KR102064475B1 - Microorganism for producing muconic acid and method for manufacturing the strain - Google Patents

Abstract

E. coli transformed with the recombinant vector according to the present invention possesses high muconic acid production ability, thereby effectively producing muconic acid, which is a precursor of bio-derived TPA or adipic acid. Specifically, the microorganism according to the present invention is a polynucleotide, aroY ^opt polynucleotides and catA ^opt polynucleotides each one operon encoding the encoding the encoding the asbF ^opt three of a foreign gene required for E. coli to produce the MU-conic acid By introducing a recombinant vector prepared in the (operon) form into E. coli, the foreign genes can be transcribed at the same ratio, respectively.

Description

Microorganisms for producing muconic acid and method for manufacturing the strain

The present invention relates to a novel recombinant vector having a muconic acid production capacity, a microorganism comprising the same and a method for producing the same.

Fossil fuels used as raw materials for energy and chemicals face various environmental and economic problems, including global warming, due to continuous oil price rises and resource depletion. have. Among them, biosynthetic strategies using microorganisms are being actively studied, and in particular, it is possible to biosynthesize various chemicals, biofuels, amino acids and secondary metabolites of plants using recombinant microorganisms whose specific metabolic pathways have been genetically redesigned. .

Currently, the global polymer market is required to use bio-derived eco-friendly raw materials. Accordingly, large beverage companies such as Coca-Cola and Pepsi are focusing on the development of 100% plant-derived polyethylene terephthalate (PET). Meanwhile, PTT (polytrimethylene terephthalate), which has a structure similar to that of PET but has unique characteristics, has a high potential market size and is growing at an average annual growth rate of 17%. Therefore, like PET, PTT is a time point for bio-friendly polymer synthesis. Currently, PTT is produced through a condensation reaction between terephthalic acid (TPA) derived from petroleum and 1,3-PDO (1,3-propanediol) derived from biotechnology. On the other hand, bio-derived research on 1,3-PDO derived from bio, TPA derived from biotechnology is very poor worldwide. In particular, since most of the research on terephthalic acid (TPA) starts with petrochemicals, there is a need for development of bio-friendly TPA production process. However, a process for biosynthesizing TPA directly from a bio-derived carbon source using a bioprocess has not been developed yet. Therefore, in order to produce environmentally friendly TPA, it is necessary to first develop a bio-derived TPA precursor through a bioprocess, and to develop a fusion production process that converts the TPA precursor produced through the bioprocess into TPA through a chemical synthesis process.

Muconic acid is well known as a precursor of adipic acid in addition to its use as a bio-derived precursor for TPA synthesis. Adipic acid is used as a precursor to various materials such as nylon, lubricants, plastics, and plasticizers, and consumes a large amount of 2 × 10 ⁹ kg annually worldwide. However, cyclohexane derived from benzene, which is currently used when adipic acid is synthesized, has a problem of generating N ₂ O which causes global warming during oxidation. In addition, various intermediate chemicals in each step are known as carcinogens as well as harmful to the human body. In order to solve this problem, it is necessary to develop adipic acid production process using renewable raw materials derived from plants, that is, adipic acid production process through hydrogenation of bio-derived muconic acid.

Alper H, Miyaoku K, Stephanopoulos G. (2005) Construction of lycopene-overproducing E. coli strains by combining systematic and combinatorial gene knockout targets. Nature Biotechnology, 23, 612-616. Atsumi S, Hanai T, Liao JC. (2008) Non-fermentative pathways for synthesis of branched-chain higher alcohols as biofuels. Nature, 451, 86-89. Azizkhan JC, Jensen DE, Pierce AJ, Wade M. (1993) Transcription from TATA-less promoters: Dihydrofolatereductase as a model. Critical Reviews in Eukaryotic Gene Expression, 3, 229-54. Berry, A. (1996) Improving production of aromatic compounds in Escherichia coli by metabolic engineering. Trends in Biotechnology, 14 (7), 250-256. Branlant C, Oster T, Branlant G. (1989) Nucleotide sequence determination of the DNA region coding for Bacillus stearothermophilus glyceraldehyde-3-phosphate dehydrogenase and of the flanking DNA regions required for its expression in Escherichia coil. Gene, 75, 145-155. Conway T, Ingram LO. (1988) Phosphoglycerate kinase gene from Zymomonasmobilis: Cloning, sequencing and localization within the gap operon. Journal of Bacteriology, 170, 1926-1933. Draths KM, Frost JW. (1994) Environmentally compatible synthesis of adipic acid from D-glucose. Journal of the American Chemical Society, 116, 399-400. Fox DT, Hotta K, Kim CY, Koppisch AT. (2008) The missing link in petrobactin biosynthesis: AsbF encodes a () -3-dehydroshikimate dehydratase. Biochemistry, 47 (47), 12251-12253. Frost JW, Draths. KM. (1995) Biocatalytic syntheses of aromatics from D-glucose: Renewable microbial sources of aromatic compounds. Annual Review of Microbiology, 49, 557-579. Harris JI, Waters M. (1976) Glyceraldehyde-3-phosphate dehydrogenase. The Enzyme, 13, 1-49. Lin Y, Yan Y. (2012) Biosynthesis of caffeic acid in Escherichia coli using its endogenous hydroxylase complex. Microbial Cell Factories, 11, 42. Lin YL, Blaschek HP. (1983) Butanol production by a butanol-tolerant strain of Clostridium acetobutylicum in extruded corn broth. Applied and Environmental Microbiology, 45, 966-973. Miller JH. (1972) Experiments in molecular genetics; Cold spring harbor laboratory. Planview. NiuW, Draths KM, Frost JW. (2002) Benzene-free synthesis of adipic acid. Biotechnology Progress, 18, 201-211. Pfleger BF, Kim Y, Nusca TD, Maltseva N, Lee JY, Rath CM, Scaglione JB, Janes BK, Anderson EC, Bergman NH, Hanna PC, Joachimiak A, Sherman DH. (2008) Structural and functional analysis of AsbF: Origin of the stealth 3,4-dihydroxybenzoic acid subunit for petrobactin biosynthesis. Proceedings of the National Academy of Sciences, 105 (44), 17133-17138. Pittard AJ. (1996) Biosynthesis of the aromatic amino acids. Escherichia coli and Salmonella. InNeidhart FC, Curtiss R, Ingraham JL, Lin ECC, Low KB, Magasanik B, Reznikoff WS, Riley M, Schaechter M, Umbarger HE (ed.). vol. American Society for Microbiology. Washington, D.C.pp. 458-484. Sprenger GA. (2007) From scratch to value: Engineering Escherichia coli wild type cells to the production of L-phenylalanine and other fine chemicals derived from chorismate. Applied Microbiology and Biotechnology, 75 (4), 739-749. Thiemens MH, Trogler WC. (1991) Nylon production: An unknown source of atmospheric nitrous oxide. Science, 251, 932-934. Ulrich H. (1988) Raw materials for industrial polymers. Germany: Hanser Publishers, Munich. Warhurst AM, Clarke KF, Hill RA, Holt RA, Fewson CA (1994) Production of catechols and muconic acids from various aromatics by the styrene-degrader Rhodococcus rhodochrous NCIMB 13259. Biotechnology Letters, 16, 513-516. Weber C, BrC, Weinreb S, Lehr C, Essl C, Boles E. (2012) Biosynthesis of cis, cis-muconic acid and its aromatic precursors, catechol and protocatechuic acid, from renewable feedstocks by Saccharomyces cerevisiae. Applied and Environmental Microbiology, 78 (23), 8421. Wu CM, Lee TH, Lee SN Lee YA, Wu JY (2004) Microbial synthesis of cis, cis-muconic acid by Sphingobacterium sp. GCG generated from effluent of a styrene monomer (SM) production plant. Enzyme and Microbial Technology, 35, 598-604. Yan Y, Chemler J, Huang L, Martens S, Koffas MA. (2005) Metabolic engineering of anthocyanin biosynthesis in Escherichia coli. Applied and Environmental Microbiology, 71, 3617-3623.

An object of the present invention is to provide an Escherichia coli having a high muconic acid production capacity and a method for producing the same.

In order to achieve the above object, one embodiment of the invention is a polynucleotide as a recombinant vector for the production of MU-conic acid, encoding the polynucleotides, encoding the aroY ^opt and ^opt asbF a polynucleotide encoding a catA ^opt , upstream of each of the three polynucleotides, comprising a ribosomal binding site (rbs) derived from E. coli, and a first transcribed polynucleotide of the three polynucleotides It provides a recombinant vector for the production of muconic acid, including a promoter (promoter) upstream of the ribosome binding site (rbs).

Further, one embodiment of the present invention are polynucleotides encoding the MU-conic acid process for preparing E. coli for production, a polynucleotide encoding a asbF ^opt the vector, and aroY ^opt preparing a recombinant vector by inserting a polynucleotide encoding catA ^opt and inserting a ribosome binding site (rbs) derived from E. coli in an upstream direction of the three polynucleotides, and the recombinant vector It provides a method for producing E. coli for muconic acid production comprising the step of transforming E. coli into the microorganism.

E. coli transformed with the recombinant vector according to the present invention possesses a high muconic acid production capacity, thereby effectively producing muconic acid, which is a precursor of bio-derived TPA or adipic acid. In addition, the microorganism according to the present invention by producing the foreign genes necessary for producing muconic acid Escherichia coli in the form of a single operon (operon) and introduced into E. coli, the foreign genes can each be transcribed in the same ratio. Therefore, the implementation of the prepared microorganism itself can be judged as the implementation of a single gene, so it is easy to confirm the success of the manufactured microorganism.

FIG. 1 shows biosynthetic pathways and regulatory pathways of aromatic amino acids and cis, cis-muconic acids in Escherichia coli, and dashed lines indicate feedback suppression. Names of substances described in Figure 1 E4P (erythrose-4-phosphate), PEP (phosphoenolpyruvate), DAHP (3-deoxy-d-arabinoheptulosonate-7-phosphate), DHQ (3-dehydroquinic acid), DHS (3-dehydroshikimic acid), SA (shikimic acid), PCA ( protocatechuate) with and gene name aroF (DAHP synthase, l-tyr ), aroG (DAHP synthase, l-phe), aroH (DAHP synthase, l-trp), aroB (DHQ synthase), aroD (DHQ dehydratase), aroE (shikimate dehydrogenase), asbF ^opt (dehydroshikimate dehydratase), aroY ^opt (protocatechuate decarboxylase) and catA ^opt (catechol 1,2-dioxygenase) are E. coli Follow the K-12 connection map.
2 shows (A) pUC18ΔlacZ and (B) pMESK1 as recombinant plasmid maps.
Figure 3 shows the cis, cis-muconic acid (Muconic) for the incubation time of AB2834 / pMESK1 (Example) and AB2834 / pUC18ΔlacZ (Comparative) in different media of (A) LB medium (B) M9 medium acid) and cell growth. (◆: cis, cis-muconic acid production of AB2834 / pMESK1, ○: cell growth of AB2834 / pUC18ΔlacZ, ■: cell growth of AB2834 / pMESK1)
4 is a graph showing cis, cis-muconic acid (◆), 3-DHS (□), cathecol (Δ), and PCA (○) production of AB2834 / pMESK1 (Example).
Figure 5 shows the RT-PCR analysis of AB2834 / pMESK1 (Example) (M: 100bp ladder, 1 : aroB, 2: aroD, 3: aroF, 4: aroH, 5: aroG, 6: asbF opt, 7: aroY ^opt , 8: catA ^opt , 9: GAPDH).

Hereinafter, the present invention will be described in detail.

Muconic acid (muconic acid) is a precursor of bio-derived terephthalic acid (TPA) or adipic acid, can be synthesized through the intermediate of the aromatic amino acid biosynthetic pathway. Thus, the present invention, in order to provide a microorganism capable of producing muconic acid, Escherichia coli ( Esherichia) among the microorganisms coli ) genes capable of synthesizing muconic acid were introduced.

In embodiments of the invention are mu conic acid as a recombinant vector for production, a polynucleotide encoding the polynucleotide, encoding a asbF aroY ^opt and ^opt a polynucleotide encoding a catA ^opt , upstream of each of the three polynucleotides, comprising a ribosomal binding site (rbs) derived from E. coli, and a first transcribed polynucleotide of the three polynucleotides It provides a recombinant vector for the production of muconic acid, including a promoter (promoter) upstream of the ribosome binding site (rbs). In one embodiment the polynucleotide is the first transfer of the three polynucleotides is any one selected from a polynucleotide encoding the polynucleotide and catA ^opt encoding polynucleotides, aroY ^opt encoding asbF ^opt, of the three genes The arrangement order is not limited to the order in which the genes are described. For example, the three genes may be arranged in the order of polynucleotides encoding aroY ^opt , polynucleotides encoding asbF ^opt and polynucleotides encoding catA ^opt in the recombinant vector for muconic acid production. Or, it may be arranged in a polynucleotide, the polynucleotide encoding order of the polynucleotide and coding for the aroY asbF ^{opt opt} encoding a catA ^opt.

Specifically, Escherichia coli used as an embodiment of the present invention coli ) is a gram-negative aerobic bacterium that is non-toxic and has the advantage of being very fast and easy and inexpensive to grow in laboratories and industrial sites. However, since there are no genes capable of synthesizing muconic acid in Escherichia coli, it is necessary to introduce a foreign gene to produce muconic acid. Therefore, the present invention pays attention to the synthesis of 3-DHS (3-dehydroshikimate) in the aromatic amino acid biosynthesis pathway in the E. coli metabolic pathway, and asbF, aroY and catA , respectively , are required for biosynthesis of muconic acid from 3-DHS. The coding gene was introduced. In one embodiment, the muconic acid is cis-cis-muconic acid (cis-muconic acid, CCM), the metabolic pathway from the 3-DHS to cis-cis muconic acid is shown in FIG. As shown in Figure 1, the carbohydrate metabolic pathway of Escherichia coli has a pathway for biosynthesis of the aromatic amino acids phenylalanine (Phenylalanine, Phe), Tyrosine (Tyr), tryptophan (Tryptophan, Try). In this case, 3-DHS (3-dehydroshikimate), an intermediate, can be used as a muconic acid precursor, as mentioned above. Do. That is, 3-DHS dehydratase (3-DHS dehydratase) coding asbF, PCA decarboxylation aroY, catechol 1,2-oxygenated enzyme (catechol 1,2-dioxygenase) encoding the enzyme (protocatechuic acid decarboxylase) to the Is catA coding. With the introduction of these three foreign genes, it is possible to synthesize muconic acid from 3-DHS via PCA and catechol.

Therefore, the embodiments of the present invention, in order to improve the muconic acid production capacity by increasing the expression rate in E. coli in introducing the three kinds of foreign genes in E. coli, the asbF , aroY And a polynucleotide encoding a catA one of asbF ^opt nucleotide sequence transformed into the E. coli codon, the polynucleotide encoding the aroY ^opt and Synthesize a polynucleotide encoding catA ^opt . And ribosomal binding sites of the first polynucleotide to be transcribed, including the three polynucleotides and a ribosome binding site derived from E. coli upstream of each of the three polynucleotides. It can be prepared with a recombinant vector comprising a promoter upstream of). In one embodiment, the polynucleotide encoding the asbF ^opt comprises SEQ ID NO: 1, the polynucleotide encoding aroY ^opt comprises SEQ ID NO: 2, the polynucleotide encoding catA ^opt is SEQ ID NO: It may include. The ribosomal binding site may comprise SEQ ID NO: 4. One embodiment provides a host cell transformed with the recombinant vector prepared as described above, and provides E. coli comprising the host cell.

This leads to asbF ^opt , aroY ^opt and E. coli according to an embodiment of the present invention comprising catA ^opt includes each of the three foreign genes as a single operon structure, thereby asbF ^opt , aroY ^opt and Transcription amount of each polynucleotide encoding catA ^opt is implemented as 0.9-1.1: 0.9-1.1: 0.9-1.1.

The three types of polynucleotides are 3-DHS dehydratase, PCA decarboxylase, catechol 1,2-oxygenase, 3-DHS dehydratase. dioxygenase) efficiently expressed. As another embodiment of the invention the asbF of the three genes Genes Klebsiella pneumonia , Acinetobacter sp , Podospore anserine Or asbF from Bacillus thuringiensis , aroY Genes Klebsiella pneumonia , Sedimentibacter hydroxybenzoicus or Enterobacter cloacae origin of aroY, catA Genes Burkholderia xenovorans, Acinetobacter calcoaceticus Acinetobacter calcoaceticus, or you can use the catA of origin.

In addition, as an embodiment of the present invention, the E. coli is E. coli AB2834 (purchase institution), the aro E gene (SEQ ID NO: 5) is missing for the accumulation of 3-DHS, the aro E enzyme activity is lost. E. coli Genetic Stock Center, Accession No. AB2834). The areE gene is a gene encoding 3-DHS dehydratase, which converts DHS (3-dehydroshikimic acid) to SA (shikimic acid), and when the aroE gene is deleted, DHS blocks SA conversion, thereby preventing DHS from producing aromatic amino acids. By blocking the use, metabolic flow can be shifted towards muconic acid biosynthesis, so that the E. coli lacking the areE gene can further increase the biosynthesis efficiency of muconic acid. In addition, when the biosynthesis of aromatic amino acids is blocked, metabolic flow to muconic acid biosynthesis occurs due to the release of inhibition of inhibition of PEP (phosphoenolpyruvate) and E4P (erythrose-4-phosphate) conversion to DAHP. It is smooth. However, since the aromatic amino acid is not synthesized due to the deletion of the aroE gene, it is necessary to add the aromatic amino acid to the culture medium. At this time, if the excess aromatic amino acid is added, feedback inhibition occurs again.

Another embodiment of the present invention is a method for producing a polynucleotide mu conic acid production for E. coli as described above, encoding the asbF ^opt the vector, the polynucleotide encoding the aroY ^opt and preparing a recombinant vector by inserting a polynucleotide encoding catA ^opt and inserting a ribosomal binding site (RBS) derived from E. coli in an upstream direction of the three polynucleotides, and the recombinant vector It provides a method for producing a recombinant Escherichia coli for the production of muconic acid comprising the step of transforming by introducing into the E. coli strain strain. In one embodiment, the step of preparing the recombinant vector may further include inserting a promoter upstream of the ribosomal binding site (rbs) of the polynucleotide to be transcribed first of the three polynucleotides. Can be.

In one embodiment the polynucleotide to be transferred first of the three polynucleotides and polynucleotides encoding the polynucleotides, encoding the aroY ^{opt opt} asbF Any one selected from among polynucleotides encoding catA ^opt , and the insertion and arrangement order of the three polynucleotides is not limited to the order in which the genes are described. For example, the three genes are polynucleotides encoding the polynucleotides, encoding the aroY asbF ^{opt opt} in a recombinant vector for the production of MU-conic acid and The polynucleotides encoding catA ^opt may be arranged in order. Or, it may be arranged in a polynucleotide, the polynucleotide encoding order of the polynucleotide and coding for the aroY asbF ^{opt opt} encoding a catA ^opt.

As above, asbF ^opt , aroY ^opt and When the ribosome binding site (RBS) derived from E. coli is added in the upstream direction of each polynucleotide encoding catA ^opt , each of the foreign genes is prepared in the form of a single operon, thereby reducing the amount of transcription of each gene from 0.9 to 1.1: 0.9 to 1.1: The same can be achieved with 0.9 to 1.1.

In one embodiment step Xba I restriction enzyme (SEQ ID NO: 6) in front of the ribosome binding site added to the polynucleotide encoding an asbF ^opt for synthesis of the E. coli recombinant vector of the method for producing the recombinant mutant microorganism, the catA ^opt The method may further include adding Hind III restriction enzyme (SEQ ID NO: 7) sites after the encoding polynucleotide. In addition, as an embodiment, the vector may be used as a plasmid, and specifically, any plasmid having Xba I and Hind III restriction enzyme sites and corresponding to the promoter direction may be used without limitation.

In another embodiment, the vector may use a vector from which a lac promoter-derived lacZα gene has been removed. In one embodiment, the lac promoter-derived lacZα gene may include SEQ ID NO: 8. The vector from which the lacZα gene has been removed removes only the lacZα gene and uses the promoter portion as it is, so that the lac repressor binds to the lac operator. Therefore, in order to express asbF ^opt , aroY ^opt and catA ^opt , it is necessary to introduce IPTG (Isopropyl β-D-1-thiogalactopyranoside) to induce gene expression, and during the process, glucose is depleted or Maintains high productivity.

The present invention can produce an optimal foreign gene group expression-regulated operon system for the production of synthetic biological muconic acid in E. coli, ultimately by producing E. coli for the production of muconic acid through the above production method.

Hereinafter, the present invention will be described in detail with reference to production examples and test examples of the present invention. These are only presented by way of example only to more specifically describe the present invention, it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these preparation and test examples. .

[Production example]

Recombinant Escherichia coli microorganism according to an embodiment of the present invention was prepared according to the following method.

Microorganisms Used, Medium and Culture Conditions

Escherichia coli microorganisms for muconic acid synthesis were purchased from E. coli Genetic Stock Center of Yale University as E. coli AB2834 (see Table 1 and Table 2 below).

Microbe ( E. coli ) characteristic AB2834 aroE Defective E. coli AB2834 / pUC18 △ lacZ (comparative example) AB2834 containing pUC18 △ lacZ AB2834 / pMESK1 (Example) AB2834 with pMESK1

Vector (plasmid) characteristic pUC18 △ lacZ lacZ α deletion pUC18 pMESK1 pUC18 △ lac with asbF ^opt , aroY ^opt , catA ^opt

First, E. coli DH5α (purchased from TaKaRa, purchase number: 9057) was used as the mother microorganism in the production of the recombinant plasmid. All Escherichia coli microorganisms were shaken at 37 ° C and 220rpm, and 1L LB (Luria-Bertani) liquid medium (containing 10.0g of Baktotrypton, 5.0g of Bakto yeast extract, 10.0g of NaCl) and 1L of M9 liquid medium (Na ₂ 6.8 g of HPO ₄ , 3.0 g of KH ₂ PO ₄ , 0.5 g of NaCl, and 1.0 g of NH ₄ Cl were sterilized in 980 ml of primary water, followed by 20 ml of sterilized 20% glucose, 100 µl of 1M CaCl ₂ , and ₂ ml of 1M MgSO _4. L-try, L-phe, L-tyr and shikimate were added each 0.04 g). Ampicillin (Ap) used as an antibiotic was added to the medium at a final concentration of 50 mg / L. Isopropyl-β-D-thiogalactopyranoside (IPTG) was prepared in a 0.5M stock state. IPTG was used during induction to control the promoter, and IPTG was inducted every 0.5 hours at 0.5 mM after 36 hours of inoculation. Amino acid, shikimic acid, ampicillin, IPTG, and 20% glucose dissolved in tertiary distilled water were all sterilized using a 0.25 μm membrane.

pUC18 △ lacZ  Preparation of the plasmid

For the preparation of the pUC18 plasmid from which the lacZ α gene (SEQ ID NO: 8) was removed, a pair of primers (SEQ ID NOs: 9 and 10) in the opposite direction based on the lacZ α gene were prepared and used for PCR.

pUC18_lac_forward: 5'-agctgtttcctg tctaga aattgttatc-3 '(SEQ ID NO: 9),

pUC18_lac_reverse: 5'-tt aagctt gccccgacacccgccaac-3 '(SEQ ID NO: 10)

Underlined sequences of the two nucleotide sequences are Xba I and Hind III restriction enzymes (SEQ ID NOs: 6 and 7), respectively.

PCR consisted of 10 μl of 5 × Phusion HF buffer, 0.2 mM dNTPs, 0.5 μM of the above pUC18ΔlacZ forward and pUC18ΔlacZ reverse primers, 3% DMSO, 0.25 μl of pUC18 plasmid with 50 μl final volume. The prepared mixture was carried out in a C1000 Thermal Cycler (BIO-RAD). At this time, the PCR method is as follows: Step 1: 98 ℃ 30 seconds, Step 2: 98 ℃ 10 seconds, 60 ℃ 30 seconds, 72 ℃ 1 minute 30 seconds (30 repetitions), Step 3: 72 ℃ 10 minutes.

PCR products were identified by electrophoresis on 1% (w / v) agarose gel, and then purified using a PCR purification kit, and then self-ligation using T4 lagase (Takara). . The ligated vector was constructed after confirming the pUC18ΔlacZ sequencing primer (5'-ttggccgattcattaatgcag-3 ', SEQ ID NO: 11) (Macrogen, Korea).

AB2834 Of pMESK1  Escherichia coli ( Example Manufacturing

In order to prepare AB2834 / pMESK1 Escherichia coli (Example), asbF , K. pneumonia from B. thuringiensis were first searched through a database search. By screening by the aroY, Acinetobacter calcoaceticus derived catA of the derived optimized E. coli codon, asbF ^opt (SEQ ID NO: 1), aroY ^opt (SEQ ID NO: 2) And Polynucleotides encoding catA ^opt (SEQ ID NO: 3) were synthesized. Subsequently, E. coli-derived ribosomal binding sites (RBS, SEQ ID NO: 4) were added to each upstream of the polynucleotide and then cloned using Xba I and Hind III restriction sites in the pUC57 plasmid (Cosmo genetech, Korea). ). Finally, asbF ^opt and aroY ^opt synthesized in pUC18ΔlacZ plasmid. And Gene fragments containing the polynucleotide and ribosomal binding sites encoding catA ^opt , respectively, were cloned into Xba I, Hind III restriction site (see FIG. 2) to prepare pMESK1 plasmid.

Table 3 below shows the nucleotide sequences of the prepared pMESK1 plasmid (SEQ ID NO: 32).

This plasmid was transformed into E. coli AB2834 to prepare AB2834 / pMESK1 (Example, Accession No .: KCCM11505P), that is, Escherichia coli for muconic acid production according to the present invention.

AB2834 Of pUC18 △ lacZ  ( Comparative example Manufacturing

The pUC18ΔlacZ plasmid prepared above was transformed into E. coli AB2834 to prepare AB2834 / pUC18ΔlacZ (Comparative Example).

 [Test Example 1]

Production curves and metabolites (muconic acid and muconic acid precursors) of the recombinant E. coli prepared in the above preparation were analyzed as follows.

First, the Comparative Example (AB2834 / pUC18 ΔlacZ) and Example (AB2834 / pMESK1) incubated in 250ml flask and then incubated in both 50ml M9 medium and LB medium and sampled at regular intervals to grow each microorganism HPLC analysis of curves and metabolites was performed.

Specifically, 1 ml of the collected culture solution was centrifuged at 13000 rpm for 5 minutes to separate cells, and the supernatant was filtered through a 0.25 μm membrane filter and used for analysis. Biosynthesized cis, cis-muconic acid (CCM) and precursors were separated-analyzed by HPLC (High Performance Liquid Chromatography), column used was Aminex HPX-87H, mobile phase was 5 mM H ₂ SO ₄ , flow rate 0.6 mL / L, Assay temperature was performed at 65 ° C. (FRC-10A, SHIMADZU). UV detection was performed in PCA (259 nm), 3-DHS (237 nm), catechol (275 nm), CCM (262 nm). Standards used for quantitative analysis (PCA, 3-DHS, Catechol, CCM: Sigma) were each dissolved in distilled water and filtered through a 0.25 μm membrane.

OD ₆₀₀ As a result of analyzing the growth curve based on the values, it was confirmed that the comparative example (AB2834 / pUC18ΔlacZ), which is the control microorganism containing only the empty vector, reached the exponential phase faster than the example (AB2834 / pMESK1) in both media. It was. The highest OD ₆₀₀ values were higher in both LB medium and the 0.5 mM IPTG induction time performed at stationary phase also showed faster LB medium.

Then, as a result of confirming that muconic acid is produced, it was confirmed that the Example (AB2834 / pMESK1) produced 9.5 mg / L of muconic acid in 3.5 mg / L in LB medium and M9 medium (see FIG. 3). In addition, as a result of confirming the production of muconic acid in a 3L fermenter, in the case of Example (AB2834 / pMESK1), 7.7 g / L of muconic acid, 0.3 g / L of 3-DHS, and 0.2 g / L of PCA were produced after 72 hours of culture, respectively. Until this time, the production rate of muconic acid is kept constant, so it is expected that the production of muconic acid will continue to increase if culture continues (see FIG. 4).

[Test Example 2]

In Example (AB2834 / pMESK1) prepared in the preparation example according to an embodiment of the present invention, the expression patterns of the three foreign genes introduced and the existing aromatic amino acid biosynthetic pathway genes, that is, muconic acid biosynthetic pathway gene RT-PCR was performed as follows for confirmation of their transcription.

First, AB2834 / pMESK1 (Example) transformed with pMESK1 plasmid was pre-incubated in 5 ml LB medium and inoculated at 1/100 in 50 ml M9 medium, followed by 0.5 mM IPTG induction after 23 hours, and culture medium after 3 hours. After centrifugation for 5 minutes at 1300rpm, the cells were disrupted with a RNase-treated sterilized mortar. RNA was isolated using RNeasy Mini Kit (Qiagen), cDNA synthesis was synthesized using PrimeScript 1 ^ST strand cDNA Synthesis Kit (Takara). RT-PCR was prepared by mixing 20 μl of final volume with 2 μl of 10 × buffer, 0.25 mM dNTPs, 0.4 μM of each pair of primers (see Table 4 below), 10% DMSO, and 1 μl of synthesized cDNA. The thermal cycler (BIO-RAD) was performed. RT-PCR conditions are as follows: Step 1: 95 ° C. 15 minutes, Step 2: 95 ° C. 45 seconds, 60 ° C. 45 seconds, 72 ° C. 40 seconds (30 repetitions), Step 3: 72 ° C. 10 minutes. PCR products were confirmed by electrophoresis on 2% (w / v) agarose gel (see Figure 5).

SEQ ID NO: primer Sequence (5 '-> 3') Target ^a 11 pUC18_lac_sequencing ttggccgattcattaatgcag Plasmid pUC18_lac 12 pUC18_lac_F agctgtttcctgtctagaaattgttatc Plasmid pUC18 13 pUC18_lac_R ttaagcttgccccgacacccgccaac Plasmid pUC18 14 aroB_RT-PCR_F TGTCGTTACTCTCGGGGAAC 15 aroB_RT-PCR_R CCGCGGACCTTATCGAGATA 16 aroD_RT-PCR_F CCGAAGAAATCATTGCCCGT 17 aroD_RT-PCR_R TCACCAGCCAGACGAGAAAT 18 aroF_RT-PCR_F CTGAAGGCCGCTTTTCCATT 19 aroF_RT-PCR_R TTCCAGAGCAGTTTCCGGAT 20 aroG_RT-PCR_F CTGACGTTTGCCAGCAGATT 21 aroG_RT-PCR_R TGACGTAACAGAGCATCGGT 22 aroH_RT-PCR_F AAACCACGAACTGTTGTCGG Strain AB2834 / pMESK1 cDNA 23 aroH_RT-PCR_R CCGGTCACCATATCGAGGAA Strain AB2834 / pMESK1 cDNA 24 asbF_RT-PCR_F TCCTGCATATTTGGGAAAGC Strain AB2834 / pMESK1 cDNA 25 asbF_RT-PCR_R ATGCCCTCAAACAGTGGAAC 26 aroY_RT-PCR_F ATCCTGTGGGCTATGACGAC 27 aroY_RT-PCR_R GGTGCAGTCGAAAATGGTTT 28 catA_RT-PCR_F TATTTCACCGATGCTGGTCA 29 catA_RT-PCR_R ATACAGCGGACCTTCAATGG 30 GAPDH_RT-PCR_F TTTCCGTGCTGCTCAGAAAC 31 GAPDH_RT-PCR_R GTCAACACCAACTTCGTCCC

The housekeeping gene used as a control for the comparison of transcriptional expression was GAPDH (D-glyceraldehyde-3-phosphate dehydrogenase) and 1,3-D-glyceraldehyde-3-phosphate (D-glyceraldehyde-3-phosphate). It is an enzyme that converts to 1,3-phosphoglycerate and is an important enzyme involved in glycolysis and glucose neosynthesis. Housekeeping genes such as GAPDH are used as control genes when performing quantitative RT-PCR because they are always expressed in all cells without regulation. As a result of RT-PCR analysis, asbF ^opt , aroY ^opt , and catA ^opt genes cloned into high copy number vectors as shown in FIG. 5 showed higher expression levels when compared to GAPDH. . While the gene of the aromatic amino acid biosynthetic pathway (aroB, aroD, aroF, aroG , aroH) showed a relatively very low expression level as. Especially aroD , aroG Genes were difficult to visually identify in the expression level observed by 2% (w / v) agarose gel electrophoresis. This microorganism is E. coli AB2834 is due to the loss of the aroE gene cultured aromatic amino acid, phenylalanine gave put in a culture medium, tyrosine, the three kinds of DAHP synthase by tryptophan AroF, AroG, AroH the feedback inhibition with (feedback inhibition) The genes are expected to be restricted at the transcription level. Therefore, the synthesis of DHQ synthase AroB and DHQ dehydratase AroD , which is the next step, is also restricted due to the restriction on the transcription of the DAHP synthase gene, which is the early stage of muconic acid synthesis, and thus negatively affects the production of muconic acid and intermediates. It is expected.

Three kinds of foreign genes in the nucleotide sequence of a synthetic codon optimized for E. coli (polynucleotide) asbF ^opt, aroY ^opt, the introduction of catA ^opt, in the mu-conic acid flask culture in recombinant E. coli has been removed the aroE 9.5mg / L and 3L Fermenter cultures produced 7.7 g / L, respectively. It synthesizes three foreign genes asbF , aroY , and catA into polynucleotides optimized for E. coli codons, and introduces ribosomal binding sites (RBS) before each gene into a single operon structure of high copy number vectors. By introducing, it means that an efficient expression system that can express three foreign genes at the same time is built. In addition, it is possible to maintain the same level of expression of the three foreign genes as well as to maximize the expression of the three foreign genes at the same time. The three introduced genes efficiently express their respective enzymes, 3-DHS dehydratase, PCA protocatechuic acid decarboxylase, and catechol 1,2-dioxygenase. Ultimately, muconic acid could be efficiently biosynthesized from recombinant E. coli with aroE removal for 3-DHS accumulation.

Korea Microorganism Conservation Center (overseas) KCCM11505P 20140110

<110> STR Biotech Co., Ltd. <120> Microorganism for producing muconic acid and method for          manufacturing the strain <130> 13P555IND <160> 32 <170> KopatentIn 2.0 <210> 1 <211> 843 <212> DNA <213> Artificial Sequence <220> <223> optimized asbF (3-dehydroshikimate dehydratase) <400> 1 atgaaatact ccctgtgcac tattagcttc cgtcatcaac tgatttcttt cactgacatc 60 gttcagttcg cgtacgaaaa cggttttgaa ggcatcgagc tgtggggtac tcatgcccag 120 aacctgtaca tgcaggagcg tgaaaccacc gagcgtgagc tgaacttcct gaaagataag 180 aacctggaaa tcaccatgat ctctgactac ctggatattt ccctgtccgc cgacttcgag 240 aaaaccattg aaaaatccga acagctggtg gtgctggcaa actggttcaa caccaacaag 300 atccgtacct ttgcgggcca gaaaggtagc aaggactttt ctgaacagga acgtaaagag 360 tacgtaaagc gcatccgtaa aatctgcgac gtttttgcac agcataacat gtacgtcctg 420 ctggaaactc atccgaacac cctgaccgac actctgccta gcaccattga actgctggaa 480 gaagtgaacc atccaaacct gaaaatcaac ctggatttcc tgcatatttg ggaaagcggc 540 gcgaatccaa tcgactcttt ccatcgcctg aaaccgtgga ctctgcacta ccatttcaaa 600 aacatctcct ccgcggatta cctgcacgtg ttcgaaccga ataacgtcta cgccgctgca 660 ggctcccgta ttggtatggt tccactgttt gagggcatcg ttaactacga cgaaatcatt 720 caagaagttc gtggcaccga cctgtttgct tctctggaat ggttcggcca caactctaaa 780 gagatcctga aggaagaaat gaaagtgctg atcaaccgta aactggaagt ggtgacgagc 840 tga 843 <210> 2 <211> 1509 <212> DNA <213> Artificial Sequence <220> <223> optimized aroY (protocatechuate decarboxylase) <400> 2 atgactgcac caatccagga cctgcgcgac gcaatcgctc tgctgcaaca gcacgataac 60 cagtatctgg aaaccgatca cccagttgac ccgaatgcgg agctggcagg cgtctaccgt 120 catattggtg ccggtggcac tgttaaacgc ccgacccgca tcggcccagc aatgatgttt 180 aacaacatca aaggctaccc gcacagccgc atcctggtag gcatgcacgc ttctcgtcaa 240 cgtgcggcac tgctgctggg ctgtgaagca tctcagctgg ctctggaggt gggcaaggcc 300 gtcaaaaagc cggtggcgcc ggttgttgtt ccggcatctt ccgctccttg ccaggaacag 360 attttcctgg ccgatgatcc ggacttcgac ctgcgtacgc tgctgccggc tcacacgaac 420 actccgatcg acgcgggtcc gtttttctgc ctgggtctgg ctctggcgtc tgacccggtg 480 gatgcgagcc tgaccgacgt gaccatccac cgcctgtgcg ttcagggtcg tgacgaactg 540 agcatgttcc tggcagcagg tcgtcacatt gaagtattcc gccaaaaagc ggaagccgcc 600 ggtaaaccgc tgcctattac catcaacatg ggtctggacc cggcgatcta catcggcgct 660 tgctttgaag cacctacgac tccgttcggt tacaacgaac tgggtgtagc cggtgctctg 720 cgccagcgtc cggtggaact ggtacagggc gtgagcgtcc cagaaaaagc catcgcacgc 780 gctgaaatcg taatcgaagg cgaactgctg ccgggcgtcc gcgttcgtga agaccagcac 840 accaacagcg gtcacgcaat gcctgaattc ccgggctact gtggcggtgc caacccgtcc 900 ctgccggtta ttaaggttaa agctgttact atgcgtaaca acgcgattct gcagactctg 960 gtcggtccgg gtgaggaaca cacgaccctg gcgggcctgc cgactgaagc ctctatttgg 1020 aatgcggttg aagcagccat cccgggcttc ctgcagaatg tttacgctca taccgcgggt 1080 ggcggtaaat tcctgggtat cctgcaggtt aaaaagcgcc agccggcaga tgaaggtcgc 1140 caaggtcagg ctgccctgct ggcgctggct acctactctg aactgaaaaa catcattctg 1200 gttgacgaag atgtcgatat ctttgattcc gacgacatcc tgtgggctat gacgactcgt 1260 atgcagggcg atgtttctat caccaccatc ccgggcatcc gtggtcacca gctggacccg 1320 tcccagactc cggaatattc cccgagcatc cgcggcaacg gcatctcctg taaaaccatt 1380 ttcgactgca ccgttccgtg ggctctgaaa tcccacttcg agcgtgcgcc gtttgcggac 1440 gttgatccgc gtccgttcgc accggagtat ttcgctcgtc tggagaaaaa tcagggttcc 1500 gcgaaataa 1509 <210> 3 <211> 923 <212> DNA <213> Artificial Sequence <220> <223> optimized catA (catechol 1,2-dioxygenase) <400> 3 atgaaccgtc agcagatcga cgcgctggtt aaacagatga acgtggatac cgctaagggc 60 gaagttgacg ctcgcgtaca gcagattgta gtacgtctgc tgggtgacct gttccaggca 120 atcgaagatc tggatattca gccgtctgaa gtgtggaaag gtctggagta tttcaccgat 180 gctggtcagg cgaacgaact gggtctgctg gcggccggtc tgggcctgga gcactatctg 240 gacctgcgtg cggatgaagc agatgcaaaa gcaggtgtga ccggtggtac tccgcgtacc 300 attgaaggtc cgctgtatgt tgcaggtgct ccggaaagcg ttggtttcgc gcgtatggat 360 gacggtactg aatctggtaa aatcgatact ctgatcattg aaggcaccgt caccgacacc 420 gacggtaata tcatcgaaaa cgctaaagta gaggtttggc acgcgaactc tctgggcaac 480 tattctttct ttgataaatc ccagtccgac ttcaacctgc gtcgtaccat tctgaccgat 540 gcggacggta aatatgttgc gctgacgacg atgccagtag gctatggctg tccgccggaa 600 ggtaccaccc aagcgctgct gaacaaactg ggtcgccacg gtaaccgtcc ttctcacgta 660 cactatttcg tgtctgctcc gggctaccgt aaactgacga cccaattcaa tatcgagggt 720 gacgaatacc tgtgggatga tttcgctttt gctacccgtg atggtctggt ggcgaccgcg 780 gtagacgtga ccgatccagc tgaaatccag cgtcgcggcc tggatcacgc ttttaaacac 840 atcaccttca acattgaact ggttaaagat gcagccgcgg cacctagcac tgaggtagaa 900 cgccgtcgtg cgtccgctta att 923 <210> 4 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> ribosome binding site <400> 4 gaagga 6 <210> 5 <211> 819 <212> DNA <213> aroE (shikimate dehydrogenase) <400> 5 atggaaacct atgctgtttt tggtaatccg atagcccaca gcaaatcgcc attcattcat 60 cagcaatttg ctcagcaact gaatattgaa catccctatg ggcgcgtgtt ggcacccatc 120 aatgatttca tcaacacact gaacgctttc tttagtgctg gtggtaaagg tgcgaatgtg 180 acggtgcctt ttaaagaaga ggcttttgcc agagcggatg agcttactga acgggcagcg 240 ttggctggtg ctgttaatac cctcatgcgg ttagaagatg gacgcctgct gggtgacaat 300 accgatggtg taggcttgtt aagcgatctg gaacgtctgt cttttatccg ccctggttta 360 cgtattctgc ttatcggcgc tggtggagca tctcgcggcg tactactgcc actcctttcc 420 ctggactgtg cggtgacaat aactaatcgg acggtatccc gcgcggaaga gttggctaaa 480 ttgtttgcgc acactggcag tattcaggcg ttgagtatgg acgaactgga aggtcatgag 540 tttgatctca ttattaatgc aacatccagt ggcatcagtg gtgatattcc ggcgatcccg 600 tcatcgctca ttcatccagg catttattgc tatgacatgt tctatcagaa aggaaaaact 660 ccttttctgg catggtgtga gcagcgaggc tcaaagcgta atgctgatgg tttaggaatg 720 ctggtggcac aggcggctca tgcctttctt ctctggcacg gtgttctgcc tgacgtagaa 780 ccagttataa agcaattgca ggaggaattg tccgcgtga 819 <210> 6 <211> 6 <212> DNA <213> XbaI restrction enzyme <400> 6 tctaga 6 <210> 7 <211> 6 <212> DNA <213> HindIII restriction enzyme <400> 7 aagctt 6 <210> 8 <211> 324 <212> DNA <213> Artificial Sequence <220> <223> lacZ-alpha which codes for the N-terminus fragment of          beta-galactosidase <400> 8 atgaccatga ttacgaattc gagctcggta cccggggatc ctctagagtc gacctgcagg 60 catgcaagct tggcactggc cgtcgtttta caacgtcgtg actgggaaaa ccctggcgtt 120 acccaactta atcgccttgc agcacatccc cctttcgcca gctggcgtaa tagcgaagag 180 gcccgcaccg atcgcccttc ccaacagttg cgcagcctga atggcgaatg gcgcctgatg 240 cggtattttc tccttacgca tctgtgcggt atttcacacc gcatatggtg cactctcagt 300 acaatctgct ctgatgccgc atag 324 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> pUC18_lacZ forward primer <400> 9 agctgtttcc tgtctagaaa ttgttatc 28 <210> 10 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> pUC18_lacZ reverse primer <400> 10 ttaagcttgc cccgacaccc gccaac 26 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> pUC18_lacZ sequencing primer <400> 11 ttggccgatt cattaatgca g 21 <210> 12 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> pUC18_lacZ_Forward primer tageting plasmid pUC18 <400> 12 agctgtttcc tgtctagaaa ttgttatc 28 <210> 13 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> pUC18_lacZ_Reverse primer tageting plasmid pUC18 <400> 13 ttaagcttgc cccgacaccc gccaac 26 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> aroB_RT-PCR_Forward primer <400> 14 tgtcgttact ctcggggaac 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> aroB_RT-PCR_Reverse primer <400> 15 ccgcggacct tatcgagata 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> aroD_RT-PCR_Forward primer <400> 16 ccgaagaaat cattgcccgt 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> aroD_RT-PCR_Reverse primer <400> 17 tcaccagcca gacgagaaat 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> aroF_RT-PCR_Forward primer <400> 18 ctgaaggccg cttttccatt 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> aroF_RT-PCR_Reverse primer <400> 19 ttccagagca gtttccggat 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> aroG_RT-PCR_Forward primer <400> 20 ctgacgtttg ccagcagatt 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> aroG_RT-PCR_Reverse primer <400> 21 tgacgtaaca gagcatcggt 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> aroH_RT-PCR_Forward primer <400> 22 aaaccacgaa ctgttgtcgg 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> aroH_RT-PCR_Reverse primer <400> 23 ccggtcacca tatcgaggaa 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> asbF_RT-PCR_Forward primer <400> 24 tcctgcatat ttgggaaagc 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> asbF_RT-PCR_Reverse primer <400> 25 atgccctcaa acagtggaac 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> aroY_RT-PCR_Forward primer <400> 26 atcctgtggg ctatgacgac 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> aroY_RT-PCR_Reverse primer <400> 27 ggtgcagtcg aaaatggttt 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> catA_RT-PCR_Forward primer <400> 28 tatttcaccg atgctggtca 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> catA_RT-PCR_Reverse primer <400> 29 atacagcgga ccttcaatgg 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_RT-PCR_Forward primer <400> 30 tttccgtgct gctcagaaac 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_RT-PCR_Reverse primer <400> 31 gtcaacacca acttcgtccc 20 <210> 32 <211> 5732 <212> DNA <213> Artificial Sequence <220> <223> pMESK1_plasmid sequences <400> 32 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60 cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180 aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240 ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300 ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360 tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420 tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480 actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540 gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600 acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660 gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720 acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780 gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840 ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900 gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960 cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020 agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080 catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140 tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260 gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320 taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 1380 ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440 tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560 cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620 agctttgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980 cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040 cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100 acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160 cggctcgtat gttgtgtgga attgtgagcg gataacaatt tctagaaata attttgttta 2220 actttaagaa ggagatatac atatgaaata ctccctgtgc actattagct tccgtcatca 2280 actgatttct ttcactgaca tcgttcagtt cgcgtacgaa aacggttttg aaggcatcga 2340 gctgtggggt actcatgccc agaacctgta catgcaggag cgtgaaacca ccgagcgtga 2400 gctgaacttc ctgaaagata agaacctgga aatcaccatg atctctgact acctggatat 2460 ttccctgtcc gccgacttcg agaaaaccat tgaaaaatcc gaacagctgg tggtgctggc 2520 aaactggttc aacaccaaca agatccgtac ctttgcgggc cagaaaggta gcaaggactt 2580 ttctgaacag gaacgtaaag agtacgtaaa gcgcatccgt aaaatctgcg acgtttttgc 2640 acagcataac atgtacgtcc tgctggaaac tcatccgaac accctgaccg acactctgcc 2700 tagcaccatt gaactgctgg aagaagtgaa ccatccaaac ctgaaaatca acctggattt 2760 cctgcatatt tgggaaagcg gcgcgaatcc aatcgactct ttccatcgcc tgaaaccgtg 2820 gactctgcac taccatttca aaaacatctc ctccgcggat tacctgcacg tgttcgaacc 2880 gaataacgtc tacgccgctg caggctcccg tattggtatg gttccactgt ttgagggcat 2940 cgttaactac gacgaaatca ttcaagaagt tcgtggcacc gacctgtttg cttctctgga 3000 atggttcggc cacaactcta aagagatcct gaaggaagaa atgaaagtgc tgatcaaccg 3060 taaactggaa gtggtgacga gctgaaataa ttttgtttaa ctttaagaag gagatataca 3120 tatgactgca ccaatccagg acctgcgcga cgcaatcgct ctgctgcaac agcacgataa 3180 ccagtatctg gaaaccgatc acccagttga cccgaatgcg gagctggcag gcgtctaccg 3240 tcatattggt gccggtggca ctgttaaacg cccgacccgc atcggcccag caatgatgtt 3300 taacaacatc aaaggctacc cgcacagccg catcctggta ggcatgcacg cttctcgtca 3360 acgtgcggca ctgctgctgg gctgtgaagc atctcagctg gctctggagg tgggcaaggc 3420 cgtcaaaaag ccggtggcgc cggttgttgt tccggcatct tccgctcctt gccaggaaca 3480 gattttcctg gccgatgatc cggacttcga cctgcgtacg ctgctgccgg ctcacacgaa 3540 cactccgatc gacgcgggtc cgtttttctg cctgggtctg gctctggcgt ctgacccggt 3600 ggatgcgagc ctgaccgacg tgaccatcca ccgcctgtgc gttcagggtc gtgacgaact 3660 gagcatgttc ctggcagcag gtcgtcacat tgaagtattc cgccaaaaag cggaagccgc 3720 cggtaaaccg ctgcctatta ccatcaacat gggtctggac ccggcgatct acatcggcgc 3780 ttgctttgaa gcacctacga ctccgttcgg ttacaacgaa ctgggtgtag ccggtgctct 3840 gcgccagcgt ccggtggaac tggtacaggg cgtgagcgtc ccagaaaaag ccatcgcacg 3900 cgctgaaatc gtaatcgaag gcgaactgct gccgggcgtc cgcgttcgtg aagaccagca 3960 caccaacagc ggtcacgcaa tgcctgaatt cccgggctac tgtggcggtg ccaacccgtc 4020 cctgccggtt attaaggtta aagctgttac tatgcgtaac aacgcgattc tgcagactct 4080 ggtcggtccg ggtgaggaac acacgaccct ggcgggcctg ccgactgaag cctctatttg 4140 gaatgcggtt gaagcagcca tcccgggctt cctgcagaat gtttacgctc ataccgcggg 4200 tggcggtaaa ttcctgggta tcctgcaggt taaaaagcgc cagccggcag atgaaggtcg 4260 ccaaggtcag gctgccctgc tggcgctggc tacctactct gaactgaaaa acatcattct 4320 ggttgacgaa gatgtcgata tctttgattc cgacgacatc ctgtgggcta tgacgactcg 4380 tatgcagggc gatgtttcta tcaccaccat cccgggcatc cgtggtcacc agctggaccc 4440 gtcccagact ccggaatatt ccccgagcat ccgcggcaac ggcatctcct gtaaaaccat 4500 tttcgactgc accgttccgt gggctctgaa atcccacttc gagcgtgcgc cgtttgcgga 4560 cgttgatccg cgtccgttcg caccggagta tttcgctcgt ctggagaaaa atcagggttc 4620 cgcgaaataa aataattttg tttaacttta agaaggagat atacatatga accgtcagca 4680 gatcgacgcg ctggttaaac agatgaacgt ggataccgct aagggcgaag ttgacgctcg 4740 cgtacagcag attgtagtac gtctgctggg tgacctgttc caggcaatcg aagatctgga 4800 tattcagccg tctgaagtgt ggaaaggtct ggagtatttc accgatgctg gtcaggcgaa 4860 cgaactgggt ctgctggcgg ccggtctggg cctggagcac tatctggacc tgcgtgcgga 4920 tgaagcagat gcaaaagcag gtgtgaccgg tggtactccg cgtaccattg aaggtccgct 4980 gtatgttgca ggtgctccgg aaagcgttgg tttcgcgcgt atggatgacg gtactgaatc 5040 tggtaaaatc gatactctga tcattgaagg caccgtcacc gacaccgacg gtaatatcat 5100 cgaaaacgct aaagtagagg tttggcacgc gaactctctg ggcaactatt ctttctttga 5160 taaatcccag tccgacttca acctgcgtcg taccattctg accgatgcgg acggtaaata 5220 tgttgcgctg acgacgatgc cagtaggcta tggctgtccg ccggaaggta ccacccaagc 5280 gctgctgaac aaactgggtc gccacggtaa ccgtccttct cacgtacact atttcgtgtc 5340 tgctccgggc taccgtaaac tgacgaccca attcaatatc gagggtgacg aatacctgtg 5400 ggatgatttc gcttttgcta cccgtgatgg tctggtggcg accgcggtag acgtgaccga 5460 tccagctgaa atccagcgtc gcggcctgga tcacgctttt aaacacatca ccttcaacat 5520 tgaactggtt aaagatgcag ccgcggcacc tagcactgag gtagaacgcc gtcgtgcgtc 5580 cgcttaatta agcttgcccc gacacccgcc aacacccgct gacgcgccct gacgggcttg 5640 tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct gcatgtgtca 5700 gaggttttca ccgtcatcac cgaaacgcgc ga 5732

Claims (14)

As Escherichia coli transformed with a recombinant vector for producing muconic acid,
The recombinant vector for producing muconic acid,
encoding the asbF ^opt polynucleotide, a polynucleotide encoding the polynucleotide and coding for the aroY catA ^{opt opt;}
A ribosome binding site (rbs) derived from E. coli located upstream of each of the three polynucleotides; And
And a promoter located upstream of the ribosomal binding site (rbs) of the first transcribed polynucleotide of the three polynucleotides.
The Escherichia coli is E. coli for the production of muconic acid, the amount of transcription of each polynucleotide encoding the asbF ^opt , aroY ^opt and catA ^opt is 0.9 ~ 1.1: 0.9 ~ 1.1: 0.9 ~ 1.1. The E. coli for muconic acid production according to claim 1, wherein the polynucleotide encoding asbF ^opt comprises SEQ ID NO: 1. The E. coli for muconic acid production according to claim 1, wherein the polynucleotide encoding aroY ^opt comprises SEQ ID NO: 2. The E. coli for muconic acid production according to claim 1, wherein the polynucleotide encoding catA ^opt comprises SEQ ID NO. According to claim 1, wherein the ribosome binding site E. coli muconic acid production comprising SEQ ID NO: 4. delete delete The Escherichia coli of claim 1, wherein the E. coli is deficient in a polynucleotide (SEQ ID NO: 5) encoding aroE . delete As a method of producing E. coli for the production of muconic acid,
Encoding the asbF ^opt the vector polynucleotide, aroY insert a polynucleotide encoding the polynucleotide and catA ^opt encoding ^opt and binding ribosomes of the E. coli derived upstream (upstream) direction of the three polynucleotide region (ribosome binding site inserting rbs) to prepare recombinant vectors; And
Introducing and transforming the recombinant vector into E. coli microorganisms;
Including;
The vector is a method of producing Escherichia coli for the production of muconic acid is a vector from which the lac promoter-derived lacZα gene is removed. The method of claim 10, wherein the E. coli mother microorganism is E. coli lacking a polynucleotide encoding SEQ ID NO: 5 (SEQ ID NO: 5). delete The method of claim 10, wherein the lac promoter-derived lacZα gene removed from the vector comprises a SEQ ID NO: 8. The method of claim 10, wherein preparing the recombinant vector further comprises inserting a promoter upstream of the ribosomal binding site (rbs) of the polynucleotide to be transcribed first of the three polynucleotides. Method for producing E. coli for producing muconic acid.

Images