KR102114271B1 - Pharmaceutical composition for anti-inflammatory Ethanol Extract of Antirrhinum majus as an active ingradient - Google Patents

Abstract

The present invention relates to an anti-inflammatory pharmaceutical composition comprising a snapdragon extract as an active ingredient, and an anti-inflammatory pharmaceutical composition comprising a snapdragon extract according to the present invention as an active ingredient inhibits the production of NO, an inflammatory reaction mediator. In addition, it suppresses the expression of iNOS and COX-2 involved in its synthesis, and has an effect of inhibiting inflammatory cytokines such as TNF-α, IL-6, IL-1β, and MCP-1. It can be used in products such as health functional foods and cosmetic compositions related to improvement.

Description

{Pharmaceutical composition for anti-inflammatory Ethanol Extract of Antirrhinum majus as an active ingradient}

The present invention relates to a pharmaceutical composition for anti-inflammatory comprising a snapdragon extract as an active ingredient.

Inflammation reactions are caused by physical trauma, damage from external physical and chemical stimuli such as harmful chemicals, infection by microorganisms such as bacteria and viruses, or damage caused by stimulating substances in metabolites in vivo. It is a reaction that recognizes this and protects the body by secreting various inflammatory mediators. These inflammatory reactions are triggered by various chemical mediators produced from damaged tissues and migrating cells, and these chemical mediators are known to vary according to the type of inflammatory process. In normal cases, the living body restores normal structure and function by neutralizing or removing the onset factors through the inflammatory reaction and regenerating the upper tissue, but when the inflammatory response is excessively or inappropriately persisted, the inflammatory mediator is secreted more than necessary It has been reported to cause various adult diseases such as obesity, diabetes, edema, and high blood pressure. In addition, when inflammation is improperly triggered by an innocuous substance such as pollen, or an autoimmune reaction such as asthma or rheumatoid arthritis, the defense reaction itself damages tissue rather, so anti-inflammatory is required. Inflammatory responses can be observed in almost all clinical diseases, and among these inflammatory diseases, there are some bacterial diseases that can be causally treated by administration of antibiotics, but most of them do not have specific treatments because their outbreaks are due to tissue damage caused by autoimmune reactions. It is known as incurable disease.

Inflammatory reactions involve biochemical phenomena caused by various cells and substances, among which macrophages are cells with various functions distributed in all tissues, as well as having defense against pathogens and cancer cells, as well as various stimuli and immunity It is activated by cytokines secreted by cells, and various pro-inflammatory cytokines such as nitrogen oxide (NO), tumor necrosis factor (TNF-α), interleukin-1β, and IL-6 (pro) -Inflammatory cytokine) and physiologically active substances are secreted, causing an immune response. Nitric oxide (NO) is produced from L-arginine by three major nitrogen oxide synthase (NOS) isomers: neuronal NOS (nNOS), endothelial NOS (eNOS), and inducible NOS (iNOS). nNOS and eNOS are however regulated by Ca ^{2 +} / calmodulin (calmodulin), iNOS is IL (interleukin), IFN (interferon), or LPS (lipopolysaccharide; lipopolysaccharide) is regulated at the transcriptional level by inflammatory stimuli such as. NO, which is produced in small amounts by nNOS or eNOS, is responsible for normal physiological functions such as vasodilation, neurotransmission, or induction of apoptosis to tumor cells, but NO, which is excessively produced by iNOS in macrophages, is associated with inflammation and cancer. It is involved in a variety of pathophysiological processes, including reacting with superoxide to form peroxynitrite, which acts as a powerful oxidant, damaging cells, and NF-κB in macrophages activated by inflammatory stimuli. It is known to be involved in chronic diseases such as inflammatory reaction, cancer, and arteriosclerosis by activating.

Prostaglandin (prostaglandin) is an unsaturated fatty acid derivative containing 20 carbons having a cyclic structure. It is a chemical transporter mainly involved in chronic inflammatory diseases and is also involved in autoimmune diseases such as asthma. Prostaglandins are biosynthesized by an enzyme called cyclooxygenase (COX), which has two isomers, COX-1 and COX-2, which are present in tissues such as the stomach and kidneys. While enzymes are involved in maintaining normal homeostasis, COX-2 is transiently and rapidly expressed in cells by cytokines or cytokines during inflammation or other immune responses.

In the inflammatory process in the body, excessive NO and inflammatory factors such as PGE2 (prostaglandin E2) are formed by inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2). It is known that NO generated excessively by iNOS in an inflammatory state not only promotes an inflammatory reaction, but also promotes biosynthesis of an inflammatory mediator, thereby exacerbating inflammation. That is, the expression of iNOS and COX-2, and the production of NO and PGE2 are representative inflammatory responses of immune cells and are known to inhibit the inflammatory response by inhibiting these factors.

The most common anti-inflammatory agents for treating inflammatory diseases by suppressing these inflammatory reactions are largely divided into steroidal and non-steroidal anti-inflammatory drugs, and most of these synthetic anti-inflammatory drugs have many side effects in addition to their main function, so they are excellent. The development of anti-inflammatory drugs with few side effects is urgently required. In particular, in terms of efficacy and side effects, the natural product formulation, which has been used in folk remedies for a long time and has excellent clinical experience and excellent evaluation in terms of safety, is considered to be a good candidate for the prevention and treatment of inflammatory diseases. .

Snapdragon ( Antirrhinum majus ) is a perennial plant belonging to the genus Scrophulariaceae. It is native to Africa and southern Europe, and has a flower shape that looks like the mouth of a goldfish and is named snapdragon. In Europe, it is called snapdragon. Snapdragon is commonly used for ornamental purposes, but seeds, leaves, and flowers are also used as medicines, and it is known that anthocyanins, linoleic acid, and oleic acid are abundant. Regarding the use of snapdragon, as can be seen in the case where the US Patent Publication No. US2012-0156718 discloses that it is possible to introduce a snapdragon promoter into a culture medium for producing biosynthetic products, the patent using snapdragon as a main material is very This is a limited situation.

Thus, the present inventors completed the present invention by confirming the anti-inflammatory effect of the snapdragon extract while exploring natural materials with high anti-inflammatory efficacy.

An object of the present invention is to provide an anti-inflammatory pharmaceutical composition comprising a snapdragon extract as an active ingredient.

In order to achieve the above object, the present invention provides an anti-inflammatory pharmaceutical composition comprising a snapdragon extract as an active ingredient.

In addition, the present invention provides a health functional food for improving inflammation, including snapdragon extract as an active ingredient.

The anti-inflammatory pharmaceutical composition comprising the snapdragon extract according to the present invention as an active ingredient inhibits the production of NO, an inflammatory reaction mediator, inhibits iNOS and COX-2 expression involved in its synthesis, and inhibits TNF-α, Since it has an effect of inhibiting inflammatory cytokines such as IL-6, IL-1β, and MCP-1, it can also be used in products such as health functional foods and cosmetic compositions related to inflammation improvement requiring anti-inflammatory activity.

1 is a result showing the cytotoxicity of snapdragon ethanol extract.
Figure 2 is a result of comparing the amount of nitric oxide production of hot water extract and ethanol extract of snapdragon.
Figure 3 is a result showing the inhibitory effect of iNOS, COX-2 expression of snapdragon ethanol extract on the cells induced inflammatory response. (A: protein, B: mRNA)
Figure 4 is a result showing the inhibitory effect of TNF-α, IL-6, IL-1β, MCP-1 expression of snapdragon ethanol extract on the cells induced inflammatory response. (A: protein, B: mRNA)
5 is a result showing the DPPF, ABTS radical scavenging ability of snapdragon ethanol extract.

Hereinafter, the present invention will be described in detail.

The present invention provides an anti-inflammatory pharmaceutical composition comprising a snapdragon extract as an active ingredient.

The snapdragon extract can be prepared by a manufacturing method comprising the following steps:

1) preparing an extract by adding an extraction solvent to snapdragon;

2) filtering the extract of step 1); And

3) Concentrating the filtered filtrate of step 2) under reduced pressure and drying.

The snapdragon extract may be prepared by extraction with water, a lower alcohol of C ₁ to C ₄ or a mixed solvent thereof, but is not limited thereto.

The snapdragon extract is prepared by extraction with water, C1 to C4 lower alcohol or a mixed solvent thereof, but is not limited thereto. The extraction solvent is preferably a lower alcohol having 1 to 4 carbon atoms, and the lower alcohol is more preferably selected from methanol or ethanol. In one embodiment of the present invention, the extraction solvent may be 30% to 99% ethanol. The extraction solvent may be added in an amount of 1 to 50 ml per 1 g of weight of snapdragon used for extraction.

The extraction method may be immersion, shaking extraction, Soxhlet extraction or reflux extraction. At this time, the extraction time may be 10 to 96 hours, 15 to 72 hours. The extraction may be repeated 1 to 5 times.

On the other hand, the reduced pressure concentration of step 3) may use a vacuum decompressor or a vacuum rotary evaporator. In addition, the drying may be vacuum drying, vacuum drying, boiling drying, spray drying or freeze drying, and specifically, freeze drying.

In addition, the extract of the present invention includes not only the extract by the above-described extraction solvent, but also extracts obtained through other conventional extraction methods, extracts obtained through purification and fermentation processes. Decompression by carbon dioxide, extraction by supercritical extraction method by high temperature, extraction by ultrasonic extraction method, separation by ultrafiltration membrane having a constant molecular weight cut-off value, separation by various chromatography or natural or various microorganisms Active fractions obtained through various purification and extraction methods, such as extracts by fermentation products used, are also included in the extracts of the present invention.

The snapdragon may be any one or more selected from the group consisting of seeds, leaves, flowers, stems and roots, but is not limited thereto.

The snapdragon extract is to inhibit the production of NO (nitric oxide).

The snapdragon extract is to inhibit the expression of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), tumor necrosis factor (TNF-α), interleukin (IL) -1β and IL-6.

The anti-inflammatory pharmaceutical composition comprising the snapdragon ethanol extract of the present invention as an active ingredient contains 0.1 to 99.9% by weight of the extract of the present invention as an active ingredient relative to the total weight of the composition for administration, and a pharmaceutically acceptable carrier. , Excipients or diluents. Pharmaceutically acceptable carriers can be used by mixing one or more of these components: saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and antioxidants, buffers, if necessary. Other conventional additives such as bacteriostatic agents can be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into main-use formulations such as aqueous solutions, suspensions, emulsions, powders, tablets, capsules, pills, granules or injections. Furthermore, it can be preferably formulated according to each disease or ingredient by using methods appropriate in the art or using methods disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 19th, 1990).

The anti-inflammatory pharmaceutical composition comprising the snapdragon ethanol extract of the present invention as an active ingredient may be formulated into tablets, capsules, powders, granules, suspensions, emulsions, syrups, other liquids by conventional methods. Specifically, the composition of the present invention can be administered orally or parenterally, and the dosage form for oral administration is a tablet, orally, troche, lozenge, water-soluble or dominant suspension, preparation powder or granule, emulsion, hard or It can be formulated as a soft capsule, syrup, or elixir. Binders such as lactose, saccharose, sorbitol, mannitol, erythritol, starch, amylopectin, cellulose or gelatin, excipients such as dicalcium phosphate, disintegrants such as corn starch or sweet potato starch, stearic acid for formulation into tablets and capsules. Lubricants such as magnesium, calcium stearate, sodium stearyl fumarate, or polyethylene glycol waxes may be contained. In the case of capsule formulations, in addition to the substances mentioned above, it may contain a liquid carrier such as fatty oil. Acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, Talc, magnesium stearate and mineral oil may be added, but is not limited thereto.

In addition, the pharmaceutical composition for anti-inflammatory containing the snapdragon ethanol extract of the present invention as an active ingredient can be administered orally or parenterally, and when administered parenterally, subcutaneous injection, intravenous injection, intramuscular injection or intraperitoneal injection is selected. It is desirable to do. In order to formulate a formulation for parenteral administration, the composition of the present invention is mixed with water to prepare a suspension, which is formulated as a unit dosage form of an ampoule or vial.

The anti-inflammatory pharmaceutical composition comprising the snapdragon ethanol extract of the present invention as an active ingredient is administered in a pharmaceutically effective amount. In the present invention, "a pharmaceutically effective amount" means an amount sufficient to treat the disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level is the type of patient disease, severity, activity of the drug, Sensitivity to the drug, time of administration, route of administration and rate of excretion, duration of treatment, factors including co-drugs and other factors well known in the medical arts may be determined. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with a conventional therapeutic agent, and may be administered single or multiple. Considering all of the above factors, it is important to administer an amount that can achieve the maximum effect in a minimal amount without side effects, which can be easily determined by those skilled in the art.

The dosage of the active ingredient according to the present invention considers safety and efficiency when used in the human body, and it is also possible to estimate the amount used in humans from the effective amount determined through animal experiments. Such considerations to be taken into account when determining an effective amount include, for example, Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; And E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co. For oral dosages, the composition of the present invention is generally administered in an amount of 0.0001 to 500 mg per kg of body weight per day per adult. It can be administered in divided amounts of 1 to several times, preferably in an amount of 0.001 to 100 mg, more preferably 30 to 500 mg / kg. However, since the administration route, arthritis disease severity, sex, weight, age, etc. may increase or decrease, the above dosage does not limit the scope of the present invention in any way.

The composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormonal therapy, chemotherapy and biological response modifiers.

The compositions of the present invention may also include carriers, diluents, excipients, or combinations of two or more of those commonly used in biological agents. The pharmaceutically acceptable carrier is not particularly limited as long as it is suitable for in vivo delivery of the composition, for example, Merck Index, 13th ed., Merck & Co. Compounds described in Inc., saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol and one or more of these components can be used in combination, and if necessary, antioxidants, buffers, bacteriostatic agents, etc. Other conventional additives can be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into main-use formulations such as aqueous solutions, suspensions, emulsions, pills, capsules, granules, or tablets. Furthermore, it can be preferably formulated according to each disease or component using methods appropriate in the art or using methods disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).

The composition of the present invention may further contain one or more active ingredients exhibiting the same or similar functions. The composition of the present invention may contain 0.0001 to 10% by weight of the compound relative to the total weight of the composition, preferably 0.001 to 1% by weight.

In a specific embodiment of the present invention, the snapdragon extract does not exhibit cytotoxicity under a certain concentration (FIG. 1), inhibits the production of NO, an inflammatory mediator (FIG. 2), and iNOS and COX-2 involved in its synthesis It suppresses expression (Fig. 3), and has an effect of suppressing inflammatory cytokines such as TNF-α, IL-6, IL-1β, and MCP-1 (Fig. 4). It can be utilized as a pharmaceutical composition for anti-inflammatory. Confirmed.

In addition, the present invention provides a health functional food for improving inflammation, including snapdragon extract as an active ingredient.

The health functional food for improving inflammation comprising the snapdragon extract of the present invention as an active ingredient may further contain one or more active ingredients showing the same or similar function. For administration, an additional food-acceptable carrier may be included.

Health functional food for improving inflammation comprising the snapdragon extract of the present invention as an active ingredient is preferably any one selected from drinks, pills, tablets, capsules, powders, but is not limited thereto. The health functional food composition of the present invention may be added as it is or may be prepared together with other foods or food ingredients, and may be appropriately prepared according to conventional methods. Examples of foods to which the health functional food composition of the present invention can be added are caramel, meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups , Beverage, tea, drink, alcoholic beverages and vitamin complexes, and may be in any one form, and include all of the health foods in the ordinary sense.

The foods include various nutrients, vitamins, minerals (electrolytes), synthetic and natural flavors, colorants and enhancers (cheese, chocolate, etc.), pectic acid and salts thereof, alkylic acid and salts thereof, organic acids, protective colloidal thickeners, pH It may contain a modifier, stabilizer, preservative, glycerin, alcohol, carbonic acid used in carbonated beverages, and the like. It may also contain flesh for the manufacture of natural fruit juices and vegetable drinks.

The above components can be used independently or in combination. The proportion of these additives is not critical, but is generally selected from 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention. In addition, the health functional food composition of the present invention may contain various flavors or natural carbohydrates as additional ingredients, and the natural carbohydrates include monosaccharides such as glucose and fructose, disaccharides such as maltose, sucrose, and dextrin, And polysaccharides such as cyclodextrin, xylitol, sorbitol, and erythritol. As the sweetener, natural sweeteners such as taumatin and stevia extract, and synthetic sweeteners such as saccharin and aspartame can be used. The proportion of the natural carbohydrate is generally about 0.01 to 0.04 g per 100 ml of the composition of the present invention, preferably about 0.02 to 0.03 g.

In a specific embodiment of the present invention, the snapdragon extract does not show cytotoxicity under a certain concentration (FIG. 1), NO (FIG. 2), iNOS and COX-2 (FIG. 3) and TNF-α, IL-6, IL-1β And inhibitors and cytokines involved in inflammatory reactions such as MCP-1 (FIG. 4). In addition, it contains a bioactive substance, polyphenol (Table 1), and has antioxidant activity (FIG. 5), which confirms that it can be used for health functional foods for improving inflammation.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples and experimental examples are only for illustrating the present invention, and the present invention is not limited by the following examples and experimental examples.

< Example  1> Preparation of snapdragon extract

Snapdragon hot water extract was obtained by mixing 100 g of freeze-dried snapdragon flowers in 3000 ml of distilled water, mixing well, and heating at 90 ° C. for 3 hours. In addition, the ethanol extract of snapdragon was added to 6 g of freeze-dried snapdragon flower with 95% ethanol 6L, crushed with a homogenizer, and immersed at room temperature for 24 hours to extract. Each extract was filtered using filter paper (NO. 2, Whatman), and then concentrated under reduced pressure at 37 ° C using a rotary vacuum evaporator. The concentrated snapdragon extract was stored at -70 ° C for 24 hours, lyophilized for one week, and then frozen at -20 ° C.

< Experimental Example  1> Comparison of cytotoxicity by concentration of snapdragon extract

In order to confirm the cytotoxicity of the snapdragon extract, cell viability was measured by MTT (Thiazolyl blue tetrazolium bromide) method.

In the MTT assay, MTT tetrazolium is MTT formazan [3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyl-tetrazoliumbromide] by dehydrogenase action in the mitochondria of living cells. As a test method for measuring the degree of reduction, RAW 264.7 macrophages were used in this example. Specifically, treated with snapdragon extracts at concentrations of 50, 100, 150, 300, and 500 μg / mL in RAW 264.7 cells (HUVEC) having a cell density of 80% or more, and 200 μg / ml MTT (Sigma-Aldrich Co.) , 10% FCS (calf serum; GE Healthcare Bio-Sciences Co.) and 100 unit / ml of penicillin (penicillin)-Streptomycin (streptommycin) containing incubated for an additional hour for 1 hour. After the reaction is complete, the medium is completely removed, and 300 μl of DMSO is added to dissolve the resulting purple formazan, and then 100 μl of the dissolved formazan is placed in a 96-well plate to add a microplate reader. (Molecular Devices) was used to measure the absorbance at 595 nm. The cell viability was calculated (% of Control) using the absorbance of untreated RAW 264.7 cells as a control and the cytotoxicity of the snapdragon extract was evaluated.

As a result, up to a concentration of 300 µg / mL or less showed a survival rate of 90% or more, and thus no toxicity to the cells was observed. In general, it was confirmed that the concentration of the extract was 300 μg / mL or less in that the concentration of the sample having a cell viability of 90% or more was considered as a non-toxic safety concentration compared to the control group (FIG. 1).

< Experimental Example  2> Comparison of anti-inflammatory effect of snapdragon extract according to extraction solvent

In order to investigate the anti-inflammatory effect of snapdragon extract according to the extraction solvent, nitrogen oxide (NO) production was measured in RAW 264.7 cells activated by LPS.

RAW264.7 cells were stimulated by pre-treatment with LPS (10 μg / mL) for 24 hours, and snapdragon hot water extract or snapdragon ethanol extract was applied to RAW264.7 cells at concentrations of 50, 100, 150 and 300 μg / mL for 1 hour, respectively. After treatment, the medium was recovered through centrifugation (2,000 g, 4 ° C, 10 minutes). The extract-treated group was compared with the control group without any treatment and the inflammation-inducing group that induced inflammation with LPS without treating the snapdragon extract. The concentration of NO was measured by absorbing the medium (100 μl) and Griess reagent (0.1% naphthylethylene diamine dihydrochloride + 1% sulfanilamide + 5% phosphoric acid) in the same amount with a microplate reader at a wavelength of 540 nm. .

As a result, it was confirmed that the ethanol extract significantly reduced the amount of NO produced than the hot water extract treatment at all concentrations (FIG. 2).

< Experimental Example  3> Molecular mechanism of anti-inflammatory effect of snapdragon extract

RT-qPCR (quantitative real time polymerase chain reaction) to confirm that it inhibits the mRNA expression and protein expression of iNOS and COX-2, which are involved in the synthesis of NO, with regard to inhibition of NO production by snapdragon extract. Reaction) and western blot.

Experimental Example  3-1. Of snapdragon extract iNOS  And COS-2 protein inhibitory effect

As described in Experimental Example 2, after treating the snapdragon ethanol extract to Raw 264.7 cells by concentration, LPS (10 ng / mL) was treated and cultured for 24 hours. Expression of iNOS and COX-2 was observed. Specifically, after dispensing Raw 264.7 macrophages into 6 well plates so as to be 2 × 10 ⁵ cells / well, and incubating for 24 hours, extracts of snapdragon at 50, 100, 150, and 300 μg / mL concentrations Pre-treatment for 4 hours, and incubated for an additional 24 hours by treatment with LPS (10 ng / mL). Cells were obtained by centrifugation (500 xg, 5 minutes), lysis buffer (R4100-010, Gendepot) was added to the pellet, incubated on ice for 30 minutes, and after 60 seconds of sonication, 6000 The supernatant containing protein was collected by centrifugation at xg rpm for 10 minutes. After quantifying the protein of the collected supernatant, electrophoresis is performed on a 12% SDS poly-acylamide gel, and the separated protein is transferred to a PVDF membrane and then 5% skim milk in TBST for 2 hours. Blocking was done. Primary antibodies are iNOS (1: 3000, sc7271, Santa-cruz), COX-2 (1: 5000, ab15191, abcam), IL-1β (1: 3000, ab9722, abcam), TNF-α (1: 3000 , ab9739, abcam), and GAPDH (1: 3000, ab9485, abcam) were diluted in TBST (tris-buffered saline Tween-20) according to the ratio of each antibody, and then overnight at 4 ° C and washed 3 times with TBST for 10 minutes 2 The primary antibody was diluted at a ratio of 1: 5,000 and attached at room temperature for 2 hours. After washing three times with TBST for 10 minutes, the ECL solution was treated and measured with Chemi-DOC (Bio-rad).

As a result, in the group treated with LPS in RAW 264.7 cells, expression of iNOS and COX-2 was significantly increased compared to the control group without LPS. When treated with snapdragon extract, iNOS and COX-2 protein expression showed a concentration-dependent inhibition of snapdragon extract (FIG. 3A).

Experimental Example  3-2. Of snapdragon extract iNOS  And COS-2 mRNA  Inhibitory effect

Cells were obtained in the same manner as in Experimental Example 3-1, and RNA was isolated using a NucleoSpin® RNA Plus kit (Macherey-Nagel). After synthesis of 1 μg of total RNA into cDNA using High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific Inc.), 1 μl of synthesized cDNA, 1 μl of primer, 10 μl of SYBR master mix , RNA lyase removal Real-time PCR was performed with 8 μl of RNAase-free water. RPS was used as a control for comparing mRNA expression levels, and information on gene-specific primers to be analyzed is shown in Table 1 below.

Gene to be analyzed Primer sequence Sequence number iNOS Forward AATCTTGGAGCGAGTTGTGG One Reverse CAGGAAGTAGGTGAGGGCTTG 2 COX-2 Forward ACTCACTCAGTTTGTTGAGTCATT 3 Reverse TTTGATTAGTACTGTAGGGTTAATG 4 TNF-α Forward GCCACCACGCTCTTCTGCCT 5 Reverse GGCTGATGGTGTGGGTGAGG 6 MCP-1 Forward TCTGGACCCATTCCTTCTTG 7 Reverse AGGTCCCTGTCATGCTTCTG 8 IL-6 Forward CCAGAGATACAAAGAAATGATGG 9 Reverse ACTCCAGAAGACCAGAGGAAAT 10 IL-1β Forward AAATACCTGTGGCCTTGGGC 11 Reverse CTTGGGATCCACACTCTCCAG 12 RPS Forward ATCAGAGAGTTGACCGCAGTTG 13 Reverse AATGAACCGAAGCACACCATAG 14

As a result, in the group treated with LPS, the expression of iNOS and COX-2 was significantly increased compared to the control group, and the mRNA expression of iNOS and COX-2 was suppressed in a concentration-dependent manner in the snapdragon extract (FIG. 3B).

Experimental Example  3-3. Cytokine Inhibitory Effect of Snapdragon Extract

TNF-α and IL-1β by the method described in Experimental Example 3-1 to confirm the effect of snapdragon extract on the expression of representative TNF-α, IL-6, IL-1β and MCP-1 among inflammatory cytokines Protein expression was observed, and mRNA expression of TNF-α, IL-1β, IL-6, and MCP-1 was observed by the method described in Experimental Example 3-2.

As a result, protein expression of TNF-α and IL-1β was significantly inhibited in the group treated with snapdragon extract with LPS treatment (FIG. 4A), and TNF-α, IL-6, and IL-1β by snapdragon extract And MCP-1 mRNA expression was inhibited (FIG. 4B).

< Experimental Example  4> Snapdragon Total of extract  Polyphenol, flavonoid content analysis

Among physiologically active substances contained in plants, the content of representative phenol was analyzed in snapdragon extract. The total phenol content was performed by a method modified with reference to the Folin-Denis method (Singleton and Rossi, 1965). Specifically, 500 μl of the extract was injected, and after 500 μl of 0.5N Folin-Ciocalteu's phenol reagent was reacted for 3 minutes, 2% Na ₂ CO ₃ 1.5 mL was added and the reaction was darkened at room temperature for 30 minutes. Dispense 50 μl into 96-well plates and measure absorbance at 760 nm using a microplate reader. At this time, the total polyphenol compound is obtained from the standard calibration curve prepared using the absorbance values according to the four-step (1, 10, 100, 1000 μg / mL) concentration of the gallic acid solution, and The absorbance value of the sample was substituted and quantified. In addition, flavonoids, one type of polyphenol compounds, are calculated using quercetin equivalents and are shown in Table 2.

sample Total polyphenols (mg GAE / g) Total flavonoids (mg QE / g) Snapdragon ethanol extract 31.65 ± 0.63 0.28 ± 0.02

As shown in Table 2, the total polyphenol content of the snapdragon ethanol extract was 31.65 mg / g, and the total flavonoid content was 0.28 mg / g.

< Experimental Example  5> Antioxidant activity of snapdragon extract

DPPH, ABTS analysis was performed to measure the antioxidant activity of snapdragon ethanol extract. DPPH is widely used as a method of measuring antioxidant activity by using the principle that free radicals are erased and turned yellow by the antioxidant action of a sample when reacted with an antioxidant by free radicals. In addition, the ABTS analysis method is a principle in which blue-green color is bleached by the antioxidant substance in a sample that eliminates ABTS free radicals generated by the reaction of ABTS reagent and potassium persulfate. Is used.

Specifically, 1 mL of a 0.15 mM DPPH solution was added to 1 mL of a sample of snapdragon extract diluted by concentration (1, 2, 5, 10 µg / mL), stirred and left in the dark, and absorbance at 517 nm was measured. For ABTS analysis, 100 μl of ABTS solution was mixed with 100 μl of samples diluted by concentration, and then dispensed into 96-well plates, reacted for 30 minutes in a dark place, and absorbance was measured at 732 nm. Ascorbic acid was used as a positive control sample for DPPH radical removal and ABTS radical removal.

As a result, the snapdragon extract exhibited DPPH radical scavenging activity and ABTS radical scavenging activity depending on the concentration (FIG. 5).

<110> Republic of Korea (RDA) <120> Pharmaceutical composition for anti-inflammatory Ethanol Extract          of Antirrhinum majus as an active ingradient <130> 2017P-10-010 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> homo sapiens <400> 1 aatcttggag cgagttgtgg 20 <210> 2 <211> 21 <212> DNA <213> homo sapiens <400> 2 caggaagtag gtgagggctt g 21 <210> 3 <211> 24 <212> DNA <213> homo sapiens <400> 3 actcactcag tttgttgagt catt 24 <210> 4 <211> 25 <212> DNA <213> homo sapiens <400> 4 tttgattagt actgtagggt taatg 25 <210> 5 <211> 20 <212> DNA <213> homo sapiens <400> 5 gccaccacgc tcttctgcct 20 <210> 6 <211> 20 <212> DNA <213> homo sapiens <400> 6 ggctgatggt gtgggtgagg 20 <210> 7 <211> 20 <212> DNA <213> homo sapiens <400> 7 tctggaccca ttccttcttg 20 <210> 8 <211> 20 <212> DNA <213> homo sapiens <400> 8 aggtccctgt catgcttctg 20 <210> 9 <211> 23 <212> DNA <213> homo sapiens <400> 9 ccagagatac aaagaaatga tgg 23 <210> 10 <211> 22 <212> DNA <213> homo sapiens <400> 10 actccagaag accagaggaa at 22 <210> 11 <211> 20 <212> DNA <213> homo sapiens <400> 11 aaatacctgt ggccttgggc 20 <210> 12 <211> 21 <212> DNA <213> homo sapiens <400> 12 cttgggatcc acactctcca g 21 <210> 13 <211> 22 <212> DNA <213> homo sapiens <400> 13 atcagagagt tgaccgcagt tg 22 <210> 14 <211> 21 <212> DNA <213> homo sapiens <400> 14 caggaagtag gtgagggctt g 21

Claims (8)

An anti-inflammatory pharmaceutical composition comprising a snapdragon flower extract prepared by extraction with ethanol as an active ingredient.
delete delete According to claim 1, The snapdragon flower extract is characterized in that to inhibit the production of NO (nitric oxide), anti-inflammatory pharmaceutical composition.
The method of claim 1, wherein the snapdragon flower extract expresses inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), tumor necrosis factor (TNF-α), interleukin (IL) -1β and IL-6. Anti-inflammatory pharmaceutical composition characterized in that it inhibits.
Health functional food for improving inflammation, characterized in that it comprises a snapdragon flower extract prepared by extraction with ethanol as an active ingredient. delete delete

Images