infected sample, a plasmid control prepared for the experiment was used, and a Ct value of 35 or less was determined as positive.

As shown in Figures 5 to 8, it can be seen that it has specificity for four kinds of pathogens.

In addition, since the present invention can simultaneously diagnose 4 types (AFB, EFB, Porid, ACAR) within one test (tube), simultaneous detection and diagnosis is possible even if two or more samples to be checked are cross-infected. Do.

Example 3. Precision (repeatability) test for four major bacterial and parasitic pathogens of bees

To confirm the precision (repeatability) of the four DNA target pathogens (AFB, EFB, Porid, ACAR), the number of copies of each pathogen DNA was gradually reduced by 10 times (105 copies/Rx ~ 102 copies). /Rx), the results of performing the first to third precision (repeatability) tests are shown in Tables 7 to 10 below, and the graphs of the results of performing the first to third precision (repeatability) tests are shown in FIGS. 9A to 12C. Shown in.

In Figures 9a to 12c, the results of the precision (repeatability) graph of 4 types (AFB, EFB, Porid, ACAR) are presented in all 1 to 3 orders, and Ct values in Tables 7 to 10 are 4 types (AFB, EFB, It was prepared by calculating the standard deviation of the result of the precision (repeatability) graph of the four-lead, ACAR).

American foul brood (AFB) Serial Dilution Real-Time PCR Ct value 10 ⁵ copies/Rx 20.3±0.24 10 ⁴ copies/Rx 23.9±0.17 10 ³ copies/Rx 27.7±0.43 10 ² copies/Rx 31.8±0.41

European foulbrood (EFB) Serial Dilution Real-Time PCR Ct value 10 ⁵ copies/Rx 19.1±0.18 10 ⁴ copies/Rx 22.3±0.20 10 ³ copies/Rx 25.7±0.17 10 ² copies/Rx 29.1±0.25

Phorid Serial Dilution Real-Time PCR Ct value 10 ⁵ copies/Rx 23.6±0.26 10 ⁴ copies/Rx 27.7±0.42 10 ³ copies/Rx 31.1±0.39 10 ² copies/Rx 33.9±0.05

Acarine mites (ACAR) Serial Dilution Real-Time PCR Ct value 10 ⁵ copies/Rx 22.8±0.05 10 ⁴ copies/Rx 26.3±0.17 10 ³ copies/Rx 29.7±0.15 10 ² copies/Rx 33.0±0.17

As shown in Tables 7 to 10 and FIGS. 9A to 12C, all three pathogens show a positive Ct value of 35 or less even at a low copy number of 10 ² copies/Rx, indicating that the precision (repetition) is excellent. Able to know.

The above precision (repeatability) is intended to show that the results are the same for both the first and the second and third experiments. It is possible to check whether the same result can be obtained, whether the kit and the performer are accurate and stable even when running multiple times on the same day.

Example 4. Precision (reproducibility) test for US buzz disease of bees

In order to confirm the precision (reproducibility) of the DNA target pathogen of AFB, the number of copies of the AFB pathogen DNA was gradually reduced by 10-fold increments (105 copies/Rx ~ 102 copies/Rx), and precision ( Reproducibility) test results are shown in Table 11 below, and precision (reproducibility) test results are shown in Figs. 13A to 13C.

American foul brood (AFB) Serial Dilution Real-Time PCR (Ct value) 1st_201707 2nd_201710 3rd_201801 10 ⁵ copies/Rx 19.9 20.1 20.1 10 ⁴ copies/Rx 24.1 23.7 23.6 10 ³ copies/Rx 26.8 26.7 26.8 10 ² copies/Rx 31.6 31.3 31.7

As shown in Table 9 and FIGS. 13A to 13C, in the case of U.S. buzz disease, the Ct value is 35 or less, indicating positive even at a low copy number of 10 ² copies/Rx, it can be seen that the precision (reproducibility) is excellent. .

The above precision (reproducibility) is intended to show that the results are the same for both the first and second and third experiments. The difference from the above precision (repeatability) is that the experiment is repeated on different days. It is possible to verify that the same results can be obtained by performing multiple runs on different days, and that the kit and performer are accurate and stable.

Example 5. Precision (reproducibility) test for European buzz disease of bees

In order to confirm the precision (reproducibility) of the DNA target pathogen of EFB, the number of copies of the EFB pathogen DNA was gradually reduced by 10 times (10 ⁵ copies/Rx). ~ 10 ² copies/Rx) and precision (reproducibility) were tested three times in Table 12 below, and precision (reproducibility) was tested three times, and graphs are shown in FIGS. 14A to 14C.

European foulbrood (EFB) Serial Dilution Real-Time PCR (Ct value) 1st_201707 2nd_201710 3rd_201801 10 ⁵ copies/Rx 18.9 18.7 18.7 10 ⁴ copies/Rx 22.1 22.2 22.1 10 ³ copies/Rx 25.8 25.7 25.4 10 ² copies/Rx 29.1 29.2 29.3

As shown in Table 12 and FIGS. 14A to 14C, in the case of U.S. buzz disease, the Ct value is 35 or less even at a low copy number of 10 ² copies/Rx, indicating positive accuracy (reproducibility). .

Example 6. Precision (reproducibility) test for honey bee poride

To confirm the precision (reproducibility) of the DNA target pathogen of the porid, the number of copies of the DNA of the porid pathogen was gradually reduced by 10 times (10 ⁵ copies/Rx). ~ 10 ² copies/Rx), the results of testing the precision (reproducibility) three times are shown in Table 13 below, and the results of testing the precision (reproducibility) three times are shown in FIGS. 15A to 15C.

Porid Serial Dilution Real-Time PCR (Ct value) 1st_201707 2nd_201710 3rd_201801 10 ⁵ copies/Rx 23.2 23.2 22.76 10 ⁴ copies/Rx 26.5 27.0 26.3 10 ³ copies/Rx 29.9 30.8 30.1 10 ² copies/Rx 33.6 33.5 33.6

As shown in Table 13 and FIGS. 15A to 15C, in the case of Porid, the Ct value is 35 or less even at a low copy number of 10 ² copies/Rx, indicating positive, it can be seen that the precision (reproducibility) is excellent.

Example 7. Precision (reproducibility) test for acarian mite of honeybees

To confirm the precision (reproducibility) of the DNA target pathogen of Acarian Mite (ACAR), the number of copies of the ACAR pathogen DNA was gradually reduced by 10 times (10 ⁵ copies/Rx). ~ 10 ² copies/Rx) and precision (reproducibility) were tested three times in Table 14, and precision (reproducibility) was tested three times. The graphs are shown in FIGS. 16A to 16C.

Acarine mites (ACAR) Serial Dilution Real-Time PCR (Ct value) 1st_201707 2nd_201710 3rd_201801 10 ⁵ copies/Rx 22.4 22.2 22.3 10 ⁴ copies/Rx 25.7 25.6 26.2 10 ³ copies/Rx 29.2 29.6 30.1 10 ² copies/Rx 32.8 32.9 33.2

As shown in Table 14 and FIGS. 16A to 16C, in the case of acarian mite, the Ct value is 35 or less even at a low copy number of 10 ² copies/Rx, indicating positive, it can be seen that the precision (reproducibility) is excellent. .

Example 8. Clinical sensitivity test

Real-time PCR (real time PCR) and conventional PCR (conventional PCR) were performed by the above method for 111 clinical specimens of bees, and 4 types (US buzz disease, European buzz disease, Forride, and Acarian mite) The results of testing the sensitivity to pathogens are shown in Table 15 below.

Number of samples <Ct.35 C_PCR result Sensitivity increase rate AFB All 111 All 16 9 pcs 77% increase EFB All 111 All 16 12 pcs 33% increase Phorid All 111 0 pcs 0 pcs - ACAR All 111 All 19 11 pcs 72% increase

As shown in Table 13, in the case of real-time PCR (RT-PCR), it can be confirmed that the sensitivity is remarkably superior to that of conventional PCR.

Through the above embodiments, the present invention confirmed that the domestic pathology assessment method, which was previously conducted by uniplex PCR, was developed as a multiplex diagnosis method capable of sensitive and real-time quantification, through which domestic bee disease monitoring and initial diagnosis are possible. It is intended to be useful for research on utilization such as diagnosis and prevention of bee diseases.

As described above, specific parts of the present invention have been described in detail, and for those of ordinary skill in the art, it is clear that these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereby. something to do. Therefore, it will be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.

The present invention was developed as a multiplex diagnosis method capable of sensitive and real-time quantification of the domestic pathogenicity assessment method, which was previously conducted by uniplex PCR, and enables the monitoring and initial diagnosis of domestic bee diseases to study and utilize the diagnosis and prevention of bee diseases. It is intended to be useful for

<110> KOREA(Animal and Plant Quarantine Agency) <120> A PRIMER FOR THE DIAGNOSIS OF PARASITIC AND BACTERIAL DISEASES OF BEES, A METHOD AND KIT FOR DIAGNOSING PARASITIC AND BACTERIAL DISEASES OF BEES USING THE SAME <130> P18-E265 <160> 15 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 1 aaatcatcat gccccttatg 20 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 2 cgattactag caattccgac t 21 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 3 tgttgttaga gaagaatagg ggaa 24 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 4 cgtggctttc tggttaga 18 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 5 cctctgttct actttcattg gtttat 26 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 6 gagrgccata aaagtagcta cacc 24 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 7 cagtagggct agatatcgat acccgagctt 30 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 8 tgagctacaa cataatatct gtcatgaaga 30 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 9 tgttttccct ggccggaaag 20 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 10 ccccaatccc tagcacgaa 19 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 11 cgtactacaa tggccggtac aacg 24 <210> 12 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 12 agagtaactg ttttcctcgt gacggt 26 <210> 13 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 13 ggcattagta ttacgacgcg agaggtg 27 <210> 14 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 14 caatccacct acagaaaata aaaataaaaa tcc 33 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 15 cccgggtaac ccgctgaacc tc 22

Claims (11)

In the set of primers for diagnosing bacterial and parasitic diseases of bees,
The disease is American buzzer disease, European buzzer disease, Porid or Acarian mite,
The primer set includes a primer pair consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2; A primer pair consisting of a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4; A primer pair consisting of a forward primer of SEQ ID NO: 5 and a reverse primer of SEQ ID NO: 6; And a primer pair consisting of a forward primer of SEQ ID NO: 7 and a reverse primer of SEQ ID NO: 8.
The method of claim 1,
The primer pair consisting of the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 2 is for diagnosis of US buzz disease.
The method of claim 1,
The primer set consisting of the forward primer of SEQ ID NO: 3 and the reverse primer of SEQ ID NO: 4 is for diagnosis of European buzz disease.
The method of claim 1,
The primer pair consisting of the forward primer of SEQ ID NO: 5 and the reverse primer of SEQ ID NO: 6 is a primer set for diagnosing diseases of bees, characterized in that for diagnosis of a porid.
The method of claim 1,
The primer pair consisting of the forward primer of SEQ ID NO: 7 and the reverse primer of SEQ ID NO: 8 is for diagnosis of acarian mite. A set of primers for diagnosing bee diseases.
The method of claim 1,
A set of primers for diagnosing diseases of honeybees, further comprising an internal positive control consisting of a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10.
Amplifying the DNA extracted from the sample by using the primer set of any one of claims 1 to 6 by real time PCR; And
Analyzing the Ct value of the amplification product generated by the above step to diagnose the disease of bees,
A method for diagnosing a bee disease, characterized in that the diagnosis is positive when the analyzed Ct value is 35 or less.
The method of claim 7,
The real time polymerase chain reaction (real time PCR) is a method for diagnosing bee disease, characterized in that the multiple real-time polymerase chain reaction (Multiplex RT-PCR).
delete A kit for diagnosing bee diseases, comprising the primer set of any one of claims 1 to 6.
delete

Images