KR102065150B1 - A composition for preventing or treating obesity comprising isotretinoin-peptide conjugate as an effective ingredient - Google Patents

Abstract

The present invention relates to an isotretinoin-peptide conjugate that inhibits lipid production and has a lipolytic promoting activity, and a prophylactic or therapeutic use of obesity comprising the conjugate as an active ingredient.

Description

A composition for preventing or treating obesity comprising isotretinoin-peptide conjugate as an effective ingredient}

The present invention relates to a composition for preventing or treating obesity.

Obesity means that when energy consumed by food is not balanced with energy consumption, excess energy accumulates into body fat, resulting in excessive fatty tissue in the body. When obesity lasts for a long time, various metabolic diseases and adult diseases such as diabetes, hyperlipidemia and heart disease can be caused. Obesity can be treated in combination with drug therapy, exercise therapy, psychotherapy. However, the drugs used in the current drug therapy, as well as the side effects such as headache, anorexia, insomnia, constipation, as well as problems causing serious side effects in the cardiovascular system.

On the other hand, isotretinoin (13-cis-retinoic acid) is a retinoid compound found in a very small amount in the body. The isotretinoin may be used for the treatment of acne, cancer or skin diseases, and in particular, inhibits sebum secretion, hyperkeratosis of cotton wool and pores, and has an antimicrobial effect against acne bacteria Propionibacterium acnes . It can be used effectively in the treatment of crystalline cystic acne. In addition, the isotretinoin may be used as a therapeutic agent for certain skin cancers such as squamous cell carcinoma, or skin diseases such as Harlequin young, lamellar sclerosis and the like.

The isotretinoin has a very low solubility in water and low bioavailability in a fasting state. Therefore, in order to increase the absorption rate of isotretinoin, it is necessary to take it with food. To this end, an organic solvent is added to solubilize isotretinoin having low solubility in water, but this is a limit that may cause side effects such as dermatitis and skin drying. Is present.

Therefore, there is still a need to improve the physicochemical properties of isotretinoin to increase bioavailability and minimize side effects even when administered orally.

It is an object of the present invention to provide a pharmaceutical composition or a dietary supplement that can be effectively used for the prevention, improvement or treatment of obesity or a disease associated with obesity.

In order to achieve the above object, an aspect of the present invention provides a pharmaceutical composition for the prevention or treatment of obesity or obesity-related diseases comprising the isotretinoin-peptide conjugate as an active ingredient.

In addition, another aspect of the present invention provides a dietary supplement for preventing or improving obesity comprising the isotretinoin-peptide conjugate as an active ingredient.

Isotretinoin-peptide conjugates of the present invention have higher solubility in water than isotretinoin alone, and thus can be well absorbed even in a fasting state.

The isotretinoin-peptide conjugate may be usefully used as an active ingredient of a composition for preventing, ameliorating or treating obesity or obesity-related diseases because it is absorbed into a living body to inhibit the production of fat and promote the decomposition of fat.

However, the effects of the present invention are not limited to the above-mentioned effects, and other effects not mentioned will be clearly understood by those skilled in the art from the following description.

1 is a diagram showing the result of molecular weight analysis of isotretinoin-peptide conjugates.
2 and 3 are diagrams showing the results of confirming the effect of the cell signaling pathway activity associated with lipolysis of isotretinoin-peptide conjugates, respectively.
4 is a view showing the results of confirming the effect of inhibiting the cell signaling pathways associated with fat production of isotretinoin-peptide conjugates.
Figure 5 is a view showing the result confirmed by intracellular fat staining effect promoted intracellular lipolysis due to isotretinoin-peptide conjugate.
Figure 6 shows the results of confirming the effect of free glycerol release in adipocytes by isotretinoin-peptide conjugates.
7 and 8 are a view showing the results of confirming the effect of the cell signaling pathway activity associated with lipolysis of isotretinoin-peptide conjugate in adipose tissue, respectively.
9 and 10 are diagrams showing the results of confirming the effect of inhibiting the cell signaling pathways associated with fat production of isotretinoin-peptide conjugates in adipose tissue, respectively.
11 and 12 are diagrams showing the results of confirming the effect of the cell signaling pathway activity associated with lipolysis of isotretinoin-peptide conjugate in adipose tissue, respectively.
13 and 14 show the results of confirming the effect of free glycerol release in adipose tissue by the isotretinoin-peptide conjugate.
15 is a diagram showing the size of fat in adipose tissue by isotretinoin-peptide conjugates.
16 and 17 are diagrams showing the results of confirming the effect of the cell signaling pathway activity associated with lipolysis of isotretinoin-peptide conjugate in adipose tissue, respectively.

Hereinafter, the present invention will be described in detail.

One. Pharmaceutical compositions for the prevention or treatment of obesity or obesity-related diseases

One aspect of the present invention provides a pharmaceutical composition for preventing or treating obesity.

The pharmaceutical composition for preventing or treating obesity of the present invention includes an isotretinoin-peptide conjugate as an active ingredient.

The isotretinoin-peptide conjugate has a structure in which isotretinoin and a water-soluble peptide are chemically bound.

The isotretinoin is 13-cis-retinoic acid and has a chemical structure represented by the following Chemical Formula 1.

[Formula 1]

As described above, by binding the water-soluble peptide to isotretinoin, an effect of remarkably increasing the solubility in water of isotretinoin having a very low solubility in water may be given.

The water-soluble peptide refers to a linear molecule formed by combining amino acids having side chains that may exhibit hydrophilicity by peptide bonds. The preparation of the water soluble peptide can be accomplished by conventional biological or chemical synthesis methods known in the art, for example by solid-phase synthesis techniques (Merrifield RB, J Amer. Chem. Soc. , 85, 2149-54 (1963); Stewart et al. , Solid Phase Peptide Synthesis, 2nd ed., Pierce Chem. Co. Rockford, 111 (1984)).

The water soluble peptide may be composed of 2 to 30, for example, 5 to 20, for example, 8 to 15 amino acids. When the number of amino acids constituting the water-soluble peptide is less than two, the water solubility of isotretinoin cannot be sufficiently increased, and when the number of amino acids constituting the water-soluble peptide is more than 30, a problem may occur that may lower the absorption rate of isotretinoin. .

The water soluble peptide may have a proportion of an amino acid having a side chain which may exhibit the hydrophilicity of 50% to 100%, for example, 80% to 100%, and the water soluble peptide may have a ratio of an amino acid having a side chain which may exhibit hydrophobicity. This may be 0% to 50%, for example 0% to 20%. If the proportion of amino acids having side chains capable of exhibiting hydrophilicity is outside the above range, the solubility of isotretinoin in water cannot be sufficiently increased.

The amino acid having a side chain that can exhibit the hydrophilicity is arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), asparagine (Asn) , Glutamine (Gln), cysteine (Cys), selenocysteine (Sec), glycine (Gly) and proline (Pro) is selected from the group consisting of amino acids having a side chain that can exhibit the hydrophobicity is alanine (Ala), It may be selected from the group consisting of valine, isoleucine (Ile), leucine (Leu), methionine (Met), phenylalanine (Phe), tyrosine (Tyr) and tryptophan (Trp).

In particular, the water soluble peptide may comprise an amino acid sequence of SEQ ID NO: 1, or an amino acid sequence substantially identical to the amino acid sequence of SEQ ID NO: 1.

The amino acid of SEQ ID NO: 1 may be variants or fragments of amino acids having different sequences by deletion, insertion, substitution or combination of amino acid residues within a range that does not affect binding to isotretinoin protein and increase water solubility. In some cases, it may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, and the like. In addition, the amino acid of SEQ ID NO: 1 includes a water-soluble peptide having a amino acid sequence substantially the same as the water-soluble peptide comprising the amino acid sequence of SEQ ID NO: 1 and variants or active fragments thereof. The water-soluble peptide comprising the substantially identical amino acid sequence is at least 75%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% sequence homology with the amino acid sequence of SEQ ID NO: 1, respectively. It means a water-soluble peptide having an amino acid sequence having a.

The water soluble peptide may be selected from the N- of the water soluble peptide to impart chemical stability, enhanced pharmacological properties (half-life, absorbency, titer, potency, etc.), altered specificity (eg, broad biological activity spectrum), reduced antigenicity. A protecting group such as acetyl group, fluorenyl methoxy carbonyl group, formyl group, palmitoyl group, myristyl group, stearyl group, polyethylene glycol (PEG) or the like may be bonded to the terminal or C-terminus. The chemical stability of the water soluble peptide means not only the stability in vivo that protects the water soluble peptide from the attack of protein cleavage enzymes in vivo, but also the storage stability (eg, room temperature storage stability).

The isotretinoin-peptide conjugates are administered in adipocytes and adipose tissues to activate activated protein kinase-α1 (AMPK-α1), ACOX1, Carnitine palmitoyltransferase I (CPT1), hormone-sensitive lipase (HSL), adipose triglyceride lipase (ATGL), and PLIN1. (Perilipin 1) overexpresses the gene and the protein encoded by the genes, and inhibits the expression of the C / EBPa (Ccaat-enhancer-binding protein) gene and the protein encoded by the genes. In a specific embodiment of the present invention, when the isotretinoin-peptide conjugate having the amino acid sequence of SEQ ID NO: 1 is administered in adipocytes and adipose tissue, expression of AMPK-α1, ACOX1, CPT1, HSL, ATGL and PLIN1 genes is increased. In addition, it was confirmed that the expression of the C / EBPa gene is reduced (FIGS. 2 to 4 and 9 to 12). In addition, when the isotretinoin-peptide conjugate having the amino acid sequence of SEQ ID NO: 1 was administered in adipocytes and adipose tissue, it increased the expression of proteins of AMPK-α1, CPT1 and ATGL, and increased the phosphorylation of HSL proteins. It was confirmed that (see FIGS. 7, 8, 16 and 17).

Therefore, the isotretinoin-peptide conjugate having the above activity can be used as an active ingredient of a composition for the treatment or prevention of obesity and obesity-related diseases.

The obesity refers to a condition or disease with excessive body fat due to energy imbalance. The isotretinoin-peptide conjugate not only significantly increases the expression of the fat oxidation promoting gene and the protein encoded by the genes, the lipolysis promoting gene and the protein encoded by the genes, but also is involved in fat cell accumulation. The obesity can be prevented or reduced by reducing the expression of genes, thereby controlling energy imbalance or leaving the body with excess body fat.

In addition, the obesity-related disease is a disease that can be induced due to a condition having excessive body fat due to energy imbalance, and may reduce or improve symptoms resulting from the obesity-related disease through the prevention or treatment of obesity.

Obesity-related diseases include hypertension, diabetes, increased plasma insulin levels, insulin resistance, hyperlipidemia, metabolic syndrome, insulin resistance syndrome, obesity-related gastroesophageal reflux, arteriosclerosis, hypercholesterolemia, uric acid hyperemia, lower back pain, cardiac hypertrophy And left ventricular hypertrophy, lipodystrophy, nonalcoholic steatohepatitis, cardiovascular disease, polycystic ovary syndrome, and the like.

In a specific embodiment of the present invention, when the peptide isotretinoin conjugate was administered to the adipocytes, it was confirmed that the adipocytes were reduced in size by decreasing the staining of the adipocytes, even when compared with the administration of the isotretinoin alone. It was confirmed that the amount of free-glycerol released in the culture solution of (see FIGS. 5 and 6). In addition, it was confirmed that the effect of reducing the size of the adipocytes and the amount of free-glycerol released in the adipose tissue was also the same (see Figs. 13 to 15).

The pharmaceutical composition may be carried in a pharmaceutically acceptable carrier such as colloidal suspensions, powders, saline, lipids, liposomes, microspheres, nano spherical particles and the like. They may be complexed with or related to the vehicle and are known in the art such as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensation reagents, polysaccharides, polyamino acids, dendrimers, saponins, adsorption enhancing substances or fatty acids It can be delivered in vivo using known delivery systems.

Pharmaceutically acceptable carrier in the isotretinoin-peptide conjugate is lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia, rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystals Cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil, and the like.

The pharmaceutical composition may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, and the like, in addition to the above components.

The pharmaceutical composition may be administered orally or parenterally (eg, applied intramuscularly, intravenously, intraperitoneally, subcutaneously, intradermal, or topically) according to the desired method, and the dosage is determined by the condition of the patient and Depending on body weight, degree of disease, drug form, route of administration and time of day, it may be appropriately selected by those skilled in the art.

The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, 'pharmaceutically effective amount' means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and an effective dose level means the type, severity, drug activity, The sensitivity to the drug, time of administration, route of administration and rate of release, duration of treatment, factors including concurrent use of the drug, and other factors well known in the medical art can be determined. The pharmaceutical composition may be administered as a separate therapeutic agent or in combination with other therapeutic agents for obesity, and may be administered simultaneously, separately, or sequentially with a conventional therapeutic agent, and may be single or multiple doses. Taking all of the above factors into consideration, it is important to administer an amount that can achieve the maximum effect with a minimum amount without side effects, which can be readily determined by one skilled in the art.

The pharmaceutical composition may be combined with exercise therapy, psychotherapy, etc. in order to effectively prevent or treat obesity. As such, when the combination of the drug therapy and exercise or psychotherapy using the pharmaceutical composition can be maximized the prevention or treatment of obesity.

The effective amount of the pharmaceutical composition may vary depending on the age, sex, condition, body weight, absorbency of the active ingredient in the body, inactivation rate, rate of excretion, disease type, the drug used in combination, route of administration, severity of obesity, It may be increased or decreased depending on gender, weight, age, etc. For example, the pharmaceutical composition may be administered about 0.0001 μg to 500 mg, preferably 0.01 μg to 100 mg per kg of patient weight per day.

2. Health functional foods for the prevention or improvement of obesity or obesity-related diseases

Another aspect of the present invention provides a dietary supplement for the prevention or improvement of obesity comprising an isotretinoin-peptide conjugate as an active ingredient.

The health functional food for preventing or improving obesity of the present invention includes the isotretinoin-peptide conjugate described in the section "1. Pharmaceutical composition for preventing or treating obesity or obesity-related diseases " as an active ingredient, obesity and obesity-related diseases It can be used for the purpose of preventing or ameliorating the above, for which the description of the item "1. Pharmaceutical compositions for the prevention or treatment of obesity or obesity-related diseases " is used, and hereinafter for the prevention or improvement of obesity and obesity-related diseases Only the specific composition of dietary supplements will be described.

The prevention or amelioration of obesity prevents the occurrence of a condition or disease with excessive body fat due to an energy imbalance or a condition or disease with an excess body fat due to the energy imbalance. Means to alleviate or ameliorate the symptoms that occur from.

The health functional food may be used simultaneously or separately with a medicament for treatment before or after the onset of the disease for the prevention or improvement of the disease.

In the dietary supplement, the isotretinoin-peptide conjugate may be added to the food as an active ingredient or used together with other foods or food ingredients, and may be appropriately used according to a conventional method. The mixing amount of the active ingredient can be suitably determined according to the purpose of use (prevention or improvement). In general, in the manufacture of food or beverages the compositions of the invention may be added in an amount of up to 15% by weight, for example up to 10% by weight, based on the total composition weight. However, in the case of long-term intake for health and hygiene purposes or health control purposes, the amount may be below the above range.

The dietary supplement may contain other components as an essential ingredient without particular limitation, in addition to including the isotretinoin-peptide conjugate. For example, various flavors, natural carbohydrates, and the like may be included as additional ingredients, such as ordinary beverages. The natural carbohydrates described above may be monosaccharides such as glucose, fructose and the like, and may be disaccharides such as maltose, sucrose and the like, and conventional polysaccharides such as dextrin, cyclodextrin and the like. It may be a sugar alcohol or a sugar alcohol such as xylitol, sorbitol, erythritol. The proportion of the natural carbohydrate can be appropriately determined by the choice of those skilled in the art.

The dietary supplement may further include natural flavors (tautin, stevia extract (eg, rebaudioside A, glycyrgin, etc.)) and synthetic flavors (saccharin, aspartame, etc.) as flavoring agents. Can be.

The health functional food includes various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, coloring and neutralizing agents (such as cheese and chocolate), pectic acid and salts thereof, alginic acid and salts thereof, Organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohol, carbonation agent used in the carbonated beverage may be further included. The components may be used independently or in combination, and the ratio of the additives may also be appropriately selected by those skilled in the art.

Hereinafter, the present invention will be described in detail by Examples and Experimental Examples.

However, the following Examples and Experimental Examples specifically illustrate the present invention, and the content of the present invention is not limited by the following Examples and Experimental Examples.

Preparation Example 1 Preparation of Isotretinoin-peptide Binder

Into the peptite reactor, deprotected peptide (1 mmol) of SEQ ID NO: 1 and 10 ml of dimethylformamide (DMF) were added, and 270 mg (2.0 equiv.) Of 1-hydroxybenzotriazole (HOBt), (benzotriazole 1-yl oxy) tripyrrolidino postponium hexafloorphosphonate (PyBOP) 1.04 g (2.0 equiv.) And isotretinoin 277 mg (2.0 equiv.) Were added and reacted for 30 minutes. Thereafter, 388 mg (3 equiv.) Of N, N-diisopropylethylamine (DIEA) was further added and reacted at room temperature for 2 to 4 hours. Then, after recrystallization using 10 mL (10 mmol) of diethyl ether, and filtered to prepare a conjugate of the peptide of SEQ ID NO: 1 and isotretinoin (hereinafter referred to as 'isotretinoin-peptide conjugate').

SEQ ID NO: Amino acid sequence One Iso-Arg- Arg-Leu-Ile-AspArg-Thr-Asn-Ala-Asn-His-Heu-Val-Glu

Preparation Example 1 Induction of whole-fat cell culture and differentiation into adipocytes

Pre-fat cells, 3T3-L1 cells, were seeded in 24-well plates at a density of 2 × 10 ⁴ cells / well and then cultured overnight. The cells are then incubated for 2 days in DMEM medium (hereinafter referred to as 'differentiation medium') containing differentiation components (including 10 mg / ml insulin, 0.1 μM decetamethasone and 0.5 μM IBMX) and 10% FBS To induce differentiation into adipocytes. The differentiated adipocytes were then cultured in DMEM medium (hereinafter referred to as 'culture medium') containing 1 mg / ml insulin and 10% FBS, and the culture medium was replaced every two days.

Preparation Example 2 Adipose Tissue Collection and Cultivation

Adipose tissue was collected from the abdomen of 9-week-old BL / 6 mice, placed in a 100 mm X 15 mm culture dish, and cultured overnight in the culture medium. The adipose tissue was divided into equal weights, transferred to 24-well plates, and used in the following experimental examples.

Experimental Example 1 Confirmation of Physical Properties of Isotretinoin-Peptide Conjugates

[1-1] Molecular Weight Analysis of Isotretinoin-peptide Binders

In order to confirm the structure of the isotretinoin-peptide conjugate prepared in Preparation Example 1, an experiment of measuring molecular weight was performed using a 3200 QTRAP LC / MS / MS system (Applied Biosystems, Forster, CA, USA).

As shown in FIG. 1, it can be seen that the isotretinoin-peptide conjugate has synthesized an isotretinoin-peptide conjugate having a molecular weight of about 1989.3 Da.

[1-2] Solubility Analysis of Isotretinoin-peptide Binders

Octanol water partition coefficient (logPOW) value was measured to confirm the solubility of the isotretinoin-peptide conjugate prepared in Preparation Example 1.

The isotretinoin-peptide conjugate was completely dissolved in saturated octanol for each concentration to prepare a sample solution. Saturated octanol and octanol saturated water were added to the sample solution, followed by shaking while maintaining the room temperature. Thereafter, the mixed solution was centrifuged to separate the octanol layer and the aqueous layer. An octanol was then taken from the center of the octanol layer using a pipette and water was taken from the water layer using a syringe. The concentration of the sample taken from the octanol layer and the aqueous layer was quantified, and the logPOW value was calculated through the following equation.

logPOW = log C _O / C _W

(Where C ₀ is the concentration of isotretinoin peptide conjugate taken from octanol and C _W is the concentration of isotretinoin peptide conjugate taken from aqueous layer.)

As a result, the octanol water partition coefficient of isotretino was 4.2, while the octanol water partition coefficient of isotretinoin-peptide conjugate was -2.17.

Through the above results, the isotretinoin-peptide conjugate of the present invention can be seen that water solubility is improved compared to the case where isotretinoin alone is present by binding a water-soluble peptide to isotretinoin.

Experimental Example 2 Confirmation of Lipolysis-promoting Cell Signaling Pathway Effect

In adipocytes, in order to confirm whether the isotretinoin-peptide conjugate has an active effect of a lipolysis-promoting cell signaling pathway, the mRNA expression level of genes related to fatty acid oxidation promotion and lipolysis promotion is confirmed. It was.

Specifically, isotretinoin-peptide conjugates were administered to adipocytes differentiated in Preparation Example 1 at concentrations of 50 μM and 100 μM, and then cultured for 24 hours. TNFα was used as a positive control. Total RNA of the cultured adipocytes (Total RNA) was extracted using the Qiagen RNeasy kit. In order to synthesize the extracted RNA into cDNA, 3 μg RNA and 2 μg random hexamer were added to DEPC treated water and reacted at 65 ° C. for 5 minutes. The reaction included 5 x first strand buffer, 0.1 M DTT, 10 mM dNTP and reverse transcriptase so that the final volume could be 20 μl. Then, the mixture was reacted at 42 ° C. for 1 hour, heated at 95 ° C. for 5 minutes, and 20 μl of distilled water was added to finally obtain 40 μl of cDNA.

In order to confirm fatty acid oxidation promotion and expression of lipolytic genes, polymerase chain reaction was carried out using the primers of Table 2, and the results are shown in FIG. 2. In addition, the expression level of the gene was quantified, and the results are shown in FIG. 3.

gene Primer Sequence (5 '-> 3') SEQ ID NO: CPT1a Forward direction CGTACCAAGTAGCCAAGGCA 2 Reverse CAGGAACGCACAGTCTCAGT 3 ACOX1 Forward direction CCGCCGAGAGATCGAGAAC 4 Reverse CAGTTGCCTGGTGAAGCAAG 5 HSL Forward direction GGACACACACACACCTG 6 Reverse CCCTTTCGCAGCAACTTTAG 7 ATGL Forward direction TCGTGGATGTTGGTGGAGCT 8 Reverse TGTGGCCTCATTCCTCCTA 9 PLIN1 Forward direction AAGGATCCTGCACCTCACAC 10 Reverse CCTCTGCTGAAGGGTTATCG 11 AMPKα Forward direction TCACCGGACATAAAGTGGCT 12 Reverse TGATGATGTGAGGGTGCCTG 13 β-actin Forward direction CGTGGGCCGCCCTAGGCA 14 Reverse TTGGCTTAGGGTTCAGGGGG 15

As shown in FIGS. 2 and 3, CPT1a and ACOX1 corresponding to fatty acid oxidation promoting genes, and HSL, ATGL, and PLIN1, which promote lipolysis, increased expression when treated with isotretinoin-peptide conjugates. The results show that the isotretinoin-peptide conjugate according to the present invention enhances the activity of a gene involved in promoting lipolysis or fatty acid oxidation so that the fat accumulated in adipocytes can be effectively decomposed.

Experimental Example 3 Confirmation of Adipogenesis Promoting Cell Signaling Pathway Activity

In order to determine whether the isotretinoin-peptide conjugates inhibit cell signaling pathways that promote fat production, the mRNA expression level of C / EBPa, a gene involved in fat production promotion, was examined.

Isotretinoin-peptide conjugate administration and polymerase chain reaction were performed in the same manner as in Experimental Example 2, and the results are shown in FIG. 4. However, primer sequences for polymerase chain reaction are shown in Table 3 below.

gene Primer Sequence (5 '-> 3') SEQ ID NO: C / EBPa Forward direction TCGGTGGACAAGAACAGCAA 16 Reverse CCTTGACCAAGGAGCTCTCA 17 GAPDH Forward direction GGAGCCAAAAGGGTCATCAT 18 Reverse GTGATGGCATGGACTGTGGT 19

As shown in Figure 4, the C / EBPa corresponding to the genes associated with fat accumulation in adipocytes decreased expression when isotretinoin-peptide conjugate. Through the above results, the isotretinoin-peptide conjugate according to the present invention is adipocyte It can be seen that the production of internal fat is significantly suppressed, and the production of fat is suppressed, leading to a decrease in fat accumulation.

Experimental Example 4 Confirming Lipolysis Effect in Adipose Cells

It was confirmed whether the isotretinoin-peptide conjugate has an effect of degrading fat accumulated in adipocytes.

Specifically, after administration of isotretinoin-peptide conjugates at concentrations of 50 μM and 100 μM to adipocytes differentiated for 9 days in Preparation Example 1, an oil red O staining assay was performed after 24 hours. .

The adipocytes were washed with PBS and then fixed by treating with 4% paraformaldehyde for 10 minutes. The fixed cells were washed with distilled water and then incubated for 5-10 minutes with 60% isopropanol. Then, the cultured adipocytes were stained with oil red solution [1% Oil Red in isopropanol was diluted in dH ₂ O in ratio of 6: 4 (vol / vol)] for 30 minutes and washed with PBS. After staining the cells were observed under an optical microscope, washed again with distilled water and 1 ml of 100% isopropanol was mixed at 4 ℃. The values were measured at 510 nm for quantification the next day and the results are shown in FIG. 5.

As shown in FIG. 5, staining of fat in adipocytes was reduced when the isotritinoin peptide conjugate was administered.

The results show that the fusion protein can induce the reduction of fat accumulated in adipocytes, and induce the reduction of fat in adipocytes by inhibiting adipogenesis.

Experimental Example 5 Confirmation of Lipolytic Activity in Adipose Cells

Triglycerides stored in adipocytes are broken down into fatty acids and glycerol for energy production or cellular signaling. Therefore, the degradation effect of triglycerides accumulated in adipocytes was evaluated by measuring the amount of free glycerol released.

Specifically, the isotretinoin-peptide conjugate was administered at concentrations of 1 μM and 10 μM, respectively, while replacing the culture medium of the adipocytes differentiated in Preparation Example 1 with the culture medium. After collection of the culture solution on day 8 after administration, a glycerol assay was performed using a glycerol colorimetric assay kit (cayman, USA), and the results are shown in FIG. 6.

As shown in FIG. 6, when the isotretinoin-peptide conjugate was administered as compared to the control group, glycerol, which is a degradation metabolite of fat accumulated in adipocytes, was released into the culture medium depending on the concentration of isotretinoin-peptide conjugate.

The results show that isotretinoin-peptide conjugates can induce degradation of triglycerides accumulated in adipocytes.

Experimental Example 6 Confirmation of Lipolysis-promoting Cell Signaling Pathway Effect

In order to confirm whether the isotretinoin-peptide conjugate has an active effect of the lipolysis-promoting cell signaling pathway, the expression and phosphorylation degree of the protein related to fatty acid oxidation promotion and lipolysis promotion were confirmed.

Isotretinoin-peptide conjugates were administered to the adipose tissue of Preparation Example 2 at concentrations of 50 μM and 100 μM and incubated for 48 hours, followed by Western blot analysis.

Specifically, the adipose tissue was RIPA buffer [12 mm EDTA, 137 mm NaCl, 20 mm Tris-HCl (pH 8.0), 1 mm Na3VO4 (Sigma-Aldrich, USA) 10 mm NaF (Sigma), 1 mm PMSF (Sigma) ), 1% Triton X-100, 10% Glycerol, Protease Inhibition Cocktail (Roche, Germany)] and the cell lysate was centrifuged at 14,000 rpm for 20 minutes to recover the supernatant, followed by CPT1a, ATGL Western blot was performed using the AMPKα and p-HSL antibodies, and the results are shown in FIGS. 7 and 8.

As shown in FIG. 7 and FIG. 8, CPT1a, ATGL, and AMPKα proteins were increased in concentration-dependent expression when administered isotretinoin-peptide conjugates, and in the case of HSL, phosphorylation of proteins was increased.

Through the above results, the isotretinoin-peptide conjugate according to the present invention increases the expression of proteins related to the decomposition of fat or the oxidation of fatty acids, and phosphorylation of proteins related to lipolysis, so that the fat accumulated in adipose tissue can be effectively broken down. It can be seen that the degree can be increased.

Experimental Example 7 Confirmation of Lipolysis-promoting Cell Signaling Pathway Effect

In adipose tissues, to determine whether the isotretinoin-peptide conjugates have an active effect of the lipolytic-stimulating cell signaling pathway, the mRNA expression level of genes related to fatty acid oxidation promotion and lipolysis promotion was examined. .

Isotretinoin-peptide conjugates were administered to adipose tissue in the same manner as in Experimental Example 6, and the entire method of RNA extraction and polymerase chain reaction were performed in the same manner as in Experimental Example 2, and the results are shown in FIGS. 9 to 12.

9 and 10, the administration of isotretinoin-peptide conjugates into adipose tissues increased the expression of PGC1a, CPT1 and ACOX1, which are fatty acid oxidation promoting genes, compared to the control group.

In addition, as shown in Figures 11 and 12, when the isotretinoin-peptide conjugate is administered into adipose tissue, expression of HSL, ATGL, PLIN1 and Leptin, which are related to lipolysis-promoting genes, and the expression of AMPK1a genes that increase the expression of such genes Increased compared to the control.

Through the above results, it can be seen that the isotretinoin-peptide conjugate according to the present invention increases the activity of a gene for promoting lipolysis or fatty acid oxidation so as to effectively break down fat even in adipose tissue.

Experimental Example 8 Confirmation of Lipolytic Activity in Adipose Tissue

In the adipose tissue, the amount of free glycerol released was measured as to whether degradation of triglycerides was induced by the isotretinoin-peptide conjugate.

Isotretinoin alone was administered to the adipose tissue of Preparation Example 2 at a concentration of 10 μM, the isotretinoin-peptide conjugate was administered at a concentration of 50 μM and 100 μM and incubated for 48 hours, followed by release in the same manner as in Experiment 5. The amount of glycerol released was measured, and the results are shown in FIGS. 13 and 14.

As shown in FIG. 13, when the isotretinoin-peptide conjugate was administered as compared to the control group, glycerol, a degradation metabolite of fat accumulated in adipose tissue, was released into the culture medium.

In addition, as shown in FIG. 14, when the isotretinoin-peptide conjugate was administered, more than 20% of glycerol, a degradation metabolite of fat accumulated in adipose tissue, was released into the culture medium as compared with the administration of isotretinoin alone.

The results indicate that isotretinoin-peptide conjugates can induce degradation of triglycerides accumulated in adipose tissue.

Experimental Example 9 Confirming Lipolysis Effect in Adipose Tissue

In order to confirm the lipolytic effect in the adipose tissue according to the isotretinoin-peptide conjugate, H & E staining was performed on the adipose tissue used in Experimental Example 8.

Specifically, the adipose tissue was cut and attached to a paraffin slide, and dried at 50 ° C. The dried adipose tissue-attached slides were placed in xylenes 1, 2 and 3 for 5 minutes each and de-paraffinized. Thereafter, the mixture was placed in 100% ethanol for 2 minutes and sequentially re-hydrated in 90%, 80%, and 70% ethanol, respectively. The rehydrated slides were stained in hematoxylin solution, stained with tapping water, and stained with eosin Y. Subsequently, the mixture was sequentially placed in 90%, 80%, and 70% ethanol, and then placed in xylene 3, 2, and 1, and then mounted through a xylene-based mounting media. The mounted slides were dried well and observed with an optical microscope, and the results are shown in FIG. 15.

As shown in FIG. 15, it was confirmed that the size of the cells in the adipose tissue administered with the isotretinoin-peptide conjugate was significantly smaller than that of the control group.

Experimental Example 10 Confirmation of the Lipolytic Promoting Activity in Adipose Tissue

It was confirmed by immunohistochemistry whether the isotretinoin-peptide conjugate has a lipolytic promoting activity in adipose tissue.

Specifically, the adipose tissue cultured as in Experimental Example 8 was cut and attached to a paraffin slide, and dried at 50 ° C. The dried slides were placed in xylenes 1, 2 and 3 each for 5 minutes and de-paraffinized. Then, the mixture was placed in 100% ethanol for 2 minutes, and then re-hydrated in 90%, 80%, and 70% ethanol, respectively. Next, the slide was placed in a TRS buffer, microwave was added for 5 minutes, and the buffer was cooled for 15 minutes in running water. Thereafter, the slides were added, microwave was added for 3 minutes, and the buffer was cooled for 15 minutes in running water. Then, the slides were washed with PBS, inactivated and washed with endogenous peroxidase, and then blocked with blocking solution for 1 hour and then overnight with primary antibodies p-HSL and ATGL. Incubated. For visualization, incubation with a secondary antibody bound to fluorescence for 2 hours and incubation with DAPI for 20 minutes, mounting and observing under a fluorescence microscope, the results are shown in Figures 16 and 17.

As shown in FIG. 16 and FIG. 17, the treatment of isotretinoin-peptide conjugates in adipose tissue also increased the degree of phosphorylation of HSL, and the expression of ATGL, a lipolysis-related protein, was increased compared to the control group.

Although the present invention has been described in detail only with respect to the embodiments described, it will be apparent to those skilled in the art that various modifications and variations are possible within the technical spirit of the present invention, and such modifications and modifications belong to the appended claims.

<110> CAREGEN CO., LTD. <120> A composition for preventing or treating obesity configuring          isotretinoin-peptide conjugate as an effective ingredient <130> 2018DPA2596 <160> 19 <170> KoPatentIn 3.0 <210> 1 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> peptide <400> 1 Arg Arg Leu Ile Asp Arg Thr Asn Ala Asn His Leu Val Glu   1 5 10 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CPT1a forward primer <400> 2 cgtaccaagt agccaaggca 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CPT1a reverse primer <400> 3 caggaacgca cagtctcagt 20 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ACOX1 forward primer <400> 4 ccgccgagag atcgagaac 19 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ACOX1 reverse primer <400> 5 cagttgcctg gtgaagcaag 20 <210> 6 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> HSL forward primer <400> 6 ggacacacac acacctg 17 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HSL reverse primer <400> 7 ccctttcgca gcaactttag 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ATGL forward primer <400> 8 tcgtggatgt tggtggagct 20 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ATGL reverse primer <400> 9 tgtggcctca ttcctccta 19 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLIN1 forward primer <400> 10 aaggatcctg cacctcacac 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PLIN1 reverse primer <400> 11 cctctgctga agggttatcg 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AMPK alpha forward primer <400> 12 tcaccggaca taaagtggct 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AMPK alpha reverse primer <400> 13 tgatgatgtg agggtgcctg 20 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> beta-actin forward primer <400> 14 cgtgggccgc cctaggca 18 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-actin reverse primer <400> 15 ttggcttagg gttcaggggg 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> C / EBPa forward primer <400> 16 tcggtggaca agaacagcaa 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> C / EBPa reverse primer <400> 17 ccttgaccaa ggagctctca 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 18 ggagccaaaa gggtcatcat 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 19 gtgatggcat ggactgtggt 20

Claims (11)

A pharmaceutical composition for the prevention or treatment of obesity, comprising an isotretinoin-peptide conjugate having an isotretinoin and a water-soluble peptide covalently bonded as an active ingredient,
The water-soluble peptide is a linear molecule consisting of 8 to 20 amino acid sequences formed by binding amino acids to each other by peptide bonds,
The water-soluble peptide is 50% to 100% of the amino acid having a side chain (side chain) that can exhibit hydrophilicity, 0% to 50% of the amino acid having a side chain that can exhibit hydrophobicity,
Amino acids having a side chain that can exhibit the hydrophilicity are arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), asparagine (Asn) , Glutamine (Gln), cysteine (Cys), selenocysteine (Sec), glycine (Gly) and proline (Pro) is selected from the group consisting of amino acids having a side chain that can exhibit the hydrophobicity is alanine (Ala), Prevention or treatment of obesity selected from the group consisting of valine, isoleucine (Ile), leucine (Leu), methionine (Met), phenylalanine (Phe), tyrosine (Tyr) and tryptophan (Trp) Pharmaceutical composition for.
delete The method according to claim 1,
The water-soluble peptide is a pharmaceutical composition for the prevention or treatment of obesity is a linear molecule consisting of 14 amino acid sequences.
The method according to claim 1,
The water-soluble peptide is 80% to 100% of the amino acid having a side chain that can exhibit hydrophilicity, 0% to 20% of the amino acid having a side chain that can represent hydrophobic prevention or treatment pharmaceutical Composition.
delete The method according to claim 1,
The peptide is a pharmaceutical composition for the prevention or treatment of obesity having the amino acid sequence of SEQ ID NO: 1
The method according to claim 1,
The composition increases the expression of AMPK-α1 (Activated protein kinase-α1), ACOX1, Carnitine palmitoyltransferase I (CPT1), hormone-sensitive lipase (HSL), Adipose triglyceride lipase (ATGL), and PLIN1 (Perilipin 1) genes,
A pharmaceutical composition for preventing or treating obesity, which reduces expression of the Ccaat-enhancer-binding protein (C / EBPa) gene.
The method according to claim 1,
The composition increases the expression of coated proteins from AMPK-α1, ACOX1, CPT1, ATGL and PLIN1,
A pharmaceutical composition for preventing or treating obesity, which is to increase phosphorylation of a protein encoded from Hormone-Sensitive Lipase (HSL).
delete delete As a health functional food for the prevention or improvement of obesity comprising isotretinoin-peptide conjugate having an isotretinoin and a water-soluble peptide covalently bonded as an active ingredient,
The water-soluble peptide is a linear molecule consisting of 8 to 20 amino acid sequences formed by binding amino acids to each other by peptide bonds,
The water-soluble peptide is 50% to 100% of the amino acid having a side chain that can exhibit hydrophilicity, 0% to 50% of the amino acid having a side chain that can display hydrophobicity,
Amino acids having a side chain that can exhibit the hydrophilicity are arginine (Arg), histidine (His), lysine (Lys), aspartic acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), asparagine (Asn) , Glutamine (Gln), cysteine (Cys), selenocysteine (Sec), glycine (Gly) and proline (Pro) is selected from the group consisting of amino acids having a side chain that can exhibit the hydrophobicity is alanine (Ala), Prevention or amelioration of obesity selected from the group consisting of valine, isoleucine (Ile), leucine (Leu), methionine (Met), phenylalanine (Phe), tyrosine (Tyr) and tryptophan (Trp) Dietary supplements.

Images