KR102142255B1 - Expression Method of CRM197 Protein - Google Patents

Abstract

The present invention relates to a signal sequence for expressing and secreting CRM197 protein into the periplasm in E. coli and a use thereof and, more specifically, to a signal sequence for expressing CRM197 protein, a nucleic acid encoding the signal sequence, a nucleic acid structure or expression vector including the nucleic acid and the CRM197 protein gene, a recombinant microorganism into which the nucleic acid structure or expression vector is introduced, and a method for preparing CRM197 protein including the step of culturing the recombinant microorganism. According to the present invention, CRM197 protein having the same physicochemical/immune properties as the protein isolated from the parental cell can be expressed even in general E. coli that does not control the redox potential, and it is possible to prepare CRM197 protein with high secretion efficiency to the periplasm without any change in the pH of the medium to increase secretion into the periplasm, and thus the present invention is very useful in the production of CRM197 protein.

Description

CRM197 protein expression method {Expression Method of CRM197 Protein}

The present invention relates to a signal sequence for the expression of CRM197 protein in E. coli and secretion into the periplasm and its use, more specifically, a signal sequence for CRM197 protein expression, a nucleic acid encoding the signal sequence, and the nucleic acid And a nucleic acid construct or expression vector comprising the CRM197 protein gene, a recombinant microorganism into which the nucleic acid construct or expression vector is introduced, and a step of culturing the recombinant microorganism.

Diphtheria toxin (DT) is a proteinaceous exotoxin that is synthesized and secreted from a pathogenic strain of Corynebacterium diphtheriae . Diphtheria toxin is an ADP-ribosylating enzyme that is secreted as a proenzyme of 535 residues and processed into trypsin-like proteases to separate into two fragments (A and B). Fragment A is a catalytically active site and is a NAD-dependent ADP-ribosyltransferase specifically targeting the protein synthesis factor EF-2, thereby inactivating EF-2 and protein synthesis in cells. Stop it.

CRM197 was discovered through separation of various non-toxic and partially toxic immunologically cross-reactive forms (CRM or cross-reactive substances) of diphtheria toxin (Uchida et. al . , Journal of Biological Chemistry 248, 3845-3850, 1973). Preferably, the CRM can be of any size and composition, including all or part of the DT.

CRM197 is an enzymatically highly inactive and non-toxic form of diphtheria toxin with one amino acid substitution G52E. This mutation lowers the binding of CRM197 to NAD and eliminates the toxicity of DT by conferring unique flexibility to the active-site loop located in front of the NAD-binding site (Malito et. al . , Proc Natl Acad Sci USA 109(14):5229-342012). CRM197, like DT, has two disulfide bonds. One disulfide bond connects Cys186 to Cys201, thereby linking fragment A to fragment B. The second disulfide bond connects Cys461 with Cys471 in fragment B. DT and CRM197 have nuclease activity due to fragment A (Bruce et al . , Proc. Natl. Acad. Sci. USA 87, 2995-8, 1990).

Many antigens are made of conjugates or conjugated vaccines, as long as they are not chemically linked to the protein, especially in young children, because of their low immunogenicity. In these conjugated vaccines, the protein component is also called a “carrier protein”. CRM197 is commonly used as a transport protein in protein-carbohydrate conjugation and hapten-protein conjugation. CRM197, as a transport protein, has several advantages over diphtheria toxoid as well as other toxoid proteins (Shinefield Vaccine, 28:4335, 2010).

Methods of preparing diphtheria toxin (DT) are well known in the art. For example, DT can be produced by chemical detoxification followed by purification of toxin from cultures of Corynebacterium diphtheria, or by purification of recombinants or analogs of genetically detoxified toxins Can be.

Due to the protein abundance, mass production of diphtheria toxins such as CRM197 for use in vaccines was not possible. This problem has previously been addressed by expressing CRM197 in E. coli (Bishai, et. al . , J Bacteriol. 169:5140-5151), Bishai et al. described the expression of a recombinant fusion protein containing diphtheria toxin (including tox signal sequence) resulting in the production of degraded proteins.

The production of bacterial toxins in the periplasm is soluble compared to cytoplasmic production i) because the protein is produced in mature form after cleavage of the signal peptide, or ii) the peripheral cytoplasm of E. coli is an oxidizing environment that allows the formation of disulfide bonds, making it soluble Of, can help to produce properly folded proteins, iii) help to avoid proteolytic cleavage of the expressed protein by containing less protease in the E. coli periplasm, and iv) less periplasmic protein It contains, allowing a higher purity recombinant protein to be obtained.

In general, the presence of a signal sequence on a protein facilitates the transport (prokaryotic host) or secretion (eukaryotic host) of the protein to the periplasm. In a prokaryotic host, the signal sequence modulates the new protein across the inner membrane to the periplasm, and the signal sequence is then cut. That is, it is important to search for a signal sequence capable of more efficiently mass-producing commercially important proteins, and the development of recombinant microorganisms is required.

Accordingly, the present inventors tried to develop a method for producing a CRM197 protein in an efficient and cost-effective manner. As a result, they selected a specific signal sequence and combined the codon context with a secondary structure to optimize translation in E. coli to sequence the sequence. Designed, CRM197 nucleotide sequence encoding CRM197 protein was also optimized for E. coli expression, and when these were used, it was confirmed that CRM197 was efficiently expressed in E. coli, and secretion of CRM197 into the peripheral cytoplasm was efficiently performed without changing the pH, and completed the present invention. Did.

The above information described in this background section is only for improving the understanding of the background of the present invention, and therefore does not include information that forms prior art already known to those of ordinary skill in the art. It may not.

The object of the present invention is to secrete CRM197 protein into the peripheral cytoplasm of E. coli to minimize the toxicity to the E. coli of CRM197 protein and maximize expression, nucleic acid encoding the signal sequence and the signal sequence for CRM197 protein expression of a specific sequence and the It is to provide a method for producing a CRM197 protein using nucleic acids.

In order to achieve the above object, the present invention provides a signal sequence for CRM197 protein expression represented by any one of the amino acid sequence of SEQ ID NO: 13 to SEQ ID NO: 21.

The present invention also provides a nucleic acid encoding the signal sequence for expressing the CRM197 protein.

The present invention also provides a nucleic acid construct or expression vector comprising the gene of the nucleic acid and CRM197 protein, a recombinant microorganism into which the nucleic acid construct or expression vector is introduced, and a method of producing the CRM197 protein comprising culturing the recombinant microorganism. to provide.

According to the present invention, even in general E. coli that does not regulate redox potential, it can express CRM197 protein having the same physicochemical/immunological properties as the protein isolated from the parental bacteria, and a medium for increasing secretion to the periplasm. It is very useful in the production of CRM197 protein because it can produce CRM197 protein with high secretion efficiency to the surrounding cytoplasm without changing the pH of the product.

)과 대장균 pHex-L3 생산 CRM197( ^Χ ) 간의 고차 구조의 차이가 없음을 확인하였다.
도 18은 형광스펙트럼 분석 결과로, 코리네박테리움 생산 CRM197(

)과 대장균 pHex-L3 생산 CRM197(실선)은 최대 방출파장이 338nm로 동일하였다.Figure 1 shows the schematic diagram of the expression module TPB1Tv1.3, Ptrc is a trc promoter, RBS is A/U rich enhancer + SD, λ tR2 & T7Te, rrnB T1T2 is transcription terminators, Bsa I and Dra I are used for cloning restriction enzyme site.
Figure 2 shows the E. coli expression plasmid pHex1.3, Ori (pBR322) is the replication origin of pBR322, KanR is the kanamycin marker, lacI is the lac I gene, and the rest are as shown in FIG. 1.
Figure 3 shows a schematic diagram of CRM197 expression plasmid production, T1 is λ tR2 and T7Te transcription terminator, T2 is rrnB T1T2 transcription terminators, arrows are PCR primers, alphabets A, B, C, D are homologous regions for LIC, , The rest is as shown in FIG. 1.
Figure 4 shows the expression pattern of L3, L5 fusion CRM197 in a variety of E. coli strains, shows Coomassie straining (left) and Western blotting (right) after SDS_PAGE of E. coli total cells. C means C2894H, B means BL21(DE3), W means W3110-1, O means Origami™ 2, and S means Shuffle. Cv represents C2984H containing pHex1.3 used as a negative control, L3, L5 represents a fused signal sequence, and CRM197 represents a reference CRM197. For coomassie straining, cells corresponding to 0.025 OD ₆₀₀ per well were loaded, and cells corresponding to 0.0005 OD ₆₀₀ were loaded for Western blotting.
5 shows the effect of the type and concentration of inducer on CRM197 expression induced by L5, and shows Coomassie straining (left) and Western blotting (right) after SDS_PAGE. The loading amount is the same as in Fig. 4, I is the insoluble fraction, S is the soluble fraction. (A) is cultured at 25°C, (B) is cultured at 30°C.
Figure 6 shows the location of the CRM197 protein induced by L5 fusion, SDS_PAGE on the top shows Coomassie straining, and Western blotting on the bottom. Cr indicates reference CRM197 and the arrow indicates the position of matured CRM197. P1 is the supernatant after plasma membrane induction buffer treatment, P2 is the periplasmic fraction, and Cy is the cytoplasm faction.
Figure 7 shows the effect of the type and concentration of inducer on the expression of CRM197 induced by L3, (A) 25 ℃ culture, (B) is 30 ℃ culture.
Figure 8 shows the location of the CRM197 protein induced by L3 fusion.
Figure 9 shows the change in the pH, temperature, impeller speed, dissolved oxygen (DO) of the L3 strain, and the input time of the expression inducer, (A) maintained the temperature at 30 °C, (B) expression The temperature was lowered to 25°C before induction.
FIG. 10 is a graph showing changes in pH, temperature, impeller speed, dissolved oxygen (DO) of L5 strain, and input time of the expression inducer.
Figure 11 shows the change in expression of CRM197 protein before and after the introduction of the expression inducer during culture, (A) induced L3 strain expression at 30°C, (B) induced expression at 25°C, and (C) L5 The strain was induced to express at 25°C. Lines 3 and 10 of (A) and lines 4 and 10 of (B) and lines 3 and 9 of (C) loaded 200 ng of reference CRM197. Lines 1, 2 of (A) and lines 1, 2, 3 of (B), and lines 1 and 2 of (C) are cell culture solutions prior to the introduction of the expression inducing agent, and lines 16 of (A) and (C) are terminated. After the supernatant, the subsequent line is the cell culture sample sampled every 2 hours after the introduction of the inducer. Loading amount is the same as in FIG. 4.
Figure 12 shows the expression and separation behavior of CRM197 protein in the L3/L5 strain, (A) is the protein separation behavior in culture using L3, and (B) is the protein separation behavior in culture using L5. Line 1 loaded 200ng of reference CRM197, Line 2 is the cell culture solution after completion of culture, Line 3 is the supernatant after treatment with plasma membrane-induced buffer solution, and lines 4 and 7 are periplasmic fractions (Line 7 is 4 than line 4). Pear protein was loaded), Lines 5 and 6 indicate cytoplasm faction.
13 is a result of analyzing the DEAE Chromatography (A) and HA Chromatography (B) purified samples by SDS-PAGE. Line 1 in (A) is CRM197 produced by Corynebacteria, and Line 2 means the protein present in the recovered periplasmic fraction. Line 3 is a sample before loading DEAE Chromatography that is double-concentrated after ultrafiltration, and lines 4 and 5 are flow-through and washing solutions of DEAE Chromatography to identify impurity proteins except CRM197. Line 6 is an eluted sample from which impurities have been removed, and Line 7 is a sample eluted using a high concentration salt to remove all proteins bound to the resin. (B) HA Elu is CRM197 eluted after removing the protein that is not bound to the HA resin.
14 is a result of analyzing the final purified CRM197 by SEC-HPLC, the purity was 99% or more.
15 is a result of SDS-PAGE (left) and Western blot (right). Line 1 is CRM197 produced by Corynebacterium, and Line 2 is CRM197 produced by E. coli (L3). Both CRM197 bands were identified at the same location.
FIG. 16 shows the results of Intact protein molecular mass analysis using LC/MS, and the molecular weight was 58,409 Da, which was consistent with the theoretical molecular weight.
17 is a result of circular dichroism (CD) analysis, Corynebacterium production CRM197 (

) And E. coli pHex-L3 production CRM197 ( ^Χ ) was confirmed that there is no difference in the higher order structure.
Figure 18 shows the results of fluorescence spectrum analysis, Corynebacterium production CRM197 (

) And E. coli pHex-L3 production CRM197 (solid line) had the same maximum emission wavelength of 338 nm.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by a person skilled in the art to which the present invention pertains. In general, the nomenclature used herein is well known in the art and commonly used.

In one embodiment of the present invention, nine signal sequences were attempted to be expressed by fusion with the CRM197 protein. For each signal sequence, the base sequence (SEQ ID NO: 4 to SEQ ID NO: 12) optimized for translation was designed in consideration of the codon context and the secondary structure of mRNA. This construct was inserted into the expression plasmid pHex1.3, and expression of CRM197 was examined in 5 E. coli strains to find the optimal E. coli strain of each construct. In addition, the culture temperature and the type and concentration of the inducer were set in the selected E. coli. As a result, as a result of transforming the constructs into various E. coli strains, CRM197 protein could be expressed in a soluble form and secreted into periplasm even in a strain that did not manipulate genes (trxB, gor) related to redox potential.

Therefore, in one aspect, the present invention relates to a signal sequence for CRM197 protein expression represented by an amino acid sequence of any one of SEQ ID NOs: 13 to 21.

In another aspect, the present invention relates to a nucleic acid encoding a signal sequence for CRM197 protein expression.

In the present invention, the nucleic acid may be characterized in that represented by any one of the nucleotide sequence of SEQ ID NO: 4 to SEQ ID NO: 12, preferably characterized by the nucleotide sequence of SEQ ID NO: 6 or SEQ ID NO: 8 It can, but is not limited to this.

In the present specification, "signal sequence for CRM197 protein expression" means a signal sequence for expression of CRM197 protein and secretion into periplasm.

In one embodiment of the present invention, the signal sequence of the protein targeted to the outer membrane (outermembrane) of E. coli to secrete the CRM197 protein into the periplasm and the signal sequence derived from the M13 phage were selected (Table 3). In order to optimize the translation of the selected signal sequence in E. coli, the base sequence was designed by combining the codon context and the secondary structure (SEQ ID NOs: 4 to 12).

In another aspect, the present invention relates to a nucleic acid construct encoding a signal sequence for CRM197 protein expression and a gene for CRM197 protein.

In another aspect, the present invention relates to an expression vector comprising a nucleic acid encoding a signal sequence for expressing the CRM197 protein and a gene of the CRM197 protein.

In one embodiment of the present invention, the DNA nucleotide sequence encoding the amino acid sequence of CRM197 protein (SEQ ID NO: 3) was also optimized for E. coli expression (SEQ ID NO: 2). The DNA fragment of each designed signal sequence and the optimized CRM197 DNA fragment were inserted into the plasmid pHex1.3 (Fig. 3).

In the present invention, the gene of the CRM197 protein can be used without limitation as long as it is a gene encoding the CRM197 protein. Preferably, it may be characterized by being represented by the nucleotide sequence of SEQ ID NO: 2, but is not limited thereto.

As used herein, “transformation” refers to the introduction of a specific foreign DNA strand from outside the cell into the cell. The host microorganism including the introduced DNA strand is called a “transformed microorganism”. By introducing DNA into the host,'transformation', meaning that the DNA can be replicated as an extrachromosomal factor or by chromosomal integration, introduces a vector containing a polynucleotide encoding a target protein into a host cell or introduces the target protein. It means that the coding polynucleotide is integrated into the chromosome of the host cell, so that the protein encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide includes all of them, whether they can be inserted into the host cell's chromosome or located outside the chromosome, as long as it can be expressed in the host cell.

In the present invention, the "nucleic acid construct" includes all of these, regardless of whether they are inserted into the chromosome of the host cell or located outside the chromosome, as long as they can be expressed in the host cell.

In addition, in the present specification, the “polynucleotide” is used in the same sense as “nucleic acid,” and includes DNA and RNA encoding a target protein. As long as the polynucleotide can be expressed by being introduced into a host cell, it does not matter what form it is introduced into. For example, the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all elements necessary for self-expression. The expression cassette usually includes a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replicating. In addition, the polynucleotide may be introduced into a host cell in its own form, and may be operably linked to a sequence required for expression in the host cell.

As used herein, “vector” means a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host. The vector can be a plasmid, phage particle or simply a potential genomic insert. When transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Because plasmids are the most commonly used form of current vectors, “plasmid” and “vector” are sometimes used interchangeably in the context of the present invention.

For the purposes of the present invention, it is preferred to use plasmid vectors. Typical plasmid vectors that can be used for this purpose include: (a) a replication initiation point for efficient replication to include dozens to hundreds of plasmid vectors per host cell, (b) selection of host cells transformed with plasmid vectors. It has a structure that includes a restriction enzyme cleavage site that allows the insertion of foreign DNA fragments and (c) an antibiotic resistance gene. Even if a suitable restriction enzyme cleavage site does not exist, a synthetic oligonucleotide adapter or linker according to a conventional method can be used to easily ligate a vector and foreign DNA.

In addition, the gene is “operably linked” when placed in a functional relationship with other nucleic acid sequences. This can be a gene and regulatory sequence(s) linked in a manner that enables gene expression when an appropriate molecule (eg, a transcriptional activation protein) is coupled to the regulatory sequence(s). For example, DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide when expressed as a shear protein that participates in the secretion of the polypeptide; A promoter or enhancer is operably linked to a coding sequence when it affects transcription of the sequence; Or the ribosome binding site is operably linked to the coding sequence if it affects the transcription of the sequence; Alternatively, the ribosome binding site is operably linked to the coding sequence when arranged to facilitate translation.

Generally, “operably linked” means that the linked DNA sequence is in contact, and in the case of a secretory leader, is in contact and is present in the reading frame. However, the enhancer does not need to be in contact. Linking these sequences is accomplished by ligation (linking) at convenient restriction enzyme sites. If such a site does not exist, a synthetic oligonucleotide adapter or linker according to a conventional method is used.

In the present invention, the expression vector may be characterized in that it further comprises a Trc promoter.

In the present invention, the expression vector may be characterized as being pHex1.3, but is not limited thereto.

CRM197 is known to be very toxic to E. coli due to the presence of nuclease activity. Therefore, under unfavorable conditions, CRM197 expression can adversely affect E. coli growth. The E. coli expression plasmid pHex1.3 has the LacI gene and can suppress the background expression of the trc promoter, and the expression module TPB1Tv1.3 (FIG. 1) inserted into this plasmid is derived from λ phage upstream of the CRM197 gene to be expressed. The tR2 transcription terminator, the T7 phage-derived Te transcription terminator, and the E. coli-derived rrnB T1T2 transcription terminator were inserted downstream and designed to suppress the expression of CRM197 transcribed from the plasmid-derived promoter.

In another aspect, the present invention relates to a recombinant microorganism into which the nucleic acid construct or expression vector is introduced.

In the present invention, the recombinant microorganism is Escherichia coli ( Escherichia coli ), but is not limited thereto.

In the recombinant microorganism, host cells having high DNA introduction efficiency and high expression efficiency of the introduced DNA are commonly used. As all microorganisms including prokaryotic and eukaryotic cells, bacteria, yeast, fungi, and the like are available, and the present invention E. coli was used in the embodiment of the present invention, but is not limited thereto, and any type of microorganism may be used as long as the CRM197 protein can be sufficiently expressed.

Of course, not all vectors function equally well to express the DNA sequence of the present invention, and likewise, not all hosts function equally to the same expression system. However, a person skilled in the art can select and apply appropriately among various other vectors, expression control sequences and hosts without departing from the scope of the present invention without undue experimental burden. For example, when selecting a vector, the host must be considered, because the vector must be replicated therein, the number of copies of the vector, the ability to control the number of copies, and other proteins encoded by the vector, e.g. For example, the expression of antibiotic markers should also be considered.

The transformed recombinant microorganism can be prepared according to any conventionally known transformation method.

In addition, in the present invention, as a method of inserting the gene on the chromosome of the host cell, a commonly known gene manipulation method may be used, and examples thereof include retrovirus vector, adenovirus vector, adeno-associated virus vector, and herpes simplex. And a viral vector, poxvirus vector, lentiviral vector, or non-viral vector.

In addition, in addition to a method using an expression vector, a method of directly inserting the nucleic acid construct onto a chromosome of a host cell may be used as a transformation method.

In general, electroporaton, lipofection, ballistic, virosome, liposome, immunoliposome, polycationic or lipid: nucleic acid conjugate, naked DNA, artificial viron, chemical-promoting DNA inflow, calcium phosphate (CaPO ₄ ) Precipitation, calcium chloride (CaCl ₂ ) precipitation, microinjection, lithium acetate-DMSO, and the like can be used.

Sonoporation, for example, using the Sonitron 2000 system (Rich-Mar) can also be used for the delivery of nucleic acids. Other representative nucleic acid delivery systems are Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Maryland). And BTX Molesular Syetem (Holliston, MA). Lipofection methods are specified in U.S. Patent Nos. 5,049,386, 4,946,787 and 4,897,355, and lipofection reagents are commercially available, e.g., TRANSFECTAM ^TM And LIPOFECTIN ^™ . Cationic or neutral lipids suitable for effective receptor-recognition lipofection of polynucleotides include Felgner's lipids (WO91/17424 and WO91/16024) and can be delivered to cells via ex vivo introduction and to target tissues via in vivo introduction. have. Methods of preparing lipid:nucleic acid complexes containing target liposomes, such as immunolipid complexes, are well known in the art (Crystal, Science., 270:404-410, 1995; Blaese et. al . , Cancer Gene Ther., 2:291-297, 1995; Behr et al . , Bioconjugate Chem., 5:382389, 1994; Remy et al ., Bioconjugate Chem., 5:647-654, 1994; Gao et al . , Gene Therapy., 2:710-722, 1995; Ahmad et al . , Cancer Res., 52:4817-4820, 1992; U.S. Patent 4,186,183; U.S. Patent No. 4,217,344; U.S. Patent No. 4,235,871; U.S. Patent 4,261,975; U.S. Patent 4,485,054; U.S. Patent 4,501,728; U.S. Patent 4,774,085; U.S. Patent No. 4,837,028; U.S. Patent No. 4,946,787).

In one embodiment of the present invention, as a result of transforming the prepared plasmid vector into various E. coli strains (Table 4), CRM197 was expressed in all strains in the case of L3 fusion, and CRM197 in the strains except Origami™ 2 in the case of L5 fusion. Was expressed (Fig. 4). Both L3 and L5 fusion were able to express the CRM197 protein in a soluble form even in a strain that did not manipulate the redox potential-related genes (trxB, gor), and the proteins had the same physicochemical/immunological properties as proteins isolated from the parental bacteria. . In addition, in the case of L3 fusion, CRM197 protein could be expressed in a soluble form at 25°C as well as at 30°C (FIG. 7, FIG. 12A).

According to previous reports, when cultured at pH 6.5~6.8, and shifted to pH 7.5 during induction, secretion to CRM197 periplasm is improved. In contrast, in the case of the strain prepared in the present invention, efficient secretion of CRM197 into the periplasm without pH shift of the medium was confirmed (FIG. 12 ). In a high concentration culture without pH shift, the productivity of CRM197 was 3.7g/L for L5 fusion and CRM197 secreted to periplasm was 2g/L or more.

In another aspect, the present invention, (a) culturing a recombinant microorganism in which the nucleic acid construct or expression vector is introduced to generate a CRM197 protein; And (b) separating the generated CRM197 protein.

In the present invention, step (b) may be characterized by separating the CRM197 protein secreted in the periplasm.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

Example One: CRM197 Overexpression plasmid preparation

Example 1.1: Plasmid pHex1 .3 Manufacturing

E. coli expression plasmid pHex1.3 was prepared as follows. After double digestion of ptrc99a (Amann et al., Gene. 69, 301-15, 1988) with Ssp I and Dra I, about 3.2 kb DNA fragment was purified using agarose electrophoresis. Kanamycin resistant gene was amplified using PCR. As the template used, plasmid pCR2.1 and primer were used KF2 and KR (Table 1).

PCR primer Primer Base sequence (5' -> 3') template purpose Sequence number KF2 GCGGATCCAAGAGACAGGATGAGGATCGTTTCGC pCR2.1 Km gene amplification 22 KR CGGATATCAAGCTTGGAAATGTTGAATACTCATACTCTTC 23 TPB_F GAGATCCGGAGCTTATACTGAGCTAATAAC TPB1Tv1.3 TPB1Tv1.3 amplification, insert confirmation 24 TPB_R GAAAAATAAACAAAAACAAAAAGAGTTTG 25 pHex_F TACAAACTCTTTTTGTTTTTGTTTATTTTTC pHex1.1 pHex1.1 backbpne amplification 26 pHex_R CCTGTTATTAGCTCAGTATAAGCTCCGGATCTCG 27 L1F AATTGGAGGAACAATATGAAATATCT L1 L1 signal seq. Amplification 28 L1R AACATCGTCAGCGCCCGCCATCGCCGGCT 29 L2F TTGGAGGAACAATATGAAAAAAAGCCT L2 L2 signal seq. Amplification 30 L2R AACATCGTCAGCGCCGGCAAACGACAGCAT 31 L3F TTGGAGGAACAATATGCGTTCTGTGA L3 L3 signal seq. Amplification 32 L3R AACATCGTCAGCGCCGGCGCTCACGCAA 33 L4F TTGGAGGAACAATATGCGTGCGAAACT L4 L4 signal seq. Amplification 34 L4R AACATCGTCAGCGCCGGCAAAGCTGGAAAT 35 L5F TTGGAGGAACAATATGAAAAAAACC L5 L5 signal seq. Amplification 36 L5R AACATCGTCAGCGCCCGCCTGCGCCACGGT 37 L6F TTGGAGGAACAATATGAAACTGCTGA L6 L6 signal seq. Amplification 38 L6R AACATCGTCAGCGCCGGCAAAACTACTGCT 39 L7F TTGGAGGAACAATATGAAAAAACTG L7 L7 signal seq. Amplification 40 L7R ACATCGTCAGCGCCGCTGTGGCTGTAAAA 41 L8F TTGGAGGAACAATATGAAAGCGACGAAA L8 L8 signal seq. Amplification 42 L8R AACATCGTCAGCGCCGCCCGCCAGCAGCGT 43 L9F TTGGAGGAACAATATGAAAGGTCTGAA L9 L9 signal seq. Amplification 44 L9R AACATCGTCAGCGCCCGCATGACCCGCGCA 45 C1F AGCCGGCGATGGCGGGCGCTGACGATG CRM197ec CRM197 amplification compatible with L1 46 C2F ATGCTGTCGTTTGCCGGCGCTGACGATG CRM197ec CRM297 amplification compatible with L2 47 C3F TTGCGTGAGCGCCGGCGCTGACGATG CRM197ec CRM197 amplification compatible with L3 48 C4F TTTCCAGCTTTGCCGGCGCTGACGATG CRM197ec CRM197 amplification compatible with L4 49 C5F ACCGTGGCGCAGGCGGGCGCTGACGATG CRM197ec CRM197 amplification compatible with L5 50 C6F AGCAGTAGTTTTGCCGGCGCTGACGATG CRM197ec CRM197 amplification compatible with L6 51 C7F TTTTACAGCCACAGCGGCGCTGACGATG CRM197ec CRM197 amplification compatible with L7 52 C8F TGCTGGCGGGCGGCGCTGACGATG CRM197ec CRM197 amplification compatible with L8 53 C9F CGCGGGTCATGCGGGCGCTGACGATG CRM197ec CRM197 amplification compatible with L9 54 C9R GATATCCGCTTTTCATTAGCTTTTAATCTCGAAGAA CRM197ec Reverse primer for all CRM197 amplification 55 crm_mconf GGCGCAAGCGTGCGCGGGTAACCGTGTGCG pHex-L#-CRM Insert confirmation 56

The conditions of the PCR reaction solution are 2.5 mM for dNTP, 10 pmol for each primer, template DNA, 200 to 500 ng, PrimeSTAR HS DNA Polymerase (Takara Bio Inc., Japan) 1.25 U, reaction volume 50 μl, and PCR conditions are 98° C. 10 3 steps of 30 seconds at 60°C for 5 seconds at 72°C/min were repeated 30 times. After double digestion of the DNA fragment of about 0.8kb generated with the PCR conditions with Bam HI and Hin dIII, fill-in with blunt end using klenow fragment, 3.2kb DNA fragment and T4 prepared in the previous step It was ligated using DNA ligase. The reaction solution was transformed into E. coli C2984H to prepare pHex1.1 in which the selection marker was substituted with Km in Amp.

The expression module TPB1Bv1.3 (FIG. 1) including Promoter, RBS, and transcription terminator was synthesized from Bioneer (SEQ ID NO: 1). The process of loading the expression module TPB1Bv1.3 into pHex1.3 is as follows. DNA fragment obtained by PCR amplification using the expression module TPB1Bv1.3 as a template, TPB_F, and TPB_R as a primer (Table 1), and DNA amplified by PCR using pHex1.1 as a template, pHex_F, and pHex_R as a primer fragment (4561bp) a ligation-independent cloning into the conditions as shown in Table 2; in using (LIC.. Jeong et al, Appl Environ Microbiol 78, 5440-3, 2012) After assemble in vitro , pHex1.3 was prepared by transformation into E. coli C2984H (FIG. 2).

LIC reaction solution Stock conc. Linearized vector 100ng Insert 1 40ng Insert 2 (if necessary) 40ng T4 DNA polymerase (NEB) 1U H ₂ 0 Up to 10μL

LIC reaction conditions: Vectors are cut with restriction enzymes or made into linear DNA fragments using PCR. Inserts are prepared using PCR. The vector and insert were mixed as shown in the table above, and reacted at room temperature for 2 minutes 30 seconds.

Example 1.2: CRM197 Gene manufacturing

The base sequence of CRM197 optimized for expression in E. coli (CRM197ec) was synthesized by Genscript (SEQ ID NO: 2). The amino acid sequence coding for CRM197ec is as SEQ ID NO: 3.

Example 1.3: Signal sequence Gene manufacturing

Signal sequences used to secrete CRM197 protein into the periplasm of E. coli are shown in Table 3 below (SEQ ID NOs: 13 to 21). In order to optimize expression in E. coli, considering the codon context and secondary structure, DNAs of SEQ ID NOs: 4 to 12 were synthesized (Table 3).

Signal sequence used in the present invention name Explanation Amino acid sequence Base sequence (5' -> 3') L1 PelB signal sequence MKYLLPTAAAGLLLLAAQPAMA
(SEQ ID NO: 13) GGTCTCATATGAAATATCTGTTACCGACCGCCGCTGCCGGACTGCTGTTACTGGCGGCGCAGCCGGCGATGGCGGGCGAGAGACC
(SEQ ID NO: 4) L2 M13 G8 signal sequence MKKSLVLKASVAVATLVPMLSFA
(SEQ ID NO: 14) GGTCTCATATGAAAAAAAGCCTGGTTCTGAAAGCGTCTGTTGCGGTGGCGACGCTGGTGCCGATGCTGTCGTTTGCCGGCGAGAGACC
(SEQ ID NO: 5) L3 E. coli hypothetical protein (WP_001258047) signal sequence MRSVIVAFLFACSFCVSA
(SEQ ID NO: 15) GGTCTCATATGCGTTCTGTGATTGTTGCCTTCCTGTTTGCCTGTAGCTTTTGCGTGAGCGCCGGCGAGAGACC
(SEQ ID NO: 6) L4 E. coli OmpT signal sequence MRAKLLGIVLTTPIAISSFA
(SEQ ID NO: 16) GGTCTCATATGCGTGCGAAACTGCTCGGCATTGTTCTGACCACCCCGATTGCCATTTCCAGCTTTGCCGGCGAGAGACC
(SEQ ID NO: 7) L5 E. coli OmpA signal sequence MKKTAIAIAVALAGFATVAQA
(SEQ ID NO: 17) GGTCTCATATGAAAAAAACCGCCATCGCCATTGCCGTTGCCCTCGCTGGCTTTGCCACCGTGGCGCAGGCGGGCGAGAGACC
(SEQ ID NO: 8) L6 M13 G4 signal sequence MKLLNVINFVFLMFVSSSSFA
(SEQ ID NO: 18) GGTCTCATATGAAACTGCTGAACGTGATCAACTTTGTTTTCCTGATGTTTGTCAGCAGCAGTAGTTTTGCCGGCGAGAGACC
(SEQ ID NO: 9) L7 M13 G3 signal sequence MKKLLFAIPLVVPFYSHS
(SEQ ID NO: 19) GGTCTCATATGAAAAAACTGCTGTTTGCCATTCCGCTGGTTGTACCGTTTTACAGCCACAGCGGCGAGAGACC
(SEQ ID NO: 10) L8 E. coli Lpp signal sequence MKATKLVLGAVILGSTLLAG
(SEQ ID NO: 20) GGTCTCATATGAAAGCGACGAAACTGGTGCTGGGTGCTGTGATTCTGGGCAGCACGCTGCTGGCGGGCGGCGAGAGACC
(SEQ ID NO: 11) L9 E. coli GspD signal sequence MKGLNKITCCLLAALLMPCAGHA
(SEQ ID NO: 21) GGTCTCATATGAAAGGTCTGAATAAAATTACCTGCTGTTTACTGGCGGCGCTGCTGATGCCGTGCGCGGGTCATGCGGGCGAGAGACC
(SEQ ID NO: 12)

Example 1.4: CRM197 Preparation of plasmid for overexpression

A plasmid for overexpressing CRM197 in E. coli and secreting it into periplasm was prepared as shown in FIG. 3. After double digestion of pHex1.3 with Bsa I and Dra I, DNA fragments of about 5 kb were isolated using agarose electrophoresis. Signal sequences L1 to L9 were PCR amplified using the primers and templates in Table 1. The CRM197 DNA fragment for fusion of the CRM197 gene to each signal sequence using the LIC method was PCR amplified using the primers and templates in Table 1. The pHex1.3 cut by Bsa I and Dra I, each signal sequence fragment, and the compatible CRM197 fragment are in vitro After assembling in E. coli C2984H, the plasmids pHex-L1-CRM, pHex-L2-CRM, pHex-L3-CRM, pHex-L4-CRM, containing CRM197 fused with each signal sequence, pHex-L5-CRM, pHex-L6-CRM, pHex-L7-CRM, pHex-L8-CRM, pHex-L9-CRM were prepared.

Example 2: in E. coli CRM197 Protein expression

In the plasmid prepared in Example 1, pHex-L3-CRM and pHex-L5-CRM were selected in consideration of the expression level and the degree of cell growth. It was transformed into the E. coli strain of Table 4 below to investigate expression and expression position of the CRM197 protein.

E. coli strain used in the present invention Vendor Genotype O Origami™ 2 Novagen K12 Δ(ara-leu)7697 ΔlacX74 ΔphoAPvuIIphoR araD139 ahpCgalEgalKrpsL F′[lac+ lacIq pro] gor522::Tn10 trxB(CamR, StrR, TetR) S Shuffle NEB B fhuA2 [lon] ompTahpC gal λatt::pNEB3-r1-cDsbC (SpecR, lacIq) ΔtrxBsulA11 R(mcr-73::miniTn10--TetS)2 [dcm] R(zgb-210::Tn10 --TetS) endA1 Δgor Δ(mcrC-mrr) 114::IS10 C C2894H NEB K12 F'proA+B+ lacIq ΔlacZM15 / fhuA2 Δ(lac-proAB) glnV galK16 galE15 R(zgb-210::Tn10)TetS endA1 thi-1 Δ(hsdS-mcrB)5 W W3110-1 KCTC K12 F- λ- rph-1 INV (rrnD, rrnE), ΔompT B BL21(DE3) B F- ompT gal dcmlonhsdSB(rB-mB-) λ(DE3 [lacI lacUV5-T7p07 ind1 sam7 nin5]) [malB+]K-12(λS)

The culture method is LB liquid containing 100mM Potassium phosphate (pH 7.5), 50 μg/ml, 0.2% Lactose in colony generated in solid medium (soytone 1%, Yeast extract 0.5%, NaCl 1%, agar 1.5%) After shaking culture at 30° C. for 15 hours in the medium, total cells were subjected to SDS PAGE, and then expression of CRM197 was analyzed using Coomassie Blue straining and Western blotting (FIG. 4 ). The L3 fusion expressed CRM197 protein in all the strains used, but in the case of L5 fusion, it did not grow in the liquid medium when transformed with Origami™ 2. In other strains, CRM197 protein expression was observed.

Example 2.1: by L5 CRM197 Manifestation

BL21 (DE3) containing pHex-L5-CRM in LB liquid medium (50mL/500mL baffled flask) containing 100mM Potassium phosphate (pH 7.5), km 50μg/ml until OD ₆₀₀ reaches 0.4~0.6 After cultivation, lactose 0.2 and 0.4 as inducers. Expression was induced by adding 0.6%, or IPTG (Isopropyl β-D-1-thiogalactopyranosid) 0.02, 0.2, 2 mM. The culture temperature was 25°C or 30°C. After incubation, the cells were recovered, suspended in 50 mM potassium phosphate (pH 7.0), and then sonication was performed to crush the cells. After crushing, centrifugation was performed to separate the soluble fraction and the insoluble fraction. After SDS_PAGE of each sample, the expression of CRM197 protein was analyzed using Coomassie straining and Western blotting (FIG. 5). When inducer (lactose, IPTG) was added, most of the expressed CRM197 protein was present in a soluble form when cultured at 25°C. Considering that the molecular weight of the reference CRM197 was the same, the expressed protein was matured with the L5 signal sequence removed. It is judged as CRM197 (Fig. 5A). On the other hand, when cultured at 30°C, when lactose was used as an inducer, about 50% of the CRM197 protein was found in the insoluble fraction, and when IPTG was added as an inducer, most of the CRM197 protein was found in the insoluble fraction (FIG. 5B).

To confirm the expression position of CRM197, periplasm fraction was recovered using osmotic shock. The process is as follows. After culturing BL21 (DE3) containing pHex-L5-CRM at 25°C, cells were recovered by centrifugation. Plasma membrane induction buffer solution (30 mM Tris-HCl (pH 8.0), 20% sucrose, 1 or 10 mM EDTA, 1 mM PMSF (Phenylmethylsulfonyl fluoride)) was resuspended to a cell concentration of OD ₆₀₀ 10, followed by 0.5 to 1 hour at room temperature. While stirring. Then, cells were collected by centrifugation at 4,000 xg for 15 minutes, and the same amount of cold 30 mM Tris-HCl (pH 8.0) at 4° C. or less was added and stirred at room temperature for 0.5 to 1 hour. Subsequently, supernatant was obtained by centrifugation at 4,000 xg for 15 minutes (periplasmic fraction, P2). After treatment of the plasma membrane-induced buffer solution, supernatant (P1), periplasmic fraction (P2), and cytoplasm faction were developed using SDS-PAGE, and expression and expression position of CRM197 was examined using Coomassie straining and Western blotting (FIG. 5). ). It was confirmed that L5 can successfully secrete CRM197 into periplasm (FIG. 6). EDTA in the plasma membrane-induced buffer solution was effective when 10 mM than 1 mM.

Example 2.2: by L3 CRM197 Manifestation

BL21 (DE3) containing pHex-L3-CRM was expressed under the same conditions as in Example 2.1. In the case of CRM197 induced by L3, unlike L5, it was present in a soluble form under all conditions (FIG. 7) and was confirmed to be secreted into periplasm (FIG. 8).

Example 3: Culture of E. coli BL21 (DE3)

BL21 (DE3) strains containing pHex-L3-CRM or pHex-L5-CRM were cultured in the following manner. In the main culture, feeding was performed using a pH stat method, and the pH was maintained at pH 7.3 using an influx solution (Feeding solution: 600 g/L glucose, 30 g/L yeast extract) and a basic solution (Alkali solution: 14-15% ammonia). . The solution and medium composition used for the culture are shown in Table 5 and Table 6.

Solution and medium composition used for culturing the present invention Culture medium (/L) Main culture medium (/L) Feeding solution(/L) pH adjust Casamino acids 20 g 20 g - Using ammonia solution (14~15%) Yeast extract 10 g 10 g 30 g (NH ₄ ) ₂ SO ₄ 7 g 7 g - K ₂ HPO ₄ 2.5 g 2.5 g - NaCl 0.5 g 0.5 g - Trace metal (100x) 10 mL 10 mL - Glutamic acids Added after auto-clave 2 g 2 g - CaCl ₂ ㆍ2H ₂ O 10 mg 10 mg - Glucose 15 g 15 g 600 g MgSO ₄ ㆍ7H ₂ O 2.5 g 2.5 g - Km50 1 mL 1 mL - SB2121 (antifoam) - 0.1% - pH adjust 7.3
(using 1 ~ 4M NaOH)

Trace metal composition used in the culture of the present invention Trace metal (100x, /L) EDTA 840 mg CoCl ₂ ㆍ6H ₂ O 250 mg MnCl ₂ ㆍ4H ₂ O 1.5 g CuCl ₂ ㆍ2H ₂ O 150 mg H ₃ BO ₃ 300 mg Na ₂ MoO ₄ ㆍ2H ₂ O 250 mg Zn(CH ₃ COO) ₂ ㆍ2H ₂ O 1.3 g Fe(Ⅲ)citrate 10 g

A single colony formed from modified LB agar medium [Modified Luria-Bertani (LB) agar: 10 g/L of soytone, 5 g/L of yeast extract, 10 g/L of sodium chloride, 15 g/L of agar, 50 mg/L of kanamycin] was added to the seed culture medium. Inoculated, and cultured at 30 ℃ for 18 hours. This seed culture was inoculated again in the main culture medium (3L/5L fermenter) at a rate of 1% (v/v) and cultured at 30°C. In the main culture medium, 0.1% of an additional sterilized foam inhibitor was added to the seed culture medium. After the absorbance of the culture broth had a value of 30-40, the temperature was lowered to 25°C. Next, 10 mM of IPTG was added, and the culture was terminated after the absorbance of the culture solution reached 100-120.

The culture pattern of E. coli BL21 (DE3) containing pHex-L3-CRM in 5L fermenter is shown in FIG. 9, and the culture pattern of E. coli BL21 (DE3) containing pHex-L5-CRM in FIG. 10. When fermented in a 5L fermenter, the expression pattern of CRM197 expressed is as shown in FIG. 11, and the expression yield was 1.1 to 1.2 g/L for L3 fusion and 3.0 to 3.7 g/L for L5 fusion. Quantification of CRM197 was performed by comparing the relative quantity with reference CRM197 using densitometer (GS-900™, Bio-rad laboratories Ins., Hercules, California) after SDS-PAGE/Coomassie straining.

Example 4: protein purification

Example 4.1: From cell culture periplasmic fraction Produce

The process of recovering the periplasmic fraction from cells cultured in a 5L fermenter is as follows. The cells were precipitated by centrifuging the cell culture solution at 4°C and 4,000 x g for 15 minutes. The cell precipitate was resuspended in a plasma membrane-derived buffer solution (Table 7) of the modified protein based on absorbance 100, and stirred at room temperature for 0.5 to 1 hour.

Composition of buffer solution used in the preparation of periplasmic fraction of the present invention Periplasting buffer Shock buffer(cold) Tris-HCl (pH 8.0) 30 mM 30 mM Sucrose 20% - EDTA 10 mM - PMSF 1 mM -

Thereafter, cells were collected by centrifugation at 4,000 x g for 15 minutes, and the same amount of cold 30 mM Tris-HCl [pH 8.0] of 4° C. or less was added and stirred at room temperature for 0.5 to 1 hour. Thereafter, the supernatant was collected by centrifugation at 4,000 x g for 15 minutes, and impurities were removed using MF. SDS-PAGE analysis of the periplasmic fraction recovered from E. coli BL21 (DE3) containing pHex-L3-CRM through the above procedure is shown in Figure 12(A), E. coli BL21 (DE3) containing pHex-L5-CRM SDS-PAGE analysis of the periplasmic fraction was shown in Figure 12 (B). The amount of CRM197 protein present in the periplasmic fraction was found to be 1.2 g/L for the L3 strain and 2.3 g/L for the L5 strain (Table 8).

The amount of CRM197 protein obtained through the culture of the present invention L3 L5 Periplasm batch #1 batch #2 batch #1 batch #2 batch #3 L3_#2 L5_#1 Final OD ₆₀₀ 109.4 118 119.8 107 112 100 100 Total CRM (g/L) 1.18 1.06 3.74 2.95 3.74 1.18 2.30

Example 4.2: CRM197 Purification of protein

The periplasmic fraction of the pHex-L3-CRM culture was taken and concentrated twice with a 10 kDa cut-off membrane using a TFF system, and ultrafiltration was performed with 10 times the volume of 10 mM sodium phosphate solvent (pH 7.2). Purification was completed through two column processes using an AKTA pure (GE Helthcare) system. The first column process is anion exchange chromatography (Diethyl aminoetyl Separose Fast Flow resin, DEAE) and was used for the purpose of removing nucleic acid and impurity proteins. DEAE Resin has a (-) charge, so a protein with a (+) charge is bound. Untreated proteins and impurities are firstly removed through DEAE Chromatography and removed from the samples subjected to ultrafiltration, followed by a subsequent washing process to remove impurity proteins with low binding power except CRM197 according to the salt concentration. Then, the salt concentration was increased to elute only CRM197. SDS-PAGE analysis was performed on the sample during the purification process using DEAE Chromatography, and the results are shown in FIG. 13(A). The samples subjected to DEAE Chromatography were firstly removed through flow-through of unbound impurities and proteins using Hydroxyapatite (HA) chromatography, and CRM197 was eluted with a final 100 mM Potassium phosphate and 100 mM NaCl solvent. The result of SDS-PAGE of the eluted CRM197 is shown in Fig. 13(B).

Example 5: Corynebacterium production With CRM197 compare

Quality and characteristics of the final purified CRM197 were analyzed. As a result of analysis by SEC-HPLC, it was confirmed that the purity was 99% or more (FIG. 14). Through SDS-PAGE and Western blot analysis, it was confirmed that a band appeared at the same position as CRM197 produced by Corynebacterium (FIG. 15).

In addition, it was confirmed that the total sequence of 535 amino acids constituting CRM197 was 100% identical, and as a result of measuring the molecular weight, a main peak of 58,409 Da was confirmed, which was consistent with the theoretical molecular weight value (FIG. 16). Through the circular dichroism (CD) analysis, the higher order structure was confirmed, and there was no difference between the higher order structure and CRM197 produced by Corynebacterium (FIG. 17). As a result of fluorescence spectrum analysis, the maximum emission wavelength was 338 nm, which was the same as that of Corynebacterium production CRM197 (Fig. 18).

Through the above results, it was confirmed that CRM197 produced using the E. coli pHex-L3 strain is the same protein as physicochemical and immunologically with CRM197 produced by Corynebacterium.

Since specific parts of the present invention have been described in detail above, it will be apparent to those skilled in the art that this specific technique is only a preferred embodiment, and the scope of the present invention is not limited thereby. will be. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> GENOFOCUS CO., LTD. Eubiologics.Co.,LTD <120> Expression Method of CRM197 Protein <130> P19-B342 <160> 56 <170> KoPatentIn 3.0 <210> 1 <211> 1226 <212> DNA <213> Artificial Sequence <220> <223> TPB1Tv1.3 <400> 1 tactgagcta ataacaggcc tgctggtaat cgcaggcctt tttatttctg gctcaccttc 60 gggtgggcct ttctgcgttt acggttctgg caaatattct gaaatgagct gttgacaatt 120 aatcatccgg ctcgtataat gtgtggaatt gtgagcggat aacaatttac tgctctttaa 180 caatttatca gatccaattg gaggaacaat atgggagacc acgcgcgcga ggtctcatct 240 gcggcggcag cagggggatc gatgagcaaa ggtgaagagc tgtttaccgg tgtggtgccg 300 attctggttg aactggatgg cgacgttaac ggccataaat tcagcgtcag cggcgagggc 360 gaaggggatg ccacctacgg taaactgacc ctgaagttta tttgcaccac cggcaaatta 420 ccggttccgt ggccgacgct ggtgacgacc tttagctatg gcgtgcagtg cttttcccgt 480 tatccggacc atatgaaaca gcatgatttt tttaaaagcg cgatgccgga aggctatgtt 540 caggaacgta ccattttctt taaggatgac ggcaattaca aaacccgcgc ggaagtgaaa 600 tttgaaggtg ataccctggt caaccgcatt gaactgaaag gcattgattt caaagaagat 660 ggtaatattc tcggtcataa gctggaatat aactacaaca gccataacgt ttatatcatg 720 gcggataaac aaaaaaacgg tattaaagtg aactttaaaa ttcgccataa tatcgaagat 780 ggtagcgtgc aactggcgga tcattatcag cagaacaccc caattggcga tggcccggtg 840 ttgctgccgg ataaccacta tctgagcacc cagtcggcgc tgagtaaaga tccgaacgaa 900 aaacgcgatc acatggtgct gctggagttt gtcaccgccg ccggtatcac ccacggcatg 960 gatgaactgt ataaataatg atttaaagcg gatatcaaat aaaacgaaag gctcagtcga 1020 aagactgggc ctttcgtttt atctgttgtt tgtcggtgaa cgctctcctg agtaggacaa 1080 atccgccggg agcggatttg aacgttgcga agcaacggcc cggagggtgg cgggcaggac 1140 gcccgccata aactgccagg catcaaatta agcagaaggc catcctgacg gatggccttt 1200 ttgcgtttct acaaactctt tttgtt 1226 <210> 2 <211> 1625 <212> DNA <213> Artificial Sequence <220> <223> CRM197ec <400> 2 gaagacacgg cgctgacgat gttgttgaca gcagcaagag ctttgttatg gagaatttca 60 gcagctatca cggcaccaaa ccgggctatg ttgacagcat tcagaaaggc atccaaaagc 120 cgaaaagcgg tacccagggc aactacgacg atgactggaa agagttttat agcaccgata 180 acaagtacga cgcggcgggc tatagcgttg ataacgaaaa cccgctgagc ggtaaagcgg 240 gtggcgtggt taaggtgacc tacccgggtc tgaccaaagt gctggcgctg aaggttgaca 300 acgcggaaac catcaagaaa gagctgggcc tgagcctgac cgaaccgctg atggagcagg 360 ttggtaccga ggaattcatt aagcgttttg gtgatggtgc gagccgtgtg gttctgagcc 420 tgccgttcgc ggaaggtagc agcagcgtgg agtacatcaa caactgggaa caagcgaaag 480 cgctgagcgt ggagctggaa attaacttcg aaacccgtgg caagcgtggc caggatgcga 540 tgtacgaata tatggcgcaa gcgtgcgcgg gtaaccgtgt gcgtcgtagc gttggtagca 600 gcctgagctg cattaacctg gattgggacg ttatccgtga caagaccaaa accaagatcg 660 aaagcctgaa agagcacggt ccgattaaaa acaagatgag cgagagcccg aacaagaccg 720 tgagcgagga aaaagcgaag cagtacctgg aggaatttca ccaaaccgcg ctggagcacc 780 cggaactgag cgagctgaaa accgtgaccg gcaccaaccc ggttttcgcg ggtgcgaact 840 atgcggcgtg ggcggtgaac gttgcgcagg tgatcgatag cgaaaccgcg gacaacctgg 900 aaaagaccac cgcggcgctg agcatcctgc cgggtattgg cagcgtgatg ggcatcgcgg 960 atggtgcggt tcaccacaac accgaggaaa tcgtggcgca gagcattgcg ctgagcagcc 1020 tgatggttgc gcaagcgatc ccgctggttg gtgagctggt tgacattggt ttcgcggcgt 1080 acaactttgt ggaaagcatc attaacctgt tccaggtggt tcacaacagc tacaaccgtc 1140 cggcgtatag cccgggccac aaaacccaac cgtttctgca cgatggttat gcggtgagct 1200 ggaacaccgt tgaggacagc atcattcgta ccggtttcca gggcgagagc ggtcacgata 1260 tcaagattac cgcggaaaac accccgctgc cgattgcggg cgttctgctg ccgaccattc 1320 cgggtaaact ggacgttaac aaaagcaaga cccacattag cgtgaacggc cgtaagatcc 1380 gtatgcgttg ccgtgcgatt gatggtgacg tgaccttttg ccgtccgaaa agcccggtgt 1440 acgttggtaa cggcgtgcac gcgaacctgc acgttgcgtt ccaccgtagc agcagcgaga 1500 agatccacag caacgaaatt agcagcgaca gcatcggcgt tctgggttat caaaaaaccg 1560 tggatcatac caaagtgaat agcaagctga gcctgttctt cgagattaaa agctctgagg 1620 tcttc 1625 <210> 3 <211> 535 <212> PRT <213> Artificial Sequence <220> <223> CRM197 <400> 3 Gly Ala Asp Asp Val Val Asp Ser Ser Lys Ser Phe Val Met Glu Asn 1 5 10 15 Phe Ser Ser Tyr His Gly Thr Lys Pro Gly Tyr Val Asp Ser Ile Gln 20 25 30 Lys Gly Ile Gln Lys Pro Lys Ser Gly Thr Gln Gly Asn Tyr Asp Asp 35 40 45 Asp Trp Lys Glu Phe Tyr Ser Thr Asp Asn Lys Tyr Asp Ala Ala Gly 50 55 60 Tyr Ser Val Asp Asn Glu Asn Pro Leu Ser Gly Lys Ala Gly Gly Val 65 70 75 80 Val Lys Val Thr Tyr Pro Gly Leu Thr Lys Val Leu Ala Leu Lys Val 85 90 95 Asp Asn Ala Glu Thr Ile Lys Lys Glu Leu Gly Leu Ser Leu Thr Glu 100 105 110 Pro Leu Met Glu Gln Val Gly Thr Glu Glu Phe Ile Lys Arg Phe Gly 115 120 125 Asp Gly Ala Ser Arg Val Val Leu Ser Leu Pro Phe Ala Glu Gly Ser 130 135 140 Ser Ser Val Glu Tyr Ile Asn Asn Trp Glu Gln Ala Lys Ala Leu Ser 145 150 155 160 Val Glu Leu Glu Ile Asn Phe Glu Thr Arg Gly Lys Arg Gly Gln Asp 165 170 175 Ala Met Tyr Glu Tyr Met Ala Gln Ala Cys Ala Gly Asn Arg Val Arg 180 185 190 Arg Ser Val Gly Ser Ser Leu Ser Cys Ile Asn Leu Asp Trp Asp Val 195 200 205 Ile Arg Asp Lys Thr Lys Thr Lys Ile Glu Ser Leu Lys Glu His Gly 210 215 220 Pro Ile Lys Asn Lys Met Ser Glu Ser Pro Asn Lys Thr Val Ser Glu 225 230 235 240 Glu Lys Ala Lys Gln Tyr Leu Glu Glu Phe His Gln Thr Ala Leu Glu 245 250 255 His Pro Glu Leu Ser Glu Leu Lys Thr Val Thr Gly Thr Asn Pro Val 260 265 270 Phe Ala Gly Ala Asn Tyr Ala Ala Trp Ala Val Asn Val Ala Gln Val 275 280 285 Ile Asp Ser Glu Thr Ala Asp Asn Leu Glu Lys Thr Thr Ala Ala Leu 290 295 300 Ser Ile Leu Pro Gly Ile Gly Ser Val Met Gly Ile Ala Asp Gly Ala 305 310 315 320 Val His His Asn Thr Glu Glu Ile Val Ala Gln Ser Ile Ala Leu Ser 325 330 335 Ser Leu Met Val Ala Gln Ala Ile Pro Leu Val Gly Glu Leu Val Asp 340 345 350 Ile Gly Phe Ala Ala Tyr Asn Phe Val Glu Ser Ile Ile Asn Leu Phe 355 360 365 Gln Val Val His Asn Ser Tyr Asn Arg Pro Ala Tyr Ser Pro Gly His 370 375 380 Lys Thr Gln Pro Phe Leu His Asp Gly Tyr Ala Val Ser Trp Asn Thr 385 390 395 400 Val Glu Asp Ser Ile Ile Arg Thr Gly Phe Gln Gly Glu Ser Gly His 405 410 415 Asp Ile Lys Ile Thr Ala Glu Asn Thr Pro Leu Pro Ile Ala Gly Val 420 425 430 Leu Leu Pro Thr Ile Pro Gly Lys Leu Asp Val Asn Lys Ser Lys Thr 435 440 445 His Ile Ser Val Asn Gly Arg Lys Ile Arg Met Arg Cys Arg Ala Ile 450 455 460 Asp Gly Asp Val Thr Phe Cys Arg Pro Lys Ser Pro Val Tyr Val Gly 465 470 475 480 Asn Gly Val His Ala Asn Leu His Val Ala Phe His Arg Ser Ser Ser 485 490 495 Glu Lys Ile His Ser Asn Glu Ile Ser Ser Asp Ser Ile Gly Val Leu 500 505 510 Gly Tyr Gln Lys Thr Val Asp His Thr Lys Val Asn Ser Lys Leu Ser 515 520 525 Leu Phe Phe Glu Ile Lys Ser 530 535 <210> 4 <211> 85 <212> DNA <213> Artificial Sequence <220> <223> PelB (L1) <400> 4 ggtctcatat gaaatatctg ttaccgaccg ccgctgccgg actgctgtta ctggcggcgc 60 agccggcgat ggcgggcgag agacc 85 <210> 5 <211> 88 <212> DNA <213> Artificial Sequence <220> <223> G8 (L2) <400> 5 ggtctcatat gaaaaaaagc ctggttctga aagcgtctgt tgcggtggcg acgctggtgc 60 cgatgctgtc gtttgccggc gagagacc 88 <210> 6 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> Wp (L3) <400> 6 ggtctcatat gcgttctgtg attgttgcct tcctgtttgc ctgtagcttt tgcgtgagcg 60 ccggcgagag acc 73 <210> 7 <211> 79 <212> DNA <213> Artificial Sequence <220> <223> OmpT (L4) <400> 7 ggtctcatat gcgtgcgaaa ctgctcggca ttgttctgac caccccgatt gccatttcca 60 gctttgccgg cgagagacc 79 <210> 8 <211> 82 <212> DNA <213> Artificial Sequence <220> <223> OmpA (L5) <400> 8 ggtctcatat gaaaaaaacc gccatcgcca ttgccgttgc cctcgctggc tttgccaccg 60 tggcgcaggc gggcgagaga cc 82 <210> 9 <211> 82 <212> DNA <213> Artificial Sequence <220> <223> G4 (L6) <400> 9 ggtctcatat gaaactgctg aacgtgatca actttgtttt cctgatgttt gtcagcagca 60 gtagttttgc cggcgagaga cc 82 <210> 10 <211> 73 <212> DNA <213> Artificial Sequence <220> <223> G3 (L7) <400> 10 ggtctcatat gaaaaaactg ctgtttgcca ttccgctggt tgtaccgttt tacagccaca 60 gcggcgagag acc 73 <210> 11 <211> 79 <212> DNA <213> Artificial Sequence <220> <223> Lpp (L8) <400> 11 ggtctcatat gaaagcgacg aaactggtgc tgggtgctgt gattctgggc agcacgctgc 60 tggcgggcgg cgagagacc 79 <210> 12 <211> 88 <212> DNA <213> Artificial Sequence <220> <223> Gsp (L9) <400> 12 ggtctcatat gaaaggtctg aataaaatta cctgctgttt actggcggcg ctgctgatgc 60 cgtgcgcggg tcatgcgggc gagagacc 88 <210> 13 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> PelB (L1) <400> 13 Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala 1 5 10 15 Ala Gln Pro Ala Met Ala 20 <210> 14 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> G8 (L2) <400> 14 Met Lys Lys Ser Leu Val Leu Lys Ala Ser Val Ala Val Ala Thr Leu 1 5 10 15 Val Pro Met Leu Ser Phe Ala 20 <210> 15 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> Wp (L3) <400> 15 Met Arg Ser Val Ile Val Ala Phe Leu Phe Ala Cys Ser Phe Cys Val 1 5 10 15 Ser Ala <210> 16 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> OmpT (L4) <400> 16 Met Arg Ala Lys Leu Leu Gly Ile Val Leu Thr Thr Pro Ile Ala Ile 1 5 10 15 Ser Ser Phe Ala 20 <210> 17 <211> 21 <212> PRT <213> Artificial Sequence <220> <223> OmpA (L5) <400> 17 Met Lys Lys Thr Ala Ile Ala Ile Ala Val Ala Leu Ala Gly Phe Ala 1 5 10 15 Thr Val Ala Gln Ala 20 <210> 18 <211> 21 <212> PRT <213> Artificial Sequence <220> <223> G4 (L6) <400> 18 Met Lys Leu Leu Asn Val Ile Asn Phe Val Phe Leu Met Phe Val Ser 1 5 10 15 Ser Ser Ser Phe Ala 20 <210> 19 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> G3 (L7) <400> 19 Met Lys Lys Leu Leu Phe Ala Ile Pro Leu Val Val Pro Phe Tyr Ser 1 5 10 15 His Ser <210> 20 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> Lpp (L8) <400> 20 Met Lys Ala Thr Lys Leu Val Leu Gly Ala Val Ile Leu Gly Ser Thr 1 5 10 15 Leu Leu Ala Gly 20 <210> 21 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> Gsp (L9) <400> 21 Met Lys Gly Leu Asn Lys Ile Thr Cys Cys Leu Leu Ala Ala Leu Leu 1 5 10 15 Met Pro Cys Ala Gly His Ala 20 <210> 22 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 gcggatccaa gagacaggat gaggatcgtt tcgc 34 <210> 23 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 cggatatcaa gcttggaaat gttgaatact catactcttc 40 <210> 24 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 gagatccgga gcttatactg agctaataac 30 <210> 25 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 gaaaaataaa caaaaacaaa aagagtttg 29 <210> 26 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 tacaaactct ttttgttttt gtttattttt c 31 <210> 27 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 cctgttatta gctcagtata agctccggat ctcg 34 <210> 28 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 aattggagga acaatatgaa atatct 26 <210> 29 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 aacatcgtca gcgcccgcca tcgccggct 29 <210> 30 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 ttggaggaac aatatgaaaa aaagcct 27 <210> 31 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 aacatcgtca gcgccggcaa acgacagcat 30 <210> 32 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 ttggaggaac aatatgcgtt ctgtga 26 <210> 33 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 aacatcgtca gcgccggcgc tcacgcaa 28 <210> 34 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 ttggaggaac aatatgcgtg cgaaact 27 <210> 35 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 aacatcgtca gcgccggcaa agctggaaat 30 <210> 36 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 ttggaggaac aatatgaaaa aaacc 25 <210> 37 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 aacatcgtca gcgcccgcct gcgccacggt 30 <210> 38 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 ttggaggaac aatatgaaac tgctga 26 <210> 39 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 aacatcgtca gcgccggcaa aactactgct 30 <210> 40 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 40 ttggaggaac aatatgaaaa aactg 25 <210> 41 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 acatcgtcag cgccgctgtg gctgtaaaa 29 <210> 42 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 42 ttggaggaac aatatgaaag cgacgaaa 28 <210> 43 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 43 aacatcgtca gcgccgcccg ccagcagcgt 30 <210> 44 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 44 ttggaggaac aatatgaaag gtctgaa 27 <210> 45 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 45 aacatcgtca gcgcccgcat gacccgcgca 30 <210> 46 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 46 agccggcgat ggcgggcgct gacgatg 27 <210> 47 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 47 atgctgtcgt ttgccggcgc tgacgatg 28 <210> 48 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 48 ttgcgtgagc gccggcgctg acgatg 26 <210> 49 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 49 tttccagctt tgccggcgct gacgatg 27 <210> 50 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 50 accgtggcgc aggcgggcgc tgacgatg 28 <210> 51 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 51 agcagtagtt ttgccggcgc tgacgatg 28 <210> 52 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 52 ttttacagcc acagcggcgc tgacgatg 28 <210> 53 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 53 tgctggcggg cggcgctgac gatg 24 <210> 54 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 54 cgcgggtcat gcgggcgctg acgatg 26 <210> 55 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 55 gatatccgct tttcattagc ttttaatctc gaagaa 36 <210> 56 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 56 ggcgcaagcg tgcgcgggta accgtgtgcg 30

Claims (10)

A nucleic acid encoding a signal peptide for CRM197 protein expression, wherein the nucleic acid is represented by the nucleotide sequence of SEQ ID NO: 6.
A nucleic acid construct comprising the gene of claim 1 and the gene of CRM197 protein.
According to claim 2, wherein the gene of the CRM197 protein is a nucleic acid structure, characterized in that represented by the nucleotide sequence of SEQ ID NO: 2.
An expression vector comprising the nucleic acid of claim 1 and a gene of CRM197 protein.
5. The expression vector of claim 4, wherein the gene of CRM197 protein is represented by the nucleotide sequence of SEQ ID NO: 2.
The expression vector according to claim 4, further comprising a Trc promoter.
A recombinant microorganism into which the nucleic acid construct of claim 2 or the expression vector of claim 4 is introduced.
8. The recombinant microorganism according to claim 7, which is Escherichia coli .
Method of preparing a CRM197 protein comprising the following steps:
(a) culturing the recombinant microorganism of claim 7 to generate CRM197 protein; And
(B) separating the generated CRM197 protein.
10. The method of claim 9, wherein step (b) is characterized in that the separation of the CRM197 protein secreted in the periplasm (periplasm).

Images