JPH03206887A - Production of human pdi - Google Patents

Abstract

PURPOSE:To obtain human PDI in high efficiency by incubating in a medium Bacillus brevis containing a specific DNA. CONSTITUTION:Firstly, Bacillus brevis H 102 strain is extracted and separated to produce (A) a DNA (e.g. plasmid pNU 200) containing, at its 3' end, a region coding signal peptide, and also containing a promoter region. Second, from human placental cDNA library, a cloning is made to produce (B) human protein disulfide isomerase(PDI). Third, a DNA coding the human PDI is bound to the 3' end of the component A to produce (C) plasmid pNU 200-PDI. Fourth, a (D) transformant produced by introducing the component C into Bacillus brevis H 102 strain is incubated in a medium containing glucose, etc., at pH5-9 at 10-42 deg.C for 10-166hr into (E) a cultured product. finally, bacteria produced by centrifugation of the component E is extracted and separated to collect the objective human PDI.

Description

DETAILED DESCRIPTION OF THE INVENTION Field of Industrial Application The present invention relates to human PDI [human protein disulfide isomerase;
This invention relates to recombinant DNA technology for producing sulfide isomerasel. More specifically, human PD
DNA containing Bacillus brevis (Bacillus brevis) containing the DNA
is) transformants and methods for producing human PDI using them.

Conventional technology Human PDI has a molecular weight of approximately 55 and consists of 490 amino acids.
,000 simple proteins. The gene encoding PDI has already been cloned, and the entire base sequence and the entire amino acid sequence deduced from it have been revealed [EP Publication No. 293793 1]. [N, J, Bulleid and R, B,
Freedman.

Nature, Vol. 335. p649 651(1
988)].

Due to rapid advances in genetic engineering technology in recent years, eukaryotic proteins can now be synthesized in large quantities in Escherichia coli, but the recombinant proteins produced in this way often lack the correct disulfide bonds or contain incorrect disulfide bonds. It may have different disulfide bonds [EMBO Journal, 4
, 775 (1985); 1nGenetic Eng.
ineering Vol, 4 (William
mson, R.

ed) p, l 27 (1983)]. Therefore, the utility value of PDI is expected to be applied to the folding of recombinant proteins produced in E. coli and yeast.
Mass production of recombinant human PDI through genetic manipulation is desired.

To date, much of the recombinant DNA research has focused on Escherichia coli (E.
coli), and many heterologous genes have already been expressed in E. coli. However, with this method, the expressed gene product accumulates within the bacterial body;
In the process of obtaining the desired gene product in pure form, not only does it take a great deal of time and effort to extract the desired substance from the bacterial cells and purify it from the extract, but it also takes a lot of time and effort to extract the desired substance from the bacterial cells and purify the extract. It is not easy to obtain it in its pure form.

On the other hand, bacteria of the genus Bacillus have long been used industrially as producing bacteria for various extracellular enzymes, and the DNA regions encoding the promoters and signal peptides of the genes of these extracellular enzymes have been cloned. It is thought that by linking the structural gene of the protein of interest downstream and introducing this into a bacterium of the genus Bacillus, it becomes possible to secrete the protein of interest as a gene product outside the bacterial cell. In Bacillus bacteria, secreted proteins are synthesized as precursors with a signal peptide consisting of approximately 20 to 30 amino acid residues on the amine terminal side, and this portion is then cleaved by signal peptidase to form the mature protein. It is believed that Bacillus amylorichue7enens (Bacillus amylolique)
amyloliquefaciens) α-amylase gene (1, Pa1va et al., Gene, 22
.

229 (1983)), Bacillus licheniformis (
Benicillinase gene of Bacillus licheniformis (S, Chang et al., Mo1
ecular Cloning and Gene
Regulation in Bacilli,
Academic Press, 659 pages, 198
2 years], Bacillus subtilis (Bacillus 5)
α-amylase gene (H, Yam
azaki et al., J. Bacteriol, supra 56
, 327 (1983)) have been cloned, and secretion of heterologous proteins using these signal peptides has been reported.

Bacillus subtilis is mainly used as a host for secretory production of the above-mentioned heterologous proteins, but since this microorganism produces large amounts of extracellular protease, recombinant DNA technology can be used to secrete the protein. The foreign protein that has been used is degraded, and its accumulated amount is significantly reduced.

In contrast, Udaka et al.
We discovered that there are many strains of Bacillus brevis that produce almost no protease, and that one strain of Bacillus brevis 47 (FERM P-7224; JP-A-60-58074, JP-A-62-201583)
The main extracellular protein (H, Yamagat
a et al., J. Bacteriol, 169.

1239 (1987), Norihiro Tsukagoshi 9 Journal of the Japanese Society of Agricultural Chemistry,
61.68 (1987) and Japanese Patent Publication No. 62201583
°' outer wallpro
tein and m1ddle wall
Proteins are described as ``major extracellular proteins'' and ``cell surface proteins.'' Gene promoters and MW proteins (middle wall proteins), which are a type of major extracellular proteins.
A secretion vector was constructed using the region encoding the 1′-amylase [α-amylase] using this strain as a host.
JP-A-62-201583, H, Yamagat
a et al., J.

Bacteriol, ↓69, 1239 (1987)
) and porcine pepsinogen [Juzo Udaka 1 Japanese Society of Agricultural Chemistry, Abstracts of the 1986 Conference, p. 837-838, Norihiro Tsukagoshi 7 Journal of the Japanese Society of Agricultural Chemistry, Rando, 68 (1987)). There is.

In addition, Takagi et al. also investigated Bacillus brevis HP D31, a strain that does not produce Bacillus brevis protease.
This strain is referred to herein as C. plebis H.
It is the same strain as 102 (FERM BP-1087). ), and using this as a host, we have succeeded in producing high secretion of thermostable α-amylase [Proceedings of the 1986 Annual Conference of the Japanese Society of Agricultural Chemistry, p. 27]. In addition, human EGF [human epidermal growth factor; human e
Secretory production of pidermal growth factor has been reported [Japanese Patent Application No. 63-46747,
Proc, NaL], Acad, Sci, 8
[3.

3589 (1989)].

Problems to be Solved by the Invention As mentioned above, various attempts have been made to secrete and produce heterologous proteins using Bacillus bacteria as hosts, and to produce human PDI using Escherichia coli and animal cells as hosts. The object of the present invention is to provide a new method for producing human PDI using Bacillus brevis as a host.

Means for Solving the Problems The present inventors conducted intensive research to provide a method for efficiently producing human PDI, and found that by expressing the human PDI gene using Bacillus brevis H102 as a host. It was found that significant amounts of human PI)I were produced in the culture. Furthermore, by breeding production strains, we found scales that stably express the PDI gene and scales that prevent the decomposition of PDI that is produced and accumulated depending on the culture conditions.Based on these findings, we conducted further research. The present invention has now been completed.

That is, the present invention provides: (1) a DNA encoding human PDI at the 3' end of a DNA containing a promoter region derived from Bacillus brevis;
DNA bound to A.

(2) Bacillus brevis that has DNA in which human PDI-encoding DNA is linked to the 3' end of the DNA containing the promoter region, and (3) the above (2).
This is a method for producing human PDI, which comprises culturing Bacillus brehis described in 1. in a medium, producing and accumulating human PDI in the culture, and collecting the same.

The DNA encoding human PDI may be any DNA as long as it encodes human PDI; for example, a DNA cloned from a human placenta cDNA library based on homology with bovine PDI cDNA may be mentioned; a specific example thereof is is DNA cloned according to the method described in EP Publication No. 293793 etc. (see Figure 3)
can be mentioned.

Any promoter may be used as long as it functions in Bacillus brevis, but promoters derived from Bacillus brevis are preferred, such as promoters of major extracellular protein genes of Bacillus brevis 47 or Bacillus brevis H102. It will be done. One or more types of promoters may be contained.

The DNA containing the promoter region must contain an SD sequence, a translation initiation codon, etc. in addition to the promoter, and may further contain a part of a major extracellular protein gene.

In the present invention, human PDI may be accumulated either inside or outside the bacterial body of Bacillus brevis, but human PDI
In order to facilitate the extraction and purification of I and to increase the production amount, it is desirable to accumulate human PD■ outside the bacterial body.In this case, the DNA containing the promoter region has a 3' The terminal side contains a region encoding a signal peptide.

The signal peptide may be any peptide that secretes and expresses human PDI outside the Bacillus brevis cells, such as the signal peptide of the main extracellular protein of Bacillus brevis 47 or Bacillus brevis H102. Among them, the MW protein of Bacillus brevis 47 (middle wall p
(rotein) signal peptide is preferred.

Any expression vector used for gene expression may be used as long as it functions in Bacillus brevis, such as plasmid pNU200 obtained in Reference Example 2 described below.
[Juzo Udaka 9 Journal of the Japanese Society of Agricultural Chemistry, ■±, 669 (198
7)].

The human PDI expression plasmid prepared using the above DNA may be any plasmid as long as it functions in Bacillus brevis, and specific examples include plasmid pNU200PDI obtained in Example 1 described below.

Methods for constructing these plasmids include, for example, M
o1ecular Cloning, A Lab
oratoryManual, Cold Sprin
g Harbor Laboratory (19
82), etc. On the other hand, as a host for plasmid construction (E.
i), Bacillus subt.
i l is), Bacillus brevis
Microorganisms belonging to the genus E. lusbrevis may vary from l/~, for example, E. coli HBIOI, E. coli DH1,
/<Chill 71,・Zachirus RM 141 [J, Ba
cteriol,, 158.

1054 (1984)], No (Chills Prebis 47 (
FERM P-7224), Nokucilres Previs 447-5 (FERBP-1664, 1F014698
), etc.

The host used for gene expression may be any Bacillus brevis, including Bacillus brevis 47 (FERM P-7224), Bacillus brevis 447-5 (FERBP1664, IF
O14698), Nokuchiresu・Furehisu H10
2 (FERM BP-1087),
Among them, Bacillus brevis H102 is preferred. In addition, /< Bacillus brevis H102 is Bacillus brevis HPD31 (Collection of lecture abstracts of the 1986 conference of the Japanese Society of Agricultural Sciences, p. 27, Shigetama Udaka.

It is the same strain as the Journal of the Japanese Society of Agricultural Chemistry, Migami, 669 (1987)'l.

Method 1 for transforming Bacillus brevis Any known method may be used, for example (fTakahash
The method of I et al. [J, Bacteriol,, l 56
, 1130 (1983)] or Chang and Co.
hen's method [Mo1. Gen, Genet, Month 38. l l 1 (1979)] or the method of Takagi et al. [Japan Society of Agricultural Chemistry 1989 Conference Abstracts p373
1 etc.

The PDI expression ability of transformants obtained in this way may be unstable, and even if transformants carrying a vector carrying an antibiotic resistance gene such as erythromycin are cultured in the presence of the antibiotic, It is very easy to lose the ability to express it. Therefore, in order to stably express PDI, ultraviolet rays are used.

After treating the transformant with a known mutant such as N-methyl-N'-nitroN-nitro'/ri'7nidine and ethyl methanesulfonate, PDI is stably expressed. It is often necessary to obtain mutant strains.

In addition, the obtained stabilized mutant strain was cultured in the absence of antibiotics to obtain a Bacillus brevis mutant strain in which the plasmid had been shed, and the Bacillus brevis mutant strain was obtained using the above-mentioned transformation method again. It is desirable to breed and obtain stabilized transformed strains by transformation.

The medium used for culturing the obtained transformant may be any medium as long as the transformant can grow and produce the desired protein.

Examples of carbon sources contained in the medium include glucose, sucrose, glycerol, and starch.

Dextrin, molasses, urea, organic acids, etc. are used.

Nitrogen sources contained in the medium include casein, polypeptone, meat extract, yeast extract, amino acids such as casamino acids and glycine, organic nitrogen sources such as NZ-amine, and inorganic nitrogen sources such as ammonium sulfate, ammonium chloride, and ammonium nitrate. etc. are used. In addition, inorganic salts such as potassium chloride, potassium phosphate, dipotassium phosphate, sodium chloride, and magnesium sulfate are added to the medium as necessary. Alternatively, the culture may be performed using a synthetic medium containing mainly sugar and an inorganic nitrogen source. When using a strain that exhibits auxotrophy, nutrients necessary for its growth may be added to the medium. Examples of the nutritional substances include amino acids, vitamins, nucleobases, and the like.

Furthermore, if necessary during culture, antibiotics (eg, penicillin, erythromycin, chloramphenicol, bacitracin, D-cycloserine, etc.) are added to the medium. Further, if necessary, an antifoaming agent (eg, soybean oil, lard oil, etc.) may be added to the medium.

Since the concentration of PDI produced and accumulated in the culture solution is significantly influenced by these culture conditions, it is necessary to select optimal conditions to control the amount of PDI produced and accumulated. Moreover, once generated and accumulated in the medium, PDI is surprisingly unstable, fragmenting (low molecular weight) over time, and fragmentation depends on the pH, temperature, and culture time of the medium. Therefore, it is necessary to strictly control these factors.

Furthermore, in order to prevent the decomposition of PDI, it is desirable to use T3 medium as the medium.

The initial pH of the culture medium used in the present invention is 5.0-9.0, more preferably 6.5-7.5.

Culture temperature is usually 10°C to 42°C, preferably 15°C.
C to 37°C1, more preferably 20°C to 30°C, and the culture time is usually 10 to 166 hours, preferably 1
It is 5 to 96 hours, more preferably 15 to 20 hours.

After completion of the culture, the bacterial cells and the supernatant are separated by a method known per se, such as centrifugation or filtration. Hi-1-PDI produced within the bacterial cells can be processed using conventional methods in the art, such as ultrasonic disruption, disruption using a French press, mechanical disruption such as grinding, and disruption using cell wall lytic enzymes. Crush the bacterial cells, and if necessary, add Triton-
It is extracted by adding surfactants such as X100 and deoxycholate. The human PD contained in the culture supernatant or extract thus obtained can be purified using conventional protein purification methods such as salting out, isoelectric precipitation, gel filtration,
Ion exchange chromatography hydroxyapatite, high performance liquid chromatography (H, PLC, FPLC
etc.), and the target human PDI is purified according to
can be obtained.

The activity of human PD■ obtained above can be quantified using the activation of ribonuclease (scrambled ribonuclease), which does not have enzymatic activity due to incorrect disulfide bond formation [
Hillson, D. A. etal, Me.
thods in Enzymolog”/, 10
7 + 281 (+984), Kalnitsky,
G. et al., J. Biol.

Chem, 234, 1512 (1959)].

Effects According to the method for producing human PDI of the present invention, human PDr can be mass-produced more efficiently, and the human PDI gene is stably retained in transformants. Mass-produced human PDI is expected to be used for refolding inactive proteins in which normal disulfide bonds are not formed. It is also thought to be useful in clarifying the metabolic regulation function of the SH/SS exchange reaction and the relationship between protein structure and function.

EXAMPLES The present invention will be explained in more detail by referring to Reference Examples and Examples below, but the present invention should not be limited thereto.

In addition, Bacillus brevis H102 disclosed in Example 1
([3 Books Abstracts of the 1986 Conference of the Agricultural Chemistry Society, p.
27, Shigezo Udaka 1 Journal of the Japanese Society of Agricultural Chemistry.

61.669 (1987)) has been deposited with the Microbial Research Institute (FRI), Agency of Industrial Science and Technology, Ministry of International Trade and Industry under the accession number FERM BP-1087 since June 24, 1986. has been done. Enerichia coli K12 disclosed in Example 1
DH5α/pT3BP-3 is provided by Fermentation Research Institute (
IFO) with accession number IFO14610, and FRI with accession number FERM BP-1841 (FER
Transferred from MP-9386).

On the other hand, Bacillus brevis H102 disclosed in Example I
/pNU200-PDI-10-1 has been deposited with IFO as accession number IFOl 4927 since August 22, 1989.
In addition, since August 28, 1989, FRI has received the accession number FERM.
It has been deposited as BP-2566. In addition, Example 6
Bacillus brevis H102-TI/pNU disclosed in
200-PDI has been deposited with the Fermentation Research Institute (IFO) since August 22, 1989, under the accession number IFO14926.
In addition, since August 28, 1989, FRI has received the accession number FERM.
It has been deposited as BP-2567.

In this specification and drawings, when amino acids and others are indicated by abbreviations, they are IUPAC-IUB
(Commission on Biochem
icalNomenc Nature) or the abbreviations commonly used in the field, examples of which are listed in Table 1. Furthermore, when an amino acid or the like can have optical isomers, the L-isomer is indicated unless otherwise specified.

Table 1 DNA: Deoxyliponucleic acid cDNA: Complementary deoxy 1 novonucleic acid A: Adenine T: Thymine G/Guanine C: Cytosine SDS Sodium nidodecyl sulfate EDTA: Ethylenediaminetetraacetic acid DTT Nidithiothreitol GSH: Reduced glutathione G55G: Oxidized form Glutathione Gly Nigericin Ala: Alanine Val: Valine Leu: Leucine 11e: Inleucine Ser: Serine Thr: Threonine Met: Methionine Glu: Glutamic acid Asp: Aspartic acid Lys: Lysine Arg・: Arginine His: Histidine Phe: Phenylalanine Tyr: Tyr Shin Trp Nitori Butofan Pro Nibroline Asn: Asparagine Gln: Glutamine Reference Example 1 Construction of Plasmid pBR-AN Plasmid pBR322 was used with restriction enzymes BamHI and Nru.
A 3.8 kb DNA fragment was isolated.

In this fragment, 5' AGTGCACTCGCACTTACTGTTG
CTCCCATGGCTTTCGCTGCAG3',
5' GATCCTGCAGCGAAAGCCATGG
GAGCAACAGTAAGTGCGAGTGCACT
Synthetic DNA consisting of 3' is added after phosphorylation, and T4 DNA
The ligase-treated product was introduced into Escherichia coli HBIOI to obtain plasmid pBR-AN.

Reference Example 2 Construction of plasmid pNU200 On the other hand, plasmid pCWP l (7.5 kb) [Yam
Agata et al., J. Bacteriol, 16
9, l 239 (1987), Norihiro Tsukagoshi 2 Journal of the Japanese Society of Agricultural Chemistry, Dan-Sat.

68 (1987), Japanese Unexamined Patent Publication No. 62-201583]
Contains the promoter of the major extracellular protein gene of Bacillus brevis 47 and the region encoding the signal peptide of the MW protein and part of the N-terminal side of the mature protein6.
A 00bp A (2u I fragment was isolated. Next, this fragment was ligated with a BamHl linker using T4 DNA ligase, and then treated with BamHI to obtain a 600bp BamHI fragment.
Got a piece.

However, plasmid pHT-1 (5,6 kb) [JP-A-60
-58074 publication, (cf, FERM P7226
)] was cut with BamHI and BgllI, and the large fragment and the above 600bp BamHI fragment were inserted into T4DN.
Bacillus brevis 47 (FERM P-7224) was transformed using the reaction solution ligated with A ligase. A plasmid was isolated from the erythromycin-resistant transformants and transformed into pNU 100 (4.5 kb).
[Norihiro Tsukagoshi 1 Journal of the Japanese Society of Agricultural Chemistry, 61.68 (1987
)]. Plasmid pNU100 with restriction enzyme E
After partial digestion with coRI, the Klenow fragment (Large Fragment of E, c
oli DNA Polymerase) and closed with T4 DNA ligase.
Secretion vector pNU2 with one oR1 site removed
00 (4,5kb) [Juzo Udaka 3 Journal of the Japanese Society of Agricultural Chemistry, 6
1.669 (1987)] was obtained.

Example 1 Plasmid pT38P-3 containing a DNA fragment encoding human PDI was obtained according to the method described in EP Publication No. 293793 [Plasmid pT38P
-3 retained E, coli K12 DH5α/
p T 3 B P -3 has been given accession number IFO to IFO.
14610 and also with FRI under accession number FE.
Deposited as RM BP-1841 (transferred from FERM P-9386)]. As described later, using pBR-AN obtained in Reference Example ①, D encoding the Bacillus brevis MW protein signal sequence and PDI
Restriction enzymes ApaLI and BamHI are used to connect the 5' end of the NA region and separate it from pBR-AN. Within the DNA region encoding PDI, B
There is no amH1 site, but there is one ApaL1 site. Therefore, during this separation, D
It was predicted that the NA region would be fragmented, which would complicate subsequent operations and reduce the frequency of transformation of Bacillus brevis. Therefore, the ApaL1 site in the DNA region encoding PDI was deleted without changing the amino acid as follows.

That is, Ap to be deleted from pT 3 B P -3
DNA fragment containing the aL1 site, (Pst I-Bam
H11, 3kbp fragment) was isolated and this was transformed into M13mp1.
9 multiple cloning sites, 01
igonucLeotide-directed i
n vitr.

The ApaLI site was deleted using the Mutagenesis System (manufactured by AmaJam) without changing the amino acid sequence when it was translated.

On the other hand, Bacillus brevis MW protein signal sequence C
Synthesize a DNA sequence that connects the DNA sequence downstream from the Nco1 site near the end and the Ava■ site 4 bp downstream from the Ala-encoding site, which is presumed to be the amino terminus in the PDI structural gene.See Figure 1. ), this and p
0,85kbp Ava I of T38P-3
After ligating the fragments with T4 ligase, 1'sLI and Nc
A 0.37 kbp NcoIPstl fragment was obtained. This is a form in which the C-terminal part of the MW protein signal sequence and the DNA encoding the N-terminal part of human PDI are directly linked.

This fragment and Pstl-B with the ApaLI site deleted
amHI 1.3kbp fragment and Nc of pBR-AN
ol-BamHI 3.8 kbp fragment was ligated with T4 ligase, and E. coli HB I Ol was transformed to isolate plasmid pBR-AN-PDI.

The 1.7kbp ApaLI-Ba of this plasmid
mHI fragment and 4.3kbp Apa of pNU200
The LI-BamHI fragments were ligated with T4 ligase,
pNU200-PDI was obtained.

Human PDI expression plasmid pNU200 obtained above
- Using PDI, the method of Takagi et al. [Japan Society of Agricultural Chemistry 19]
Collection of abstracts from the 1989 conference, p273.

Journal of the Japanese Society of Agricultural Chemistry 63,693 (1989 Bacillus brevis H102 (FERM BP1087:
Japanese Society of Agricultural Chemistry 1985 Conference Abstracts, p27,
Shigezo Udaka, Journal of the Japanese Society of Agricultural Chemistry 61.669 (1987)
The same strain as Bacillus brevis HPD31 described in 1.
Brevis H102/pNU200-PD I-10 was obtained.

Example 2 Bacillus brevis Hl 02/pNIJ200PDI
-10 was inoculated into the T2 medium of 5- and cultured with shaking overnight at 37°C. The culture solution was inoculated at 1% into the same medium as above and cultured in the same manner as above. This operation was performed to add PDI to the culture supernatant.
This was repeated until it could no longer be confirmed by Western blotting. The culture fluid in which PDI production was no longer observed was diluted, applied to a T2 agar medium, and cultured at 37°C for 1 day to form colonies. A nitrocellulose membrane was placed on the agar medium to transfer the proteins present around the colonies, and the cells were reacted with anti-human PDI rabbit serum to develop color, and strains producing PDI were isolated. Among these strains, a strain that produced PDI with good reproducibility was selected and named Bacillus brevis H102/pNU200-1o-1.

Example 3 Culture of transformant and production of human PDI Transformant Bacillus brevis H102/pNU obtained in Example 2
200-PDI-10-1 and its control Bacillus brevis HIO2 with 1% polypeptone and 0 meat extract.
．． 5%, yeast extract 0.2%, glucose 1% (pH 7
) in a medium (T2 medium) at 37°C for 124 hours with shaking.

The above culture solution was centrifuged, and the supernatant was collected using 5DS.
-Perform polyacrylamide gel electrophoresis and perform anti-human P
Antigenic bands were detected by Western blotting using DI rabbit serum. Figure 2 shows the results. In FIG. 2, lane 1 shows a standard protein (Coomassie brilliant blue staining), and lane 2 shows a 5DS-polyacrylamide gel electropherogram of the culture supernatant of Bacillus brevis HIO2/pNU200-PDI-10-1. The amount of PDI produced is approximately 10 mg per culture supernatant IQ.
It was calculated that

Example 4 PDI expression Stabilized strain The transformant obtained in Example 1 has unstable expression of PD and I, and cannot be cultured in large quantities as it is, so a stabilized strain was bred. .

Bacillus brevis Hl 02/pNU200PDI-
4 and Bacillus brevis H102/pNU200-
PDI-1o was treated with mutagen, N-methyl-N
The cells were treated with '-N-N-N-T-L-N-T-L-L-L-L-L-L-L-N-L-L-L-L-N-L, and subcultured in liquid culture to screen for strains that did not lack the PDI expression trait using the colony immunoassay method and the Western blotting method.

Since the stabilized strain may contain mutations in the PDI structural gene, the plasmid was erased by repeated culturing in a medium without selective pressure, and the strain was transformed again using plasmid pNU200-PDI. Bacillus brevis HIO2-Tl/pNU200-PDI was obtained.

Example 5 Setting culture conditions that cause less degradation of PDI Bacillus brevis H102 was grown under the conditions used in Example 3.
/pNU200-PDI-1o-1, the decomposition of PDI produced and accumulated in the medium was significant;
We investigated various culture conditions that would reduce the amount of decomposition. As a result of various studies by changing the three elements of medium composition, culture temperature, and culture time, we found that polypeptone 2%, Jffi extract 0.4%, and meat extract 0.5%.

Glucose 1%, MgC0,2・6Hz0 0.1% (
Using a medium (T3 medium) consisting of pH 7.0,
It was found that the conditions of culturing at ℃ for 16 hours were optimal. Figure 4 shows 5DS-polyacrylamide gel electrophoresis images of the upper groove (lane 1) cultured under the conditions of Example 3 and the upper groove (lane 2) cultured under the conditions set in this example where PDI is less degraded. (Western blotting method).

Example 6 PDI expression Purification of human PDI before expression stabilization PDI expression stabilized strain Bacillus brevis H10 obtained in Example 4
Ammonium sulfate fraction (
After collecting the fraction with 55% saturation or higher, Phenyl-S
epharose CL-4B column chromatography (manufactured by Pharmacia), DEAE-To
yopearl 650 M column chromatography (manufactured by Tosoh Corporation), T S Kgel G 30oo
PDI was purified by the HPLC method using swc (manufactured by Freezetsu Co., Ltd.). The purified sample showed a single band in 5DS-polyacrylamide gel electrophoresis and a single peak in gel filtration chromatography (Figure 5). The molecular weight of the obtained sample was calculated to be 57° CIQCI under both reducing and non-reducing conditions by 5DS-polyacrylamide gel electrophoresis. Further, in gel filtration chromatography, it was calculated to be 122,000.

Example 7 Properties of human PDr The properties of human 1-PDI obtained in Example 6 are shown below.

(1) Isoelectric point The isoelectric point of H) PDI determined by isoelectric focusing gel electrophoresis was 5.0.

(2) Optimal reaction temperature The optimal temperature for the scrambled ribonuclease folding reaction in the presence of pH 7, 5, and 3 μM DTT was 20°C.

(3) Optimal pH of the reaction The optimal pH of the scrambled ribonuclease 7-oldering reaction at 20°C and in the presence of 23 μM DTT was 7.5.

(4) Optimal DTT concentration for reaction The optimal concentration of DTT in the scrambled ribonuclease glue folding reaction at 20°O and pH 7.5 was 3 μM.

(5) Optimal Glutathione Concentration for Reaction The optimal concentration of glutathione for the scrambled ribonuclease glue folding reaction at 20°C and pH 7.5 is GSH: 0.6 mM.

G55G: 0.06mM (mixture) ivy.

(6) Protein Chemistry Using approximately 1 nmol of human PDI I obtained in Example 6, its amine-terminal amino acid sequence was analyzed using a gas phase protein sequencer (manufactured by Applied Biosystems). It was revealed that the N-terminal signal sequence was cleaved at the location expected from the cDNA (Table 2).

In addition, the amino acid composition analysis of this human PDI was performed using Pico
-TAGo amino acid analysis acid analyzer (manufactured by TARS Inc.). The composition value almost coincided with the composition value predicted from the cDNA sequence (Table 3).

(Margin below) Table 2 No. 3 tables Glu/Gin er ly is rg hr 1a Pr.

yr a1 et -Cys 1e eu he rp ■3.9 4.6 5.3 1.8 2.6 5.0 9.0 4.5 2.8 6.4 0.6 1.1 4.7 9 .4 6.9 1.3 Example 8 Folding activity of scrambled ribonuclease using human PDI was measured using the PDI purified preparation obtained in Example 6 (Fig. 6). ).

(1) Materials - Scrambled ribonuclease (SRNase) is H
Methods in E.
nzymology 107.281-294 (1984
)) using orchid pancreatic ribonuclease A.

(2) Method In 100mM sodium phosphate buffer (pH 7.5) containing 10mM ED'TA, scrambled ribonuclease (50μg/-) was mixed with PDI (8.8μg/ml).
;△), DTT (3μM:・), glutathione (GSH
0.6mM, G55G 0.06mM; ■), PDI
(8,8μg/-) and DTT (3μM) (○), or PDI (8,8μg/ml) and glutathione (GSH0
, 6mM, G55G O, 06mMX) and 20
It was heated at °C for 15 minutes, 30 minutes, 1 hour, and 2 hours, respectively. The total amount of reaction solution was adjusted to 200 μα. After warming, add 800μ of 0.2M sodium acetate buffer.
The reaction was stopped by adding Q.

The RNase activity in this reaction solution was determined by the method of Alnisk Y et al. (J, Biol, Chem, 234.1512).
1516 (1959)).

That is, 200 μQ of the above reaction solution was placed in a centrifuge tube and preheated at 37° C. for 5 minutes. Yeast RNA was added to 0.1M sodium acetate buffer (pH 5.0) to a concentration of 1%.
) was also prewarmed at 37°C for 5 minutes.

After prewarming, add 200 μQ of substrate solution to the reaction solution and incubate for 3
After reacting at 7°C for 4 minutes, 200 μQ of a 25% perchloric acid solution containing 0.75% uranium acetate was added.

After addition, cool the centrifuge tube on ice for 5 minutes and spin at 16,000 rpm.
After centrifugation for 5 minutes at m, the supernatant was diluted 3 times with distilled water, and the absorbance at a wavelength of 260 nm was measured.

(3) Results Compared to the conditions in which PDI, DT, T, and glutathione were each added alone, the scrambled ribonuclease 7-olding progressed more efficiently under the conditions in which PDI and DTT or PDI and glutathione were added.

[Brief explanation of drawings]

FIG. 1 shows a construction diagram of the human 1-PDI expression plasmid pNU200-PDI obtained in Example I. FIG. 2 shows the results of 5DS-polyacrylamide gel electrophoresis obtained in Example 3. FIG. 3 shows the cDNA base sequence of human PDI cloned into pT 38 P-3 obtained in Example 1 and the amino acid sequence deduced from that sequence. FIG. 4 shows the results of 5DS-polyacrylamide gel electrophoresis obtained in Example 5. Figure @5 shows the gel filtration chromatography pattern of human PDI obtained in Example 6. FIG. 6 shows the time course of activation of scrambled ribonuclease by PDI (see Example 8). Rei Te 1 97.400 □ 66.200 □ 42.700□- 31,000/ ゝN1

Claims (3)

[Claims] (1) DNA encoding human PDI at the 3' end of DNA containing the promoter region derived from Bacillus brevis
DNA bound to A. (2) Bacillus brevis harboring DNA in which human PDI-encoding DNA is linked to the 3' end of the DNA containing the promoter region. (3) A method for producing human PDI, which comprises culturing Bacillus brevis according to claim 2 in a medium, producing and accumulating human PDI in the culture, and collecting the human PDI.