KR101030547B1 - A plasmid shuttle vector - Google Patents

Abstract

The present invention relates to a novel lactic acid bacterium vector, specifically a plasmid comprising a replication origin protein sequence having a nucleotide sequence of SEQ ID NO: 1 and a nucleotide sequence of SEQ ID NO: 3 and a nucleotide sequence of SEQ ID NO: 1 The present invention relates to a shuttle vector prepared by linking a plasmid containing a replication initiation protein gene having a replication origin and a nucleotide sequence of SEQ ID NO: 3 with an E. coli derived vector. The plasmid of the present invention is stably introduced and replicated in Lactobacillus pentosus as a RCR type (RCR type) vector isolated from Lactobacillus pentosus, a lactic acid bacterium having excellent antimicrobial activity and intestinal adhesion to microorganisms. In addition, the lactic acid bacteria can be used for expression of the desired external genes and useful genes, and the intestinal adhesion of the lactic acid bacteria can be maintained even after the gene introduction, thereby expressing useful external genes for the lactic acid bacteria that can be used as probiotic. As it can be used as a backbone vector, applications are expected in various industries.

Lactobacillus, plasmid, RCR vector, shuttle vector

Description

Plasmid shuttle vector {A PLASMID SHUTTLE VECTOR}

The present invention relates to a plasmid isolated from lactic acid bacteria, specifically, Lactobacillus pentosus, and an E. coli-lactic acid bacteria shuttle vector plasmid prepared by linking the plasmid and E. coli derived vector.

Lactic acid bacteria are bacteria that ferment sugars to produce more than 50% lactic acid, which is the most beneficial microorganism available to humans. It is widely distributed in the natural world such as the oral cavity, digestive tract, and soil of mammals as well as food, and it is a beneficial strain for human life that plays an important role related to food preservation and sensory characteristics. Lactic acid bacteria, widely used as foods as fermented foods containing lactic acid bacteria for a long time, have recently been recognized as stability as GRAS (Generally Recognized As Safe) microorganisms.

Based on the stability of lactic acid bacteria and the recognition that lactic acid bacteria are good for health, efforts to maintain health and prevent diseases have been increased through foods containing lactic acid bacteria. Biotic lactic acid bacteria are being researched extensively worldwide.

Probiotic lactic acid bacteria should not only be recognized for their stability in origin and use, but also under acidic conditions in the upper gastrointestinal tract and in the presence of bile, should be able to adhere to the large intestine, and should have excellent strain stability or viability. Probiotic lactic acid bacteria, which are satisfying the above requirements is the most Lactobacillus genus strains (Lactobacillus sp.) And Bifidobacterium strain (Bifidobacterium strain).

On the other hand, Kimchi is a food that can be manufactured by anyone at home without any special knowledge. More specifically, Kimchi is Korea's representative traditional fermented food that has been developed since the Three Kingdoms period. It is one of the representative Korean fermented foods that are aged through the fermentation process by microorganisms that exist around the living environment by mixing spices such as garlic and garlic.

Recently, a number of studies on the usefulness of kimchi have been published. For example, as physiological activities such as immune activity enhancement and anti-cancer effects have been revealed, it is recognized as a food necessary for maintaining health as well as nutrient supply, and soaking fresh vegetables without heat treatment. Therefore, it is reported that the content of lactic acid bacteria is higher than that of fermented milk products because all nutrients of vegetables are maintained to provide a good habitat for lactic acid bacteria.

The research on the lactic acid bacteria has been mainly conducted for dairy products, and the systematic and scientific researches on lactic acid bacteria involved in kimchi foot effect tablets have been conducted recently compared to the long history.

In accordance with the research trend as described above, in recent years, as a microorganism isolated from kimchi and the study of lactic acid bacteria satisfying the conditions of probiotic lactic acid bacteria, the need for research on the gene expression system using the lactic acid bacteria has emerged.

Among these studies, a recent research interest is to produce a large amount of high value-added substances beneficial to the human body using microorganisms, especially GRAS microorganisms, lactic acid bacteria, specifically expressing new genes that express specific genes in lactic acid bacteria. It is about the system.

The gene expression system using the lactic acid bacteria is to develop lactic acid bacteria having a new function in addition to the original characteristics of lactic acid bacteria, the introduction of the foreign gene safely into the lactic acid bacteria, that is, the research for transformation.

Conjugation method or protoplast method, which was used early in the transformation of lactic acid bacteria, has not only low transfection efficiency but also has a problem of time consuming and poor reproducibility. In order to solve this problem, an electropoartion using a plasmid has been proposed. In order to perform the transformation using the electroporation method, an essential element is a carrier capable of delivering a foreign gene, that is, a vector.

Therefore, in relation to a new gene expression system for expressing a specific gene in lactic acid bacteria, research on the vector available for lactic acid bacteria is actively progressing. In particular, in order to solve the problems related to replication stability, in order to perform stable replication in E. coli, the development of lactic acid bacteria vectors capable of producing shuttle vectors that can be replicated in E. coli and vector systems using shuttle vectors and shuttle vectors using the same The need for research is emerging.

An object of the present invention is to provide a plasmid usable for lactic acid bacteria.

In addition, an object of the present invention is to provide a shuttle vector prepared by connecting a plasmid available for lactic acid bacteria and E. coli derived vector.

In order to achieve the above object, the present invention provides a plasmid comprising a replication initiation protein (Rep protein) gene having an origin of replication (Ori) having a nucleotide sequence of SEQ ID NO: 1 and a nucleotide sequence of SEQ ID NO: 3 to provide.

In addition, the present invention provides a shuttle vector prepared by connecting a plasmid and E. coli derived vector comprising a replication origin protein (Ori) having a nucleotide sequence of SEQ ID NO: 1 and a replication initiation protein gene having a nucleotide sequence of SEQ ID NO: to provide.

The present invention also provides a transformant transformed with the shuttle vector.

Hereinafter, the present invention will be described in detail.

The inventor of the present invention, while studying a gene expression system that can safely introduce and express the foreign genes in lactic acid bacteria isolated from fermented foods, especially kimchi, which is a traditional Korean food, is separated from kimchi and excellent intestinal adhesion It can be used as an activator, and RCR-type plasmid of the size that can be used as a shuttle vector from the strain belonging to Lactobacillus pentosus ( Lactobacillus pentosus ), which has excellent antibacterial activity against harmful microorganisms, induces the release of cytokines and enhances immunity P1-4, which is a rolling-circle replication type plasmid and RCR type plasmid, was isolated, and after analyzing the replication form of the plasmid p1-4, a shuttle vector recombinant with an E. coli derived vector was prepared. , Lactobacillus pentosus strain which is a suitable lactic acid bacteria host cell for transformation using the shuttle vector By introducing a shuttle vector, it is possible to stably transform, and in particular, when transforming to the strain that separated the plasmid, it is possible to stably transform and confirm that development of a host / vector system is possible. The present invention was completed.

In the present invention, "plasmid" has the same meaning as is commonly known in the technical field to which the present invention belongs, that is to say cyclic non-chromosomal elements present in bacteria. Preparation of Plasmids, Plasmids Those skilled in the art to transfer and bind DNA, transform, and the like can use known methods, which methods are described in, for example, Sambrook, J. et. al ., 'Molecular Cloning: A Laboratory Manual, Second Edition', Cold Spring Harbor Laboratory Press (1989).

The present invention provides a plasmid isolated from Lactobacillus pentosus .

The plasmid is a novel plasmid isolated from Lactobacillus pentosus that has not been reported so far, named p1-4. The plasmid p1-4 is 2,424bp, the G + C content is 38.2%, and the ORF (Open Reading Frame) that is expected to be expressed according to the size of the amino acid expressed includes three types, ORF1, ORF2 and ORF3. The plasmid p1-4, compared with the previously reported plasmid based on the entire 2,424 sequence, Pediococcus It was found that there was 51% similarity with pF8801 of damnosus, and 96% similarity among the 51% similarities.

The plasmid of the present invention may be a plasmid including a replication origin having a nucleotide sequence of SEQ ID NO: 1 and a replication initiation protein gene having a nucleotide sequence of SEQ ID NO: 3. The plasmid may be derived from Lactobacillus pentosus F121-1 ( Lactobacillus pentosus F121-1 KFCC 11417P) with Lactobacillus pentosus , preferably with accession number KFCC 11417P. In addition, the plasmid is a plasmid comprising a replication origin (Ori) having a nucleotide sequence of SEQ ID NO: 1, a replication initiation protein gene having a nucleotide sequence of SEQ ID NO: 3 and a replication initiation protein gene having a nucleotide sequence of SEQ ID NO: 5, or a sequence Origin of replication (Ori) having a nucleotide sequence of No. 1, a replication initiation protein gene having a nucleotide sequence of SEQ ID NO: 3, a replication initiation protein gene having a nucleotide sequence of SEQ ID NO: 5, and a replication initiation protein having a nucleotide sequence of SEQ ID NO: 7 It may be a plasmid containing a gene. In addition, the plasmid may be preferably a plasmid having a nucleotide sequence of SEQ ID NO: 9.

In addition, the plasmid is a plasmid comprising a replication origin (Ori) having a nucleotide sequence of SEQ ID NO: 1, a replication origin (Ori) having a nucleotide sequence of SEQ ID NO: 2 and a replication initiation protein gene having a nucleotide sequence of SEQ ID NO: 3 Can be. In addition, the plasmid has a replication origin (Ori) having a nucleotide sequence of SEQ ID NO: 1, a replication origin (Ori) having a nucleotide sequence of SEQ ID NO: 2, a replication initiation protein gene having a nucleotide sequence of SEQ ID NO: 3, and A plasmid containing a replication initiating protein gene having a nucleotide sequence, or a replication origin having an nucleotide sequence of SEQ ID NO: 1, an replication origin having an nucleotide sequence of SEQ ID NO: 2, an replication having an nucleotide sequence of SEQ ID NO: 3 It may be a plasmid comprising an initiation protein gene, a replication initiation protein gene having a nucleotide sequence of SEQ ID NO: 5, and a replication initiation protein gene having a nucleotide sequence of SEQ ID NO: 7.

The origin of replication (Ori) having the nucleotide sequence of SEQ ID NO: 1 consists of 13 nucleotides having the sequence of 5'-TATCAAGATAAGA-3 ', and in the reverse-complement nucleotide sequence, the nick is formed at the Guanine-Adenine bond. It may be the point where replication of the plus-DNA strand in the sequence begins. In addition, the replication origin (Ori) having the nucleotide sequence of SEQ ID NO: 2 consists of 10 nucleotides having the sequence of 5'-TAGATAGTCT-3 ', and may be the point where the replication of the minus-DNA strand in the nucleotide sequence starts. have.

In addition, the replication initiation protein gene having the nucleotide sequence of SEQ ID NO: 3 is named ORF1 of p1-4, ORF1 of p1-4 has a nucleotide sequence of 855bp, the sequence consisting of 285 amino acid (acid) It encodes a protein having an amino acid sequence of No. 4, and has a genetic association with a previously reported replication initiation protein, and has been identified as a gene encoding a protein that functions as a replication initiation protein.

The protein gene having the nucleotide sequence of SEQ ID NO: 5 is named ORF2 of the p1-4, ORF2 of p1-4 has a nucleotide sequence of 270bp, a protein having an amino acid sequence of SEQ ID NO: 6 consisting of 90 amino acids It is expected to be a gene that encodes a protein that functions as a transcriptional regulator because of its genetic association with transcriptional regulators.

The protein gene having a nucleotide sequence of SEQ ID NO: 7 is named ORF3 of p1-4, and the ORF3 of p1-4 has a 225 nucleotide sequence and has an amino acid sequence of SEQ ID NO: 8 consisting of 75 amino acids Encrypt

In addition, the present invention relates to a vector including a multiple cloning site (MCS) and a selection marker, in addition to the plasmid. The vector may be a cloning vector. In addition, the cloning vector may further include a replication origin and a promoter of E. coli in addition to the plasmid, MCS and the selection marker. The plasmid may be a plasmid comprising a replication origin protein having a replication origin having a nucleotide sequence of SEQ ID NO: 1 and a nucleotide sequence of SEQ ID NO: 3, and further having a nucleotide sequence of SEQ ID NO: 2 Starting point, the protein gene having a nucleotide sequence of SEQ ID NO: 5 and the protein gene having a nucleotide sequence of SEQ ID NO: 7 may further include one or more selected from the group consisting of. Each of the binding is a start of replication protein gene having a nucleotide sequence of SEQ ID NO: 3 in the 5 'to 3' direction from the origin of replication of SEQ ID NO: 1, a protein gene having a nucleotide sequence of SEQ ID NO: 7, the origin of replication of SEQ ID NO: 2 and Protein gene having the nucleotide sequence of SEQ ID NO: 5 may be combined in order.

The cloning vector is capable of stably replicating and expressing foreign genes in lactobacillus pentosus isolated from lactic acid bacteria, in particular, kimchi, and fermentation of transformants or kimchi for adding functionality to fermented foods, especially lactic acid bacteria. It is very useful to manufacture a gene expression system using lactic acid bacteria to add functionality to food, it can be useful also for the improvement of probiotics industrially.

The MCS refers to a DNA fragment having a site that is recognized and cleaved by various restriction enzymes, that is, a restriction site, and the site of the cleaved MCS because the MCS is recognized and cleaved by a specific restriction enzyme. Enable insertion of the target gene in The MCS may be used without limitation as long as it is known to those skilled in the art to which the present invention belongs, various vectors known in the art belonging to the present invention having MCS, preferably E. coli vectors, One example may be derived from pUC18 or pUC19.

In addition, the selection marker (selection marker) means a gene that can select whether the gene is cloned, that is, whether the vector is inserted into the host cell or transformed, and for drug resistance, nutritional requirements, cytotoxic agents, etc. It may be a gene that confers a selectable phenotype, such as resistance or expression of surface proteins. The selection marker may be, for example, glycolytic enzymes such as amylase, porphyranase, antibiotic resistance genes, chromogenic enzyme genes, or luminescent / fluorescent genes, but in the art to which the present invention pertains. Various genes known as selection markers can be used. The selection marker may be derived from various vectors known in the art to which the present invention pertains, preferably for E. coli vectors, for example pUC18 or pUC19.

The amylase may be alpha-amylase, for example, alpha-amylase having an amino acid sequence of SEQ ID NO: 10, and the popiranase may be a popiranase encoded by the gene sequence of SEQ ID NO: 11. have. In addition, the selection marker may be a gene construct further comprising a promoter having a specific promoter or a promoter construct of a specific promoter and a signal peptide, for example, a sequence having SEQ ID NO: 29 in the gene sequence of SEQ ID NO: 10.

The antibiotic resistance gene may be an erythromycin resistance gene, neomycin resistance gene, hygromycin resistance gene, ampicillin resistance gene, kanamycin resistance gene, chloramphenicol acetyl transferase gene, and the like, but is not limited thereto. May be a gene.

The chromogenic enzyme gene may be a β-galactosidase gene or a β-glucuronidase (GUS) gene and the like, but is not limited thereto. The light emitting gene may be a luciferase gene or the like, and the fluorescent gene may be a BFP gene, a CFP gene, a GFP gene, a YFP gene, an RFP gene, or the like, but is not limited thereto.

In addition, the present invention connects a plasmid containing a replication initiation protein (Rep protein) gene having an origin of replication (Ori) having a nucleotide sequence of SEQ ID NO. It relates to the prepared shuttle vector.

The plasmid comprising a replication origin protein sequence having a nucleotide sequence of SEQ ID NO: 1 and a replication initiation protein gene having a nucleotide sequence of SEQ ID NO: 3 further has a replication origin having a nucleotide sequence of SEQ ID NO: 2, a nucleotide sequence of SEQ ID NO: 5 It may further include one or more selected from the group consisting of a protein gene and a protein gene having a nucleotide sequence of SEQ ID NO: 7.

The shuttle vector is a replication origin having a nucleotide sequence of SEQ ID NO: 1; A replication initiation protein gene having the nucleotide sequence of SEQ ID NO: 3; MCS; And E. coli-derived vectors including a selection marker and an E. coli replication origin and a promoter, the shuttle vector has both a replication origin of Lactobacillus and an origin of replication of E. coli, thereby allowing mutual replication in Lactobacillus and E. coli. The replication origin and promoter of E. coli may be E. coli-derived replication origin and E. coli-derived promoter. In addition, the shuttle vector may further comprise E. coli-derived replication initiation protein. Therefore, the shuttle vector can mass-reproduce and express genes of interest in Lactobacillus and Escherichia coli.

The shuttle vector of the present invention is prepared by directly inserting the replication origin of E. coli and the nucleotide sequence of a promoter into a plasmid containing a replication origin having the nucleotide sequence of SEQ ID NO: 1 and a replication initiation protein gene having the nucleotide sequence of SEQ ID NO: 3 Alternatively, it may be prepared by linking a plasmid containing a replication origin having the nucleotide sequence of SEQ ID NO: 1 and a replication initiation protein gene having the nucleotide sequence of SEQ ID NO: 3 with an E. coli derived vector. The shuttle vector may be a shuttle vector capable of replicating both Escherichia coli and lactic acid bacteria.

The E. coli vector refers to E. coli-derived vectors or vectors capable of replicating in E. coli, E. coli-derived transformation vectors known to those of ordinary skill in the art, for example, pUC18 and pUC19, but It is not limited.

The origin of replication of E. coli may be a replication origin contained in E. coli-derived transformation vector known to those skilled in the art. Since the base sequence of the origin of replication of E. coli is known to those of ordinary skill in the art to which the present invention belongs, those of ordinary skill in the art to which the present invention belongs to the known origin of replication of E. coli Can easily be inserted into the shuttle vector.

For the replication origin of E. coli and insertion of a promoter or binding to E. coli-derived vectors, a plasmid containing a replication origin having the nucleotide sequence of SEQ ID NO. 1 and a replication initiation protein gene having the nucleotide sequence of SEQ ID NO. Enzyme-derived transformation vector or E. coli-derived transformation vector obtained by cutting with enzyme and then produced with linear plasmid DNA, and containing the origin and promoter of replication of E. coli obtained by cutting with the restriction enzyme and genetic engineering method (eg can be manufactured by ligation.

E. coli replication origin and the base sequence of the promoter is directly inserted into the plasmid containing the replication origin having the nucleotide sequence of SEQ ID NO: 1 and the replication initiation protein gene having the nucleotide sequence of SEQ ID NO: 3, or the base of SEQ ID NO: 1 A recombinant shuttle vector is prepared by linking a plasmid containing a replication origin protein having a replication origin having a sequence and a replication initiation protein gene having the nucleotide sequence of SEQ ID NO: 3 with a Escherichia coli derived vector or a transformant using the recombinant shuttle vector. Method for preparing can be carried out by a method known to those of ordinary skill in the art including the method described in US Pat. No. 5,688,683 described in relation to the lactic acid bacteria-derived shuttle vector.

The shuttle vector, specifically the shuttle vector for expression in lactic acid bacteria and E. coli, more specifically the shuttle vector for expression in Lactobacillus pentosus and E. coli is used for the replication and / or timing of expression of the target gene in lactic acid and E. coli will be. The Lactobacillus pentosus is Lactobacillus F121-1 ( Lactobacillus) having accession number KFCC 11417P pentosus F121-1 KFCC 11417P). When the shuttle vector is inserted into the Lactobacillus pentosus F121-1, despite the inclusion of an RCR-type vector-derived replication origin and replication initiation protein, the transformation is maintained stably and thus, a host / vector (host / vector) The advantage is that it can be used as a system.

A plasmid comprising a replication origin having the nucleotide sequence of SEQ ID NO: 1 and a replication initiation protein gene having the nucleotide sequence of SEQ ID NO: 3, or a replication origin having the nucleotide sequence of SEQ ID NO: 1, and a nucleotide sequence of SEQ ID NO: 3 A gene of interest may be inserted into a shuttle vector prepared by connecting a plasmid containing a replication initiation protein gene having a coliform vector derived from E. coli. Therefore, the present invention provides a recombinant vector in which the target gene is inserted into the plasmid or shuttle vector.

In the present invention, the term "target gene" refers to a gene to be cloned in lactic acid bacteria or a gene to be expressed in a specific host cell.

The gene of interest may be inserted into the MCS present in the plasmid or shuttle vector of the present invention. For example, the target gene may be PCR amplified with a primer containing a restriction enzyme sequence so as to be inserted into the MCS of each vector, and then inserted into the MCS of a cloning vector or shuttle vector cut with the restriction enzyme and cut with the restriction enzyme. .

The gene of interest may be operably linked to a promoter. By “operably linked” is meant that one nucleic acid fragment is combined with another nucleic acid fragment so that its function or expression is affected by the other nucleic acid fragment. That is, the gene of interest may be linked so that its expression can be controlled by a promoter in the vector.

The gene of interest means all genes capable of transforming lactic acid bacteria, and more specifically, may be genes capable of enhancing activity, function, and / or usefulness as probiotics of lactic acid bacteria corresponding to host cells of transformation.

In particular, since the plasmid of the present invention is isolated from lactic acid bacteria isolated from kimchi, the plasmid of the present invention and the vectors prepared by using the same are foods containing fermented foods, such as kimchi, preferably for enhancing immunity, growth, and disease of humans. A target gene included in a functional food including a food which can perform prevention and the like and which can impart or improve such functionality can be used as the target gene of the present invention.

Examples of medical, industrially useful target genes that can be inserted into the plasmid or shuttle vector of the invention, specifically the MCS region of the plasmid or shuttle vector, include hormones, cytokines, enzymes, coagulation factors, transport proteins, receptors, regulatory proteins, There are genes encoding structural proteins, transcription factors, antigens, antibodies and the like.

In addition, an expression control sequence may be further included in the plasmid or shuttle vector of the present invention in addition to a promoter to control expression of a gene of interest. "Expression control sequence" refers to a DNA sequence that controls the expression of a nucleic acid sequence operably linked in a particular host cell. In addition, the expression control sequence may include any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence for controlling termination of transcription and translation, in addition to a promoter for initiating transcription. It includes one or more selected from the group consisting of.

Specifically, the shuttle vector may be a shuttle vector prepared by linking pUC18 with a plasmid containing a replication origin having the nucleotide sequence of SEQ ID NO: 1 and a replication initiation protein gene having the nucleotide sequence of SEQ ID NO: 3, and preferably May be a shuttle vector having SEQ ID NO: 12.

The shuttle vector may be capable of mutual replication in Escherichia coli and Lactobacillus pentosus, and may have a cleavage map as described in FIGS. 9 and 10, and more specifically, the shuttle vector may be represented by SEQ ID NO: 12 to SEQ ID NO: 17. It may be a shuttle vector having any one sequence selected from the group consisting of.

In addition, the present invention may be a recombinant vector in which the target gene is inserted into the shuttle vector. The gene of interest may preferably be inserted into the MCS region of the shuttle vector.

The present invention also provides a transformant transformed from a host cell with the vector, shuttle vector or recombinant shuttle vector inserted with the target gene in the shuttle vector.

The host cell of the transformant may be a bacterium, and the bacterium may be E. coli or lactic acid bacteria. The Escherichia coli may be a common Escherichia coli used for the preparation of a transformant, and the lactic acid bacteria may be preferably a Lactobacillus pentosus strain, and for example, the Lactobacillus pentosus may have a Lactobacillus pento having accession number KFCC 11417P. Sus F121-1 ( Lactobacillus pentosus F121-1 KFCC 11417P).

The transformed bacteria can be usefully used for mass production of proteins expressed from genes of interest. Thus, the transformed bacteria can be cultured to obtain the desired protein mass produced from the culture.

The present invention also relates to a method for producing a transformant comprising introducing the recombinant vector into a bacterium.

The bacterium is preferably E. coli or lactic acid bacteria.

The step of introducing the recombinant vector into the bacteria is a method known in the art, such as, but not limited to, a heat shock method (heat shock method, calcium phosphate precipitation method, electroporation, gene gun ( gene gun) and other known methods for introducing DNA into cells.

The invention may also be a host / vector system. In the present invention, the host / vector system refers to a system capable of converting a specific trait by an inserted vector while maintaining the activity and properties of the strain used as the host. The host / vector system consists of a strain to be transformed and a vector to be introduced into the strain.

The vector has a replication origin having a nucleotide sequence of SEQ ID NO: 1; Replication initiating protein having a nucleotide sequence of SEQ ID NO: 3; a replication origin having a nucleotide sequence of SEQ ID NO: 1 or a vector comprising a multiple cloning site and a selection marker; A replication initiation protein gene having the nucleotide sequence of SEQ ID NO: 3; multiple cloning site; Selectable markers; E. coli derived origin of replication; And E. coli-derived promoter, and can be a vector that is a shuttle vector capable of mutual replication in lactic acid and E. coli. The shuttle vector may be, for example, a vector which is a shuttle vector having any one nucleotide sequence selected from the group consisting of SEQ ID NO: 12 to SEQ ID NO: 17.

The host or strain may be a lactic acid bacterium, preferably Lactobacillus pentosus strain, more preferably Lactobacillus pentosus F121-1 having accession number KFCC 11417P.

As described above, the plasmid according to the present invention can be stably replicated and expressed in lactobacillus, specifically, Lactobacillus pentosus, which has been recognized as stability of GRAS (Generally Recognized As Safe) microorganisms, and the shuttle vector according to the present invention is E. coli. It can be stably expressed in both lactic acid bacteria and lactic acid bacteria, and can be applied to the development of gene expression system using lactic acid bacteria and probiotics using the same. The use value will be very large.

Hereinafter, examples of the present invention will be described. The following examples are only for illustrating the present invention and the present invention is not limited to the following examples.

Example 1 Screening and Identification of Strains

Of the 341 microorganisms isolated from Kimchi, microorganisms that were found to be usable as probiotic agents were separated because of excellent intestinal adhesion. Each of the isolated microorganisms was inoculated in 5 ml of MRS (Difco aboratories, Detroit, Mich., USA) liquid medium and incubated at 30 ° C. for 18 hours to separate plasmid DNA, and the isolated plasmid DNA was 1.0% agarose ( Cambrex BioScience Rockland, Inc., ME, USA) gels were electrophoresed to confirm the presence and size of plasmid DNA.

As a result, Lactobacillus pentosus F121-1 ( Lactobacillus Lactobacillus Lactobacillus Lactobacillus spp. pentosus F121-1) was selected, and the results of analyzing the plasmid DNA of the Lactobacillus pentosus F121-1 are shown in FIG. 2. 2 shows the results of treatment of the plasmid possessed by Lactobacillus pentosus F121-1 and the plasmid with various restriction enzymes, of which about 2.0 kb or less was named p1-4.

<Example 2> Lb. pentosus Analysis of Plasmid P1-4 Isolated from F121-1

Example 2-1. Lb. peptosus Isolation of p1-4 from F121-1

Lb isolated in Example 1 . peptosus F121-1 was incubated for 18 hours using an MRS liquid medium so that the OD ₆₀₀ value was about 0.8 at 30 ° C. 5 ml of the lactic acid bacteria culture solution was centrifuged (11,900 × g, 3 min) to remove the culture supernatant, and the remaining pellet was washed twice with PBS (pH 7.4). The washed pellet was suspended in 250 μl of a resuspension solution (Quiagen Co., Germany) to which lysozyme (30 mg / ml) was added and treated at 37 ° C. for 1 hour. Thereafter, the separation step was performed according to the kit manual using a QIAprepSpin miniprep kit (QIAGEN Inc., Germany).

Example 2-2. analysis of p1-4

As shown in FIG. 2, Nco I (1462 bp), Hpa I (1676 bp), Hind III (1316 bp and 2180 bp), and Hinc II (410, 1676 and 1730 bp) were obtained by treating the isolated plasmid p1-4 with various restriction enzymes. ), EcoR I (241 bp and 1248 bp) and Dra I (763 bp, 1065 bp, 1164 bp and 1316 bp). PUC -4 treated with restriction enzyme Hpa I to form a single cleavage was inserted into pUC18, an E. coli vector treated with Sma I, using T4 DNA ligase (TaKaRa) to prepare pUC1-4. The base sequence was determined by requesting from Gent (Korea), and the results are shown in FIGS. 3 and 4. DNA and protein homology assays, ORF assays and restriction enzyme locations are available from the NCBI BLAST (http://www.ncbi.nlm.nih.gov/) program, the pDRAW32 program, the HITACHI software Engineering Co. Janpan (DNASIS) program, and the Bioinformatics. (http://www.bioinformatics.org/sms2/index.html), and alignment and phylogenetic analysis were performed using the CLUSTAL W2 program, and the results are shown in FIGS. 3, 5 to 8, and tables. 1 is shown. In addition, mfold program (http://mobyle.pasteur.fr/cgi-bin/MobylePortal/portal.py?form=mfold) was used to confirm the repeating structure of the nucleotide sequence, and the plasmid map configuration was PlasMapper (http: //wishart.biology.ualberta.ca/PlasMapper/index.html).

As a result of nucleotide sequence analysis of p1-4 using NCBI program and DNASIS program, total base sequence was 2,424bp, G + C content was 38.2%, and three ORFs (open reading frames) were expected to be identified. It was confirmed that it is a rolling-circle replication type (RCR type) plasmid with two origins of origin (origin, Ori). The ORF was named ORF1, ORF2 and ORF3 depending on the size of the amino acid expressed.

As confirmed in FIG. 5, the plasmid p1-4 has 51% similarity to pF8801 of Pediococcus damnosus , which was found to have the highest similarity when compared to the previously reported plasmid based on the total 2,424 sequences. It was confirmed that there was 96% consensus among the 51% similarities, indicating that the plasmid was completely different from that of other microorganisms previously reported.

3 and 4, the positive replication origin (Ori (+)), that is, the double stranded origin, is the sequence of 5′-TATCAAGATAAGA-3 ′ (SEQ ID NO: 1). It consists of 13 nucleotides having a nucleotide sequence of, and it is predicted that it is the point where the replication of the plus-DNA strand in the nucleotide sequence starts as nick is formed in the Guanine-Adenine bond among the reverse-complement sequences.

3 and 4, the minus origin (Ori (-)), that is, the single stranded origin is 5'-TAGATAGTCT-3 'sequence (SEQ ID NO: It consists of 10 nucleotides having a nucleotide sequence of 2), and was predicted as the starting point of replication of the minus-DNA strand in the nucleotide sequence.

3 and 4, the replication initiation protein gene has a nucleotide sequence of SEQ ID NO: 3, named ORF1 of p1-4, and ORF1 of p1-4 has a 855 bp sequence. , Encoding a protein having an amino acid sequence of SEQ ID NO: 4 consisting of 285 amino acid acids, and was identified as a gene encoding a protein that functions as a replication initiating protein.

In addition, the second replication initiation protein gene was identified as having a nucleotide sequence of SEQ ID NO: 5, named ORF2 of p1-4, ORF2 of p1-4 has a nucleotide sequence of 270bp, a sequence consisting of 90 amino acids It encodes a protein having the amino acid sequence of No. 6 and is genetically related to a transcriptional regulator among the replication initiation proteins reported so far, and has been identified as a gene encoding a protein that functions as a transcriptional regulator. .

The second replication initiation protein gene was identified as having the nucleotide sequence of SEQ ID NO: 7, named ORF3 of p1-4, ORF3 of p1-4 has a 225bp base sequence, consisting of 75 amino acids A protein having an amino acid sequence of No. 8 was encoded, and the protein was found to have no nucleotide sequence association with a replication initiation protein reported so far or a protein reported so far.

From the above results, Lactobacillus The plasmid p1-4, derived from pentosus F121-1, was identified as an RCR-type plasmid derived from a new Lactobacillus pentosus that is unknown to date.

Example 3 LAB- E. coli  Shuttle Vector

In lactic acid bacteria vector gene is inserted in E. coli shuttle vector LAB- construction was carried out by the method of Fig. 9 and 10 using the plasmid p1-4 below 3 kb of Lactobacillus pentosus F121-1 in Example 2-2 . More specifically, the p1-4 was subjected to 1.0% agarose gel electrophoresis, and then p1-4 was isolated and cut into Hpa I using a gel elution kit (Quiagen, Germany. & Geneclean II, MP Biomedicals, France). E. coli expression vector pUC18 was digested with Sma I, and then p1-4 were combined overnight at 4 ° C using a rapid ligation kit (Roche, German) or T4 DNA ligase (3 unit / μL). E. coli TG1 (pUC1-4) was screened in white colonies by X-gal (Promega, USA) in LB (ampicillin 50 μg / mL) solid medium by transformation. Em ^R gene was used as a template (template) pIL2530α using primers Emr-F (SEQ ID NO: 18) and Emr-R (SEQ ID NO: 19) shown in Table 2 below, and PCR was performed using Taq polymerase (Takara co.). . The PCR was performed using a MJ mini personal thermal cycler (BioRad, USA), the PCR was pre-denaturation (95 ℃ / 5 minutes), denaturation (95 ℃ / 1 minutes), annealing (55 ℃ / 1 minutes) 30 seconds), elongation (72 ° C / 1 min) five times, denaturation (95 ° C / 30 sec), annealing (55 ° C / 30 sec) and elongation (72 ° C / 1 min) 5 minutes at 72 ℃ for elongation was carried out by cooling to 4 ℃. The PCR product was purified using PCR quick spin (Intron, Korea), ligation to pGem-T easy vector (Promega, USA), and transformed to prepare E. coli TG1 (pGemem). PGemem was isolated from E. coli TG1 (pGemem) prepared by the transformation, cleaved with EcoR I, and gel elution to obtain an Em ^R gene. Em ^R gene obtained above was inserted into pUC1-4, and pEm1-4, which is pEm containing p1-4, was recovered by E. coli transformation. In addition, as a template for performing PCR, that is, the α-amylase of pTA322 and the porphyranase of pPOR3 were used as transfer genes, and the amplification of the two kinds of genes was performed using Pfu- polymerase (Solgent Co., South Korea). The primers 322F (SEQ ID NO: 20) and 322R (SEQ ID NO: 21), primer POR-F (SEQ ID NO: 22), and POR-R (SEQ ID NO: 23) of Table 2 were used, respectively. After the pre-denaturation (95 ℃ / 5 minutes), the PCR was repeated 5 times denaturation (95 ℃ / 1 minute), annealing (55 ℃ / 1 minute 30 seconds) and elongation (72 ℃ / 2 minutes), denaturation (95 ° C./30 sec), annealing (55 ° C./1 min) and elongation (72 ° C./2 min.) For 30 times, followed by 5 minutes at 72 ° C. and cooling to 4 ° C. for final elongation. Was performed. And the PCR product was T4 DNA polynucleotide kinase (Koschemco., Republic of Korea) and 10 mM ATP (Sigma, USA) to 5 'end by phosphorylation to processing, direct bonding (ligation) to the pEm1-4 digested with Hinc Ⅱ, About 7.8 kb of pEm1-4α including pEm1-4 including α-amylase and about 7.9 kb of pEm1-4por including pEm1-4 including porphyranase were prepared. E. coli was transformed using the α-amylase-inserted pEm1-4α in the same manner as above to incubate in LB (ampicillin 50μg / mL, erythromycin 200μg / mL) solid medium, and the transparent ring around the colony by iodine reaction E. coli transformed by the above method using pEm1-4por, which is pEm1-4 containing porphyranase, decomposed agar to check whether the periphery was pitted, Pain colonies were selected as transformed.

pEm1-4αp is a promoter of PrtB (proteinase B) of Lactobacillus delbrueckii. Synthesized.

PEm1-4α w / op F (SEQ ID NO: 24) and R (SEQ ID NO: 25) of the pEm1-4α except for the portion corresponding to the promoter of the α-amylase gene and the ORF starting point except for the PstI site. PCR was carried out, and then conjugated with the synthesized gene. The pEm1-4epα was PCR using Em w / o ORF F (SEQ ID NO: 26) and R (SEQ ID NO: 27) of Table 2 to exclude only the ORF of the Em resistance gene inserted into pEm, α PCR was performed using α-ORF F (SEQ ID NO: 28) and 322-R (SEQ ID NO: 21) of Table 2, using pTA322 as a template for ORF of -amylase. The amplified two genes were blunt ligation, and colonies showing α-amylase activity in LB (erythromycin 200 μg / mL) medium were selected and named pUCepα. The manufacturing cost pUCepα as a template (template) Emr F (SEQ ID NO: 18) and 322-R using (SEQ ID NO: 21) by performing a PCR to amplify the epα-amylase, conjugated to a pEm1-4 digested with Hinc Ⅱ ( pEm1-4epα was prepared by blunt-ligation.

Prime name Primer sequence (5 ′ → 3 ′) SEQ ID NO: Emr-f CGGTTCGTGTTCGTGCTGACTTGCA 18 Emr-r GGGACCTCTTTAGCTCCTTGGAAGC 19 322-F TTGAAGAAGTGAAGAAGCAGAGA 20 322-R TAAAATGTAATCAAAGAAATTTATAA 21 POR-F CCATATGAGAGCTCACCTCG 22 POR-R GAAGAGAAGGAGCCGATG 23 pEm1-4α w / o p F TGCAGCAGCGGCGGCAAATC 24 pEm1-4α w / o p R GATTCTCCTCCCCTTTCAATG 25 Em w / o ORF F TTCTATGAGTCGCTTTTGTAAATTTG 26 Em w / o ORF R GTAATCACTCCTTCTTAATTACAAATT 27 α-ORF F ATGAAACAACAAAAACGGC 28

Example 4 LAB- E. coli Transformation using shuttle vector

Lactobacillus After pre-culture and main culture of pentosus F121-1 in MRS medium, inoculate 1% in 12 mL of MRS medium containing 0.24 M glycine and 0.1 M sucrose and incubate for 4.5 hours to obtain an OD ₆₀₀ of about 0.5. It was. The culture was recovered by centrifugation for 10 minutes under conditions of 1,400 × g, and the recovered cells were washed twice with 1 mL of pre-cooled tertiary distilled water. 1 mL of 50 mM EDTA (pH 8.0) was added to the washed cells, and the cells were suspended and incubated at 4 ° C. for 5 minutes. The cells subjected to suspension using the EDTA were washed twice with 1 mL of pre-cooled tertiary distilled water, and then washed three times with 0.3 M sucrose and suspended in 500 μL of 0.3 M sucrose. Among them, 100 μL (electro-competent LAB) and 1 μg of each of the prepared plasmid DNAs (pEm1-4α, pEm1-4por, pEm1-4αp, and pEm1-4epα) were mixed and 1.5 kV, 4 ms, 200 Ω, 0.2 cm cuvette Single pulse under the condition of. 900 μL of MRS medium was added to the mixed solution that had been transformed, and cultured at 30 ° C. for 3 hours, and then aliquoted into MRS (erythromycin 5 μg / mL, 0.1% soluble starch) solid medium and cultured at 30 ° C. for 3 days. The transformants were selected and amylase activity was confirmed in M17 (0.25% glucose, erythromycin 5 μg / mL, 0.1% soluble starch, 0.5% CaCO ₃ ) solid medium. As a control, pIL2530α with a wide host range for the genus Lactococcus and Lactobacillus was used, and in order to further secure the host spectrum of the plasmid, the present inventors used Lactobacillus plantarum SKK and Lactobacillus plantarum , which are plasmid free strains isolated from kimchi. F125-H was used.

After transforming the control pIL2530α to the Lactobacillus plantarum SKK and Lactobacillus pentosus F121-1, it is shown in Figure 12 and Table 3 compared with the transformation results of the vector of the present invention.

As shown in Fig. 11 and Table 3, the recombinant vector of the p1-4 (pEm1-4α and pEm1-4por) is Lb. It was transformed with a yield of 4.2 × 10 ² CFU / μg of DNA or 7.7 × 10 ² CFU / μg of DNA for pentosus F121-1, resulting in a better transformation yield than pIL2530α, which can be used as a host / vector system. It was expected.

In FIG. 11, unlike pIL2530α, a recombinant vector is identified in a transformant in which pEm1-4α and pEm1-4por are inserted, but the shape of p1-4 original band disappears and was not observed. P1-4 and Lb. It was interpreted as a result of homologous recombination between p1-4, a plasmid of pentosus F121-1. The above results were similarly confirmed in pEm1-4αp and pEm1-4epα, as shown in FIGS. 11B and 11C.

In addition, in the case of the previously reported strains, the transfer and conjugation of origin and Rep initiator proteins involved in replication are mostly intended to have a wide host range, but the recombinant vector of p1-4 of the present invention is Lb. It was confirmed that it is a strain-specific vector because it was not transformed only to pentosus F121-1 and SKK and F125-H of Lactobacillus plantarum family, and could be used as a host / vector system.

The transformants were isolated from each colony of the transformed transformants, and then cultured in MRS (erythromycin 5 μg / mL) medium for 24 hours, and then suspended in 20 μL of water, respectively, 0.1% soluble. While culturing for 7 days at 30 ° C. using a starch-containing LB (erythromycin 200 μg / mL, ampicillin 50 μg / mL) solid medium, the colony forming a transparent ring following the iodine reaction was observed. 12 and Tables 4 and 5 below.

1.5 days incubation Size of Clear Zone (mm) F121-1 (1-4 epa) 5.00 F121-1 (1-4 a) 2.53 F121-1 (2530a) 0.47 F121-1 (1-4 SDM, 1-4ap) 4.76 F121-1 (1-4 por) -

1.5 days incubation Size of Clear Zone (mm) F121-1 (1-4 epa) 11.37 F121-1 (1-4 a) 7.23 F121-1 (2530a) 3.55 F121-1 (1-4 SDM, 1-4ap) 9.58 F121-1 (1-4 por) -

As shown in FIG. 12, Table 4, and Table 5, in the vector of the present invention containing the amylase gene, only the amylase activity can be determined to determine whether or not to be transformed. It was confirmed. In addition, compared to the control pIL2530, the transformant using the shuttle vector of the present invention showed excellent amylase activity, in particular, pEm1-4epα and pEm1-4αp was confirmed to show excellent amylase activity.

In addition, Lb. Transformants transformed with pEm1-4α, the shuttle vector of the present invention, using Agarose electrophoresis. Em ^R for a control transformed with pentosus F121-1 (pEm1-4α) and pIL2530α Southern blot was performed using the probe to confirm that the shuttle vector of the present invention was stably maintained in Lactobacillus pentosus F121-1, and the results are shown in FIG. 13. In more detail, the southern blot was electrophoresed in 1.0% agarose gel of the plasmid and the plasmid of the transformant, and then stained with EtBr (Ethidium bromide). The dyeing gel was immersed in denaturation buffer (0.5 M NaOH, 1.5 M NaCl) 10 times the gel volume at room temperature for 45 minutes, washed once with sterile water and neutralized buffer (1 M TrisCl, 1 volume) 1.5 M NaCl, pH 7.4) was added and neutralized for 30 minutes, followed by another 15 minutes of neutralization. The DNA band of the neutralized gel was transferred to Hybond N membrane (Amersham co. UK) through 10 × SSC (1.5 M NaCl, 0.1 M sodium citrate) and immobilized with UV for 10 seconds. The transferred membrane was reacted with a prehybridization solution (6 × SSC, 5 × Denhardt's solution, 0.5% SDS, 50% deionized formamide) at 42 ° C. for 4 hours, then blocked, and 0.4 μg of probe was added to 40 mL of the prehybridization solution. Suspension overnight at 42 ° C. Subsequently, the size-marker λ Hind III digested DNA probe was hybridized in the same manner, and then washed twice with 2 × SSC (0.1% SDS) for 10 minutes at room temperature, followed by 65 × 0.1 × SSC (0.1% SDS). Wash twice at 20 ° C. for 20 min. The washing solution on the membrane was removed and biotin detection was performed. Biotin detection was performed using Fermentas (USA) chromogenic detection kit. After the Streptavidin-AP conjugate reaction, the BCIP / NBT substrate was added and reacted in the dark for more than 30 minutes to show a purple band. When the color development was completed, washed with sterile water and dried. In order to use the Em ^R gene as a probe, the Biotin-labeled probe was digested with pGemTem with EcoR I and then gel elution to recover Em ^R fragment. In order to replace the base with biotin-labeled dUTP using Klenow fragment, 1 μg of DNA and random primer (Fermentas, USA) were added and heated at 100 ° C. for 5 minutes, followed by cooling on ice. Biotin-labeled dNTP and Klenow fragment 5 units were added and reacted at 37 ° C. for 24 hours. 1 μL of 0.5 M EDTA (pH 8.0) was added to terminate the reaction and stored at -20 ° C. Λ Hind III digested DNA (Fermentas, USA) was used as a control for the preparation of the probe.

As shown in FIG. 13, as a result of performing a southern blot, the size of the band identified by the Em ^R probe coincides with the size of pEm1-4α, and the shuttle vector (pEm1-4α) of the present invention is Lactobacillus pentosus F121. It was confirmed that it is stable within -1.

Example 5 Stability of Shuttle Vector in Transformant

In order to confirm the stability of the shuttle vector of the present invention, considering the plasmid characteristics of the rolling circle replication (RCR) type, the possibility of inactivation of the plasmid in the recombinant strain was confirmed. More specifically, in order to measure the plasmid stability of vectors (pEm1-4α and pEm1-4por and pIL2530α) inserted into Lactobacillus pentosus F121-1, 1 colony was inoculated in MRS (erythromycin 5 μg / mL) liquid medium. After the pre-culture and main culture, the cells were washed in sterile water and inoculated with 0.1% in MRS liquid medium without erythromycin. The cells were passaged every 24 hours and dispensed into MRS plate medium containing and not containing erythromycin every 3 days, and the number of viable cells was measured for 30 days, which is shown in FIG. 14.

As it is shown in Figure 14, by day 30 Lb. pentosus F121-1 (pEm1-4α) and Lb. pentosus All of the F121-1 (pEm1-4por) transformants were able to identify the vector band cloned on electrophoresis. Meanwhile, while the generation time of Lactobacillus pentosus F121-1 was about 100.5 minutes, pEm1-4α, pEm1-4por, and pIL2530α were 154.6 minutes, 165 minutes, and 226.8 minutes, respectively. In order, it was confirmed that it was 7 days, 10.7 days, 11.6 days, 15.8 days.

Since the size of the insert DNA is also very important for RCR type plasmids, it was expected that the disadvantage of RCR type, which is more stable than theta type, could be improved by reducing the size of the recombinant vector.

<Example 6> Confirmation of intestinal adhesion, hydrophobicity and cohesiveness of the transformants introduced shuttle vector

Caco-2 (ATCC HTB37), available from the American Type Culture Collection (ATCC), contains DMEM-high glucose (suppled with 10% fetal bovine serum, 1% non-essential amino acid, 1% streptomycin / penicillin (10,000 IU /). mL), 10 mM HEPES, 1 mM sodium pyruvate, 1 mM L-glutamine, Hyclone, USA) medium, and cultured, cultured for 15 days with different medium once every two days to differentiate. The passages used for intestinal adhesion were from 25 to 45.

In order to measure the adhesion to the Caco-2 cell line, the lactic acid bacteria were incubated at 30 ° C. for 24 hours, and the cells were recovered and washed three times with phosphate buffered saline (PBS, pH 7.4). In addition, after washing Caco-2 cells cultured with PBS twice for 15 days, lactic acid bacteria were added to 10 ⁸ CFU / mL, and 1 mL of each well was added to the medium containing antibiotics and fetal bovine serum. . It was incubated for 1 hour at 37 ° C. and 5% CO ₂ conditions, and then washed three times with PBS to remove unattached lactic acid bacteria.

1 mL of methanol was added to each well, and the cells were fixed to the cover slip for 5 minutes. After Gram staining, the cells were observed under an optical microscope, and the results are shown in FIG. 15 (× 4,000).

In addition, for plate counting, 1 mL of 0.05% triton X-100 was added to each well and shaken for 10 minutes. It was diluted 10 ² -10 ⁴ times and plated in MRS medium, and incubated at 30 ° C. for 1-2 days. Lactobacillus rhamnosus GG (ATCC 53103) was used as a positive control, Lactobacillus acidophilus ATCC4356 was used as a negative control, and the results are shown in FIG. 15.

As shown in Figs. 15a and 15b, Lactobacillus pento suspension his transformants are attached rate Lb both including F121-1. The rhamnosus GG showed 3-4 log CFU / mL higher values, especially Lactobacillus pentosus F121-1 (pEm1-4α) was found to have better adhesion than the original strain.

In addition, with respect to the adhesion rate of the Lactobacillus pentosus F121-1 to Caco-2 cell line, most of the transformants showed a value of about 0.9 to 1.0 times, so that the transformation of the shuttle bacterium of the present invention is the host Lactobacillus It was confirmed that it did not affect the excellent intestinal adhesion activity of Pentosus F121-1. In addition, microscopic observation after Gram staining showed that the Lactobacillus pentosus F121-1 (pEM1-4α) exhibited excellent adhesion, such as the same pattern as the original Lactobacillus pentosus F121-1 strain, and sporadicly spread out. It was confirmed that it has an excellent adhesion compared to the control group ( Lb. pentosus F121-1 (pIL2530α)).

In addition, experiments were performed to determine the effect of the transformation using the shuttle vector of the present invention on the function of the cells, specifically hydrophobicity and cohesiveness.

Specifically, hydrophobicity was performed in the following manner. First, the lactic acid bacteria cultured in a 5 mL MRS liquid medium was centrifuged at 11,600 × g for 5 minutes to recover the cells, and washed twice with 10 mL of 0.05 M phosphate buffer (pH 6.8). Put 10 mL hexadecane (Merck, Germany) in 3 mL of diluted lactic acid for the cells such that the OD ₆₀₀ of 0.5 and then vortexed (vortex) view for one minute, then allowed to stand at room temperature for 15 min, the aqueous layer at OD ₆₀₀ Hydrophobicity was measured and the results are shown in FIG. 15C.

In addition, the cultured lactic acid bacteria were centrifuged at 5,000 × g for 15 minutes to recover the cells, and then washed twice with PBS (pH 7.2), OD ₆₀₀ was adjusted to 0.5 and resuspended in PBS. The resuspended cells were measured at OD ₆₀₀ by taking 1 mL of the supernatant every hour while standing at room temperature for 5 hours. Cohesion rate (%) was calculated as "100 × (measured value at initial OD ₆₀₀ -n time OD ₆₀₀ measured) / measured value at the initial OD ₆₀₀ ", the results are shown in Figure 15d.

As shown in FIG. 15C and FIG. 15D, the hydrophobicity and the cohesiveness are similar without being affected by the transformation using the shuttle vector of the present invention, and the shuttle vector of the present invention is characterized by the hydrophobicity and cohesiveness of the host. No effect was found.

Attempts to use lactic acid bacteria as vaccine carriers have been steadily developed since 1995, but until recently, research has been focused on immune activity, and studies on intestinal adhesion are essential for application as a probiotic or probiotic. to be.

In order to solve the problems of the prior art, the inventors of the present invention have discovered a strain Lactobacillus pentosus F121-1, which is very excellent in intestinal adhesion, and the vector or shuttle used to carry a vaccine or the like against the strain During the study of the vector, even when transforming the strain was produced a shuttle vector that does not affect the hydrophobicity or cohesion to be examined when applied as a probiotic active agent and intestinal adhesion of the strain.

Therefore, the host / vector system developed using these vectors and cells is expected to be highly applicable to various probiotic products including vaccine carriers.

1 is a diagram showing a phylogenetic relationship between Lactobacillus pentosus F121-1 and other flexible related microorganisms according to an embodiment of the present invention.

Figure 2 is a photograph showing the results of treatment with various restriction enzymes and the plasmid possessed by Lactobacillus pentosus F121-1, lactic acid bacteria isolated from kimchi according to an embodiment of the present invention.

3 is a diagram showing a cleavage map of plasmid p1-4 isolated from Lactobacillus pentosus F121-1 according to an embodiment of the present invention, and FIGS. 3A and 3B are cleavage maps showing restriction sites of plasmid p1-4. 3C shows the genetic organization together with the restriction region of plasmid p1-4, the arrow indicates the Open Reading Frame (ORF), and the direction of the arrow indicates the transcription direction. The position of denotes a replication origin (plus origin).

4 is a diagram showing the nucleotide sequence of the plasmid p1-4 according to an embodiment of the present invention.

5 is a diagram showing a phylogenetic relationship based on the similarity between the nucleotide sequence of the plasmid p1-4 according to an embodiment of the present invention and another vector derived from the related relationship microorganism.

6 is a diagram comparing a double stranded origin of plasmid p1-4 with another plasmid according to an embodiment of the present invention, and FIG. 6a is a diagram illustrating a double helix replication initiation site of plasmid p1-4. The sequence is compared with the sequence of the double helix replication initiation site of another plasmid, where * indicates the same position of all nucleotide sequences in the same column, and FIG. 6B shows the double helix of plasmid p1-4 based on the homology of each sequence. Nucleotide sequence of replication initiation site and other flexible relations Figure showing phylogenetic relationship based on nucleotide sequence of double helix replication initiation site of microorganism derived vector.

7 is a diagram showing a structure of plasmid p1-4 according to an embodiment of the present invention, wherein the nucleotide sequence region shown in red in FIG. 7 is a minus origin, that is, a single stranded origin of origin. ) Shows the expected site.

8 is a diagram comparing the amino acid sequence of the plasmid ORF1 site, that is, the replication initiation protein, with the replication initiation protein of another plasmid according to an embodiment of the present invention. : Denotes a conserved substitution site and; denotes a semi-conserved substitution site.

9 and 10 show the manufacturing process and cleavage map of the shuttle vectors pEm1-4α, pEm1-4por, pEm1-4αp and pEm1-4 epα according to an embodiment of the present invention, Figure 9 is pEm1-4α and Figure 10b shows the manufacturing process of pEm1-4por, 10a shows the manufacturing process of pEm1-4αp and pEm1-4 epα, Figure 10b is a cleavage map of pUC1-4, Figure 10c is a cleavage map of pEm1-4α, 10D is a cleavage map of pEm1-4, FIG. 10E is a cleavage map of pEm1-4por, FIG. 10F is a cleavage map of pEm1-4αp, and FIG. 10G is a cleavage map of pEm1-4 epα.

Figure 11 is a photograph showing the results of transforming the recombinant vector according to an embodiment of the present invention, Figure 11a is a transformed vector and pIL2530α of the present invention to the Lactobacillus pentosus F121-1 and Lactobacillus plantarum SKK Electrophoresis of the transformed plasmid of the transformant, H is the electrophoresis of the original plasmid of Lactobacillus pentosus F121-1, V1 is pEm1-4α, T1 is pEm1 to Lactobacillus pentosus F121-1 -4α transformed, V2 is Em1-4por, T2 is Lactobacillus pentosus F121-1 transformed with Em1-4por, V3 is pIL2530α, T3 is lactobacillus pentosus F121-1 pIL2530α , HS is Lactobacillus planttriun SKK (plasmid-free), T4 transforms pIL2530α to Lactobacillus planttriun SKK, and FIG. 11B shows pEmαp1- to Lactobacillus pentosus F121-1. 4 11C shows the transformation of pEm1-4epα into Lactobacillus pentosus F121-1.

12 is a photograph of the recombinant vector according to an embodiment of the present invention, cultured in M17-G medium transformed with Lactobacillus pentosus F121-1, and stained with iodine to observe amylase activity.

Figure 13 after transforming the recombinant vector pEm1-4α and pIL2530α control according to an embodiment of the present invention, Em ^R Southern blot using a probe is shown, 1 is the result of transforming pEm1-4α to Lactobacillus pentosus F121-1, 2 is pIL2530α transformed to Lactobacillus pentosus F121-1 It is the result of the conversion, 3 is the untransformed Lactobacillus pentosus, 4 is the Southern blot result of 1, 5 is the Southern blot result of 2, and 6 is the Southern blot result of 3.

14 is a transfection of pEm1-4α, pEm1-4por and pIL2530α, which are shuttle vectors of the present invention, to Lactobacillus pentosus F121-1 to confirm the stability of the recombinant vector according to an embodiment of the present invention. It is a graph which cultured the converter and confirmed the stability of the plasmid.

15 shows the adhesion, hydrophobicity and cohesiveness of the transformant transformed with the recombinant vector and the control pIL2530α according to one embodiment of the present invention and the strain Lactobacillus pentosus F121-1, and FIG. 15A is attached. 15B is a photograph taken after staining cells with a transformant attached to Caco-2 cells, and FIG. 15C is a result showing the hydrophobicity of the transformant. Figure 15d is a result showing the cohesiveness of the transformant.

<110> MOKPO NATIONAL UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> A PLASMID SHUTTLE VECTOR <130> KP200090052 <160> 29 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 27F primer <400> 1 agagtttgat cctggctcag 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 1429R primer <400> 2 ggttaccttg ttacgactt 19 <210> 3 <211> 858 <212> DNA <213> p1-4_ORF1 <220> <221> CDS (222) (1) .. (855) <400> 3 atg ttg cac tac aag aaa gcc cat cga gtt aaa gag tgt ggt gaa gta 48 Met Leu His Tyr Lys Lys Ala His Arg Val Lys Glu Cys Gly Glu Val   1 5 10 15 tta cgt ttt gta gaa gat aaa aat ggt cac aaa aaa ttg gct cag act 96 Leu Arg Phe Val Glu Asp Lys Asn Gly His Lys Lys Leu Ala Gln Thr              20 25 30 tgg ttt tgt cat tcc cgt ttg tgt ccg tta tgt aat tgg cgg cgg tca 144 Trp Phe Cys His Ser Arg Leu Cys Pro Leu Cys Asn Trp Arg Arg Ser          35 40 45 atg aaa caa tct aac cag tta act caa att ttg aca gaa aca gtt aaa 192 Met Lys Gln Ser Asn Gln Leu Thr Gln Ile Leu Thr Glu Thr Val Lys      50 55 60 cag cga aaa acg ggg cgg ttc ttg ttt tta acg ttg acg gta aag aat 240 Gln Arg Lys Thr Gly Arg Phe Leu Phe Leu Thr Leu Thr Val Lys Asn  65 70 75 80 act aca ggg gat ttg ttg aag agt gaa tta cgg cag atg gga cga gcc 288 Thr Thr Gly Asp Leu Leu Lys Ser Glu Leu Arg Gln Met Gly Arg Ala                  85 90 95 gtt gca aag atc ttt cag tat aaa aaa gtg gct aaa aat ttg ttg ggt 336 Val Ala Lys Ile Phe Gln Tyr Lys Lys Val Ala Lys Asn Leu Leu Gly             100 105 110 tat gta cgt tca act gag gtt acc att aat cac gaa gca gat cag ccg 384 Tyr Val Arg Ser Thr Glu Val Thr Ile Asn His Glu Ala Asp Gln Pro         115 120 125 atg tat cac cac cat atg cat gtt ttg ctt ttt atg aaa tcg agt tat 432 Met Tyr His His His Met His Val Leu Leu Phe Met Lys Ser Ser Tyr     130 135 140 ttt aca gga act gat aat tat att tca caa gca gaa tgg act aga tat 480 Phe Thr Gly Thr Asp Asn Tyr Ile Ser Gln Ala Glu Trp Thr Arg Tyr 145 150 155 160 tgg caa cga gcg atg aaa tta gct tat gcg cca gtt gtg aat gtt gaa 528 Trp Gln Arg Ala Met Lys Leu Ala Tyr Ala Pro Val Val Asn Val Glu                 165 170 175 gcg gtt aaa ccg aat gtg aaa cgc cag aaa aat tcc tta ctg gct agt 576 Ala Val Lys Pro Asn Val Lys Arg Gln Lys Asn Ser Leu Leu Ala Ser             180 185 190 gcc caa gaa acg gct aaa tat cag gtg aag tcc aaa gat att tta act 624 Ala Gln Glu Thr Ala Lys Tyr Gln Val Lys Ser Lys Asp Ile Leu Thr         195 200 205 aac aat caa gaa caa gat cta caa gta att gat gat ttg gag caa gct 672 Asn Asn Gln Glu Gln Asp Leu Gln Val Ile Asp Asp Leu Glu Gln Ala     210 215 220 ttg gct ggg tcc cgg caa att agc tat ggg ggc ttg ctg aaa gaa att 720 Leu Ala Gly Ser Arg Gln Ile Ser Tyr Gly Gly Leu Leu Lys Glu Ile 225 230 235 240 cgc aag cag ttg caa tta gaa gac gtt gaa aat ggg gat ttg att aat 768 Arg Lys Gln Leu Gln Leu Glu Asp Val Glu Asn Gly Asp Leu Ile Asn                 245 250 255 acg gat agt gat gat caa aaa act ggt cag gta gtg cgt gaa att gtt 816 Thr Asp Ser Asp Asp Gln Lys Thr Gly Gln Val Val Arg Glu Ile Val             260 265 270 gca aaa tgg gat tat cag cgt aaa aat tat ttt gtt tgg taa 858 Ala Lys Trp Asp Tyr Gln Arg Lys Asn Tyr Phe Val Trp         275 280 285 <210> 4 <211> 285 <212> PRT <213> p1-4_ORF1 <400> 4 Met Leu His Tyr Lys Lys Ala His Arg Val Lys Glu Cys Gly Glu Val   1 5 10 15 Leu Arg Phe Val Glu Asp Lys Asn Gly His Lys Lys Leu Ala Gln Thr              20 25 30 Trp Phe Cys His Ser Arg Leu Cys Pro Leu Cys Asn Trp Arg Arg Ser          35 40 45 Met Lys Gln Ser Asn Gln Leu Thr Gln Ile Leu Thr Glu Thr Val Lys      50 55 60 Gln Arg Lys Thr Gly Arg Phe Leu Phe Leu Thr Leu Thr Val Lys Asn  65 70 75 80 Thr Thr Gly Asp Leu Leu Lys Ser Glu Leu Arg Gln Met Gly Arg Ala                  85 90 95 Val Ala Lys Ile Phe Gln Tyr Lys Lys Val Ala Lys Asn Leu Leu Gly             100 105 110 Tyr Val Arg Ser Thr Glu Val Thr Ile Asn His Glu Ala Asp Gln Pro         115 120 125 Met Tyr His His His Met His Val Leu Leu Phe Met Lys Ser Ser Tyr     130 135 140 Phe Thr Gly Thr Asp Asn Tyr Ile Ser Gln Ala Glu Trp Thr Arg Tyr 145 150 155 160 Trp Gln Arg Ala Met Lys Leu Ala Tyr Ala Pro Val Val Asn Val Glu                 165 170 175 Ala Val Lys Pro Asn Val Lys Arg Gln Lys Asn Ser Leu Leu Ala Ser             180 185 190 Ala Gln Glu Thr Ala Lys Tyr Gln Val Lys Ser Lys Asp Ile Leu Thr         195 200 205 Asn Asn Gln Glu Gln Asp Leu Gln Val Ile Asp Asp Leu Glu Gln Ala     210 215 220 Leu Ala Gly Ser Arg Gln Ile Ser Tyr Gly Gly Leu Leu Lys Glu Ile 225 230 235 240 Arg Lys Gln Leu Gln Leu Glu Asp Val Glu Asn Gly Asp Leu Ile Asn                 245 250 255 Thr Asp Ser Asp Asp Gln Lys Thr Gly Gln Val Val Arg Glu Ile Val             260 265 270 Ala Lys Trp Asp Tyr Gln Arg Lys Asn Tyr Phe Val Trp         275 280 285 <210> 5 <211> 225 <212> DNA <213> p1-4_ORF2 <220> <221> CDS (222) (1) .. (222) <400> 5 atg acg tcg tgc gtt ctg act gaa aaa cgt cag aag ggc gca ctt ata 48 Met Thr Ser Cys Val Leu Thr Glu Lys Arg Gln Lys Gly Ala Leu Ile   1 5 10 15 ctc cac gaa aat aaa tgg ggt gta agt tgc tta aaa cct gta tca gaa 96 Leu His Glu Asn Lys Trp Gly Val Ser Cys Leu Lys Pro Val Ser Glu              20 25 30 ttc gct ccg ctc aaa cta aaa ctg acg ggg gtc agt ttg aaa ccc aaa 144 Phe Ala Pro Leu Lys Leu Lys Leu Thr Gly Val Ser Leu Lys Pro Lys          35 40 45 aag cag ata agt tca gtc gta aac tcc ttc gaa ctt ttc tcc ttt ttg 192 Lys Gln Ile Ser Ser Val Val Asn Ser Phe Glu Leu Phe Ser Phe Leu      50 55 60 ggt tgc tct caa aag ccc aaa att gcc ttc taa 225 Gly Cys Ser Gln Lys Pro Lys Ile Ala Phe  65 70 <210> 6 <211> 74 <212> PRT <213> p1-4_ORF2 <400> 6 Met Thr Ser Cys Val Leu Thr Glu Lys Arg Gln Lys Gly Ala Leu Ile   1 5 10 15 Leu His Glu Asn Lys Trp Gly Val Ser Cys Leu Lys Pro Val Ser Glu              20 25 30 Phe Ala Pro Leu Lys Leu Lys Leu Thr Gly Val Ser Leu Lys Pro Lys          35 40 45 Lys Gln Ile Ser Ser Val Val Asn Ser Phe Glu Leu Phe Ser Phe Leu      50 55 60 Gly Cys Ser Gln Lys Pro Lys Ile Ala Phe  65 70 <210> 7 <211> 270 <212> DNA <213> p1-4_ORF3 <220> <221> CDS (222) (1) .. (270) <400> 7 atg ccg agg att gac gaa cgt agt tgg aaa aag att ttt gaa ttg ggt 48 Met Pro Arg Ile Asp Glu Arg Ser Trp Lys Lys Ile Phe Glu Leu Gly   1 5 10 15 aat aac ggt aaa tac gat gat gaa gcg tat gct gag att ctt gct aca 96 Asn Asn Gly Lys Tyr Asp Asp Glu Ala Tyr Ala Glu Ile Leu Ala Thr              20 25 30 gta ttg aat ttg cgt gtt gaa aaa ggc tta act caa agt gac gtt gcg 144 Val Leu Asn Leu Arg Val Glu Lys Gly Leu Thr Gln Ser Asp Val Ala          35 40 45 aga ata tct ggt tta tct acg agt atg atc tct aaa att gaa agt caa 192 Arg Ile Ser Gly Leu Ser Thr Ser Met Ile Ser Lys Ile Glu Ser Gln      50 55 60 tat aca gta ccg agt gta aaa aat ttc tta cga tat att ttc gcc tta 240 Tyr Thr Val Pro Ser Val Lys Asn Phe Leu Arg Tyr Ile Phe Ala Leu  65 70 75 80 gat ttg gat tgg gaa ctc gtt cat aaa cgt 270 Asp Leu Asp Trp Glu Leu Val His Lys Arg                  85 90 <210> 8 <211> 90 <212> PRT <213> p1-4_ORF3 <400> 8 Met Pro Arg Ile Asp Glu Arg Ser Trp Lys Lys Ile Phe Glu Leu Gly   1 5 10 15 Asn Asn Gly Lys Tyr Asp Asp Glu Ala Tyr Ala Glu Ile Leu Ala Thr              20 25 30 Val Leu Asn Leu Arg Val Glu Lys Gly Leu Thr Gln Ser Asp Val Ala          35 40 45 Arg Ile Ser Gly Leu Ser Thr Ser Met Ile Ser Lys Ile Glu Ser Gln      50 55 60 Tyr Thr Val Pro Ser Val Lys Asn Phe Leu Arg Tyr Ile Phe Ala Leu  65 70 75 80 Asp Leu Asp Trp Glu Leu Val His Lys Arg                  85 90 <210> 9 <211> 2424 <212> DNA <213> p1-4 <400> 9 gttgtcgcca ttggcgactt ctgatacaga ttttttggtt ttagcactac tccaatttat 60 ttggagtgta agtgcgcctt gaactaatat ttttgaattt tgtcattgtc gaaatataag 120 acaatgcgca cttacacgtc actttcatga cgtcgtgcgt tctgactgaa aaacgtcaga 180 agggcgcact tatactccac gaaaataaat ggggtgtaag ttgcttaaaa cctgtatcag 240 aattcgctcc gctcaaacta aaactgacgg gggtcagttt gaaacccaaa aagcagataa 300 gttcagtcgt aaactccttc gaacttttct cctttttggg ttgctctcaa aagcccaaaa 360 ttgccttcta agccatttta ggaattaaca agctatttcg tcgtctgtca acggtaaatc 420 gacgtagata gccttattga gccgtacagg cgaaattaga ctatctagga ggctttaagg 480 agttgataga ctttgcaaat tgaaagctaa acggcggaaa gcagcttgcc tgttttcccg 540 agcccgactg gcggcgaagt cgaaacggtc aagctggttc agcttgtcag gtttgggtga 600 aacccaaggt cttacttttt tggtcgttaa aactggaaaa tttcacaaac tttttaagcg 660 ggtctctcta actagcccgc tacccgtttg aaaatcaaac cttttgcttt tttgttcaca 720 tgaaaaaatg tggtaatgtt ctagtgtttt agaaagagat ttaaagggga ttaataatgc 780 cgaggattga cgaacgtagt tggaaaaaga tttttgaatt gggtaataac ggtaaatacg 840 atgatgaagc gtatgctgag attcttgcta cagtattgaa tttgcgtgtt gaaaaaggct 900 taactcaaag tgacgttgcg agaatatctg gtttatctac gagtatgatc tctaaaattg 960 aaagtcaata tacagtaccg agtgtaaaaa atttcttacg atatattttc gccttagatt 1020 tggattggga actcgttcat aaacgttaat tgaattttgg gtttaaaaaa gaggttcagt 1080 atgaacctct tttttggggt ttgaaagtga cgttttttgt cactttcctc ttatcttgat 1140 actattagaa acaacgtcat tttaaaaaac tgggataaac ccttgacaca actggactta 1200 ggcgtattat gagtttataa aatgaataaa gaaaaaaccc acgtgagaat tcctagtttg 1260 gcgacccgga acacgcgagt taatcttgaa tattcgtatt tactagacat agtttaaagc 1320 ttgagttagt aagcgtcaag accttagttt tagtaaatac ataaaagatt agctcttctc 1380 acgtggttgg atgagaggag ctttttagtt tggctgatag aaaagtttta gttgatcgat 1440 cgcagtcggg aaaagtacga ccatggcgag aacataagtt agagaattta cagtatggtg 1500 attatttaca aatgttgcac tacaagaaag cccatcgagt taaagagtgt ggtgaagtat 1560 tacgttttgt agaagataaa aatggtcaca aaaaattggc tcagacttgg ttttgtcatt 1620 cccgtttgtg tccgttatgt aattggcggc ggtcaatgaa acaatctaac cagttaactc 1680 aaattttgac agaaacagtt aaacagcgaa aaacggggcg gttcttgttt ttaacgttga 1740 cggtaaagaa tactacaggg gatttgttga agagtgaatt acggcagatg ggacgagccg 1800 ttgcaaagat ctttcagtat aaaaaagtgg ctaaaaattt gttgggttat gtacgttcaa 1860 ctgaggttac cattaatcac gaagcagatc agccgatgta tcaccaccat atgcatgttt 1920 tgctttttat gaaatcgagt tattttacag gaactgataa ttatatttca caagcagaat 1980 ggactagata ttggcaacga gcgatgaaat tagcttatgc gccagttgtg aatgttgaag 2040 cggttaaacc gaatgtgaaa cgccagaaaa attccttact ggctagtgcc caagaaacgg 2100 ctaaatatca ggtgaagtcc aaagatattt taactaacaa tcaagaacaa gatctacaag 2160 taattgatga tttggagcaa gctttggctg ggtcccggca aattagctat gggggcttgc 2220 tgaaagaaat tcgcaagcag ttgcaattag aagacgttga aaatggggat ttgattaata 2280 cggatagtga tgatcaaaaa actggtcagg tagtgcgtga aattgttgca aaatgggatt 2340 atcagcgtaa aaattatttt gtttggtaaa gataatacca gggtattatc aacgacaaaa 2400 ccgttggata taccctgatt tttt 2424 <210> 10 <211> 630 <212> DNA <213> amylase <400> 10 ttgaagaagt gaagaagcag agaggctatt gaataaatga gtagaaagcg ccatatcggc 60 gcttttcttt tggaagaaaa tatagggaaa atggtatttg ttaaaaattc ggaatattta 120 tacaatatca tatgtttcac attgaaaggg gaggagaatc atgaaacaac aaaaacggct 180 ttacgcccga ttgctgacgc tgttatttgc gctcatcttc ttgctgcctc attctgcagc 240 agcggcggca aatcttaatg ggacgctgat gcagtatttt gaatggtaca tgcccaatga 300 cggccaacat tggaagcgct tgcaaaacga ctcggcatat ttggctgaac acggtattac 360 tgccgtctgg attcccccgg catataaggg aacgagccaa gcggatgtgg gctacggtgc 420 ttacgacctt tatgatttag gggagtttca tcaaaaaggg acggttcgga caaagtacgg 480 cacaaaagga gagctgcaat ctgcgatcaa aagtcttcat tcccgcgaca ttaacgttta 540 cggggatgtg gtcatcaacc acaaaggcgg cgctgatgcg accgaagatg taaccgcggt 600 tgaagtcgat cccgctgacc gcaaccgcgt 630 <210> 11 <211> 1776 <212> DNA <213> porphyranase <400> 11 ccatatgaga gctcacctcg ttgatgagct ctcatatcaa ttttattagt ttgcttcacc 60 tctcacctcc gaacaaatcc tctcataacc gtttcaacaa aataagccaa ccaacgaaaa 120 acgacttcca gaaaattacc tgaaacatat aaagaagttt aatattacaa gcgccatgca 180 tcacttttat aacaaacatc aatcgatagc aacatattta ccaaattcac taaaacagca 240 atgaataata agattggttg aactatatta ttacagtgca aacacaaggt ttgcactaca 300 tccaaactat ttttaatatc cacacattta aggataaata atgaaattac caatactctc 360 tctactcacc attgccataa atcctgcttt cgcgaatgac tgggattcta ttccaattcc 420 tgcagagtta gacgaaggtc aacagtggga gttacaagaa gcttattccg actcttttaa 480 ctactcgggt aaaaatacca ctttcacgag caagtggaac gacacctatt ttcatggatg 540 gaccggtcca ggtttaactt attggcagtc gaacgagtca tgggtttcgg atggaaacct 600 aattatcagc gcatctcgtc gtcaaggtac agaacaagtt aatgctggcg ttgtaacctc 660 taagacgaaa gtaaaatatc caattttcat ggaagctaga attaaagtta gtaatctaga 720 gctttcatca aatttttggt tattgagtga aaatgacgag cgcgagattg atattctcga 780 ggtatatggt ggagcgaagg atacctggtt tgcgaaaaac atgtcgacta acttccatgt 840 tttccttaga aactctgata acacaattaa aagtgatttc aacgaccaaa cacacaacga 900 accaagttgg gggacgtatt ggagagatgg tttccaccgc tttgctgcct attggaaaag 960 tcctacagaa gtgacgttct atataaatgg tgtaaagaca ccgaaaggtt cgtgggaaca 1020 agtgttgatg aaagacaagg attacactgg acaaactcta gataagagcc agtttaacat 1080 ggatgaagag atgttcatta tacttgacac tgaagaccat tcgtggcgtt cagaggctgg 1140 tatcgttgct tctgatgcgg atctagccga tagctcgaaa aataaaatgt acgttgactg 1200 gattcgtgtt tataaaccag ttcgagacaa cgataataac ggcattgtcc ctccgagtga 1260 tgcaactagt ttacagttta ttcatagtaa tagatgtctc gatgtaaaag atggagcaac 1320 gtggaatggt agtacctatc aacaatggag ttgcaacaca tcaaatagca atcaacgttt 1380 cactttcact ccagtatcaa acagtgaata tttaattcaa tcagataaaa gtcaactctg 1440 cgttgagtta aaaccagacg catctcaatg gaaagatggt gctactatcc agcagtatat 1500 ttgtaattca gcagaagaaa atcagttgtg gacgttattc gacaaaggca gtaacacttt 1560 tgagttaaga aataagaaga cgggtaagtg tcttgaggtt gctaataacc aagcaactaa 1620 cggtggtagc attattcaag cgtcttgtga tggaggaaac aaccaacgaa ttaagttcaa 1680 gtaaatcgct tgcaacctaa tctaattagt acattcattt aatgactttc tattaaatga 1740 atgtgcattt ttattgttca tcggctcctt ctcttc 1776 <210> 12 <211> 5110 <212> DNA <213> pUC1-4 <400> 12 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60 cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180 aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240 ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300 ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360 tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420 tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480 actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540 gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600 acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660 gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720 acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780 gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840 ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900 gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960 cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020 agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080 catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140 tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260 gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320 taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc 1380 ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440 tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560 cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620 agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980 cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040 cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100 acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160 cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220 accatgatta cgaattcgag ctcggtaccc aactcaaatt ttgacagaaa cagttaaaca 2280 gcgaaaaacg gggcggttct tgtttttaac gttgacggta aagaatacta caggggattt 2340 gttgaagagt gaattacggc agatgggacg agccgttgca aagatctttc agtataaaaa 2400 agtggctaaa aatttgttgg gttatgtacg ttcaactgag gttaccatta atcacgaagc 2460 agatcagccg atgtatcacc accatatgca tgttttgctt tttatgaaat cgagttattt 2520 tacaggaact gataattata tttcacaagc agaatggact agatattggc aacgagcgat 2580 gaaattagct tatgcgccag ttgtgaatgt tgaagcggtt aaaccgaatg tgaaacgcca 2640 gaaaaattcc ttactggcta gtgcccaaga aacggctaaa tatcaggtga agtccaaaga 2700 tattttaact aacaatcaag aacaagatct acaagtaatt gatgatttgg agcaagcttt 2760 ggctgggtcc cggcaaatta gctatggggg cttgctgaaa gaaattcgca agcagttgca 2820 attagaagac gttgaaaatg gggatttgat taatacggat agtgatgatc aaaaaactgg 2880 tcaggtagtg cgtgaaattg ttgcaaaatg ggattatcag cgtaaaaatt attttgtttg 2940 gtaaagataa taccagggta ttatcaacga caaaaccgtt ggatataccc tgattttttg 3000 ttgtcgccat tggcgacttc tgatacagat tttttggttt tagcactact ccaatttatt 3060 tggagtgtaa gtgcgccttg aactaatatt tttgaatttt gtcattgtcg aaatataaga 3120 caatgcgcac ttacacgtca ctttcatgac gtcgtgcgtt ctgactgaaa aacgtcagaa 3180 gggcgcactt atactccacg aaaataaatg gggtgtaagt tgcttaaaac ctgtatcaga 3240 attcgctccg ctcaaactaa aactgacggg ggtcagtttg aaacccaaaa agcagataag 3300 ttcagtcgta aactccttcg aacttttctc ctttttgggt tgctctcaaa agcccaaaat 3360 tgccttctaa gccattttag gaattaacaa gctatttcgt cgtctgtcaa cggtaaatcg 3420 acgtagatag ccttattgag ccgtacaggc gaaattagac tatctaggag gctttaagga 3480 gttgatagac tttgcaaatt gaaagctaaa cggcggaaag cagcttgcct gttttcccga 3540 gcccgactgg cggcgaagtc gaaacggtca agctggttca gcttgtcagg tttgggtgaa 3600 acccaaggtc ttactttttt ggtcgttaaa actggaaaat ttcacaaact ttttaagcgg 3660 gtctctctaa ctagcccgct acccgtttga aaatcaaacc ttttgctttt ttgttcacat 3720 gaaaaaatgt ggtaatgttc tagtgtttta gaaagagatt taaaggggat taataatgcc 3780 gaggattgac gaacgtagtt ggaaaaagat ttttgaattg ggtaataacg gtaaatacga 3840 tgatgaagcg tatgctgaga ttcttgctac agtattgaat ttgcgtgttg aaaaaggctt 3900 aactcaaagt gacgttgcga gaatatctgg tttatctacg agtatgatct ctaaaattga 3960 aagtcaatat acagtaccga gtgtaaaaaa tttcttacga tatattttcg ccttagattt 4020 ggattgggaa ctcgttcata aacgttaatt gaattttggg tttaaaaaag aggttcagta 4080 tgaacctctt ttttggggtt tgaaagtgac gttttttgtc actttcctct tatcttgata 4140 ctattagaaa caacgtcatt ttaaaaaact gggataaacc cttgacacaa ctggacttag 4200 gcgtattatg agtttataaa atgaataaag aaaaaaccca cgtgagaatt cctagtttgg 4260 cgacccggaa cacgcgagtt aatcttgaat attcgtattt actagacata gtttaaagct 4320 tgagttagta agcgtcaaga ccttagtttt agtaaataca taaaagatta gctcttctca 4380 cgtggttgga tgagaggagc tttttagttt ggctgataga aaagttttag ttgatcgatc 4440 gcagtcggga aaagtacgac catggcgaga acataagtta gagaatttac agtatggtga 4500 ttatttacaa atgttgcact acaagaaagc ccatcgagtt aaagagtgtg gtgaagtatt 4560 acgttttgta gaagataaaa atggtcacaa aaaattggct cagacttggt tttgtcattc 4620 ccgtttgtgt ccgttatgta attggcggcg gtcaatgaaa caatctaacc agttggggat 4680 cctctagagt cgacctgcag gcatgcaagc ttggcactgg ccgtcgtttt acaacgtcgt 4740 gactgggaaa accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc 4800 agctggcgta atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg 4860 aatggcgaat ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac 4920 cgcatatggt gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga 4980 cacccgccaa cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac 5040 agacaagctg tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg 5100 aaacgcgcga 5110 <210> 13 <211> 6162 <212> DNA <213> pEm1-4 <400> 13 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60 cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180 aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240 ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300 ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360 tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420 tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480 actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540 gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600 acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660 gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720 acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780 gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840 ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900 gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960 cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020 agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080 catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140 tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260 gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320 taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc 1380 ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440 tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560 cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620 agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980 cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040 cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100 acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160 cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220 accatgatta cgaattccgg ttcgtgttcg tgctgacttg caccatatca taaaaatcga 2280 aacagcaaag aatggcggaa acgtaaaaga agttatggaa ataagactta gaagcaaact 2340 taagagtgtg ttgatagtgc agtatcttaa aattttgtat aataggaatt gaagttaaat 2400 tagatgctaa aaatttgtaa ttaagaagga gtgattacat gaacaaaaat ataaaatatt 2460 ctcaaaactt tttaacgagt gaaaaagtac tcaaccaaat aataaaacaa ttgaatttaa 2520 aagaaaccga taccgtttac gaaattggaa caggtaaagg gcatttaacg acgaaactgg 2580 ctaaaataag taaacaggta acgtctattg aattagacag tcatctattc aacttatcgt 2640 cagaaaaatt aaaactgaat actcgtgtca ctttaattca ccaagatatt ctacagtttc 2700 aattccctaa caaacagagg tataaaattg ttgggagtat tccttaccat ttaagcacac 2760 aaattattaa aaaagtggtt tttgaaagcc atgcgtctga catctatctg attgttgaag 2820 aaggattcta caagcgtacc ttggatattc accgaacact agggttgctc ttgcacactc 2880 aagtctcgat tcagcaattg cttaagctgc cagcggaatg ctttcatcct aaaccaaaag 2940 taaacagtgt cttaataaaa cttacccgcc ataccacaga tgttccagat aaatattgga 3000 agctatatac gtactttgtt tcaaaatggg tcaatcgaga atatcgtcaa ctgtttacta 3060 aaaatcagtt tcatcaagca atgaaacacg ccaaagtaaa caatttaagt accgttactt 3120 atgagcaagt attgtctatt tttaatagtt atctattatt taacgggagg aaataattct 3180 atgagtcgct tttgtaaatt tggaaagtta cacgttacta aagggaatgt agataaatta 3240 ttaggtatac tactgacagc ttccaaggag ctaaagaggt cccgaattcg agctcggtac 3300 ccaactcaaa ttttgacaga aacagttaaa cagcgaaaaa cggggcggtt cttgttttta 3360 acgttgacgg taaagaatac tacaggggat ttgttgaaga gtgaattacg gcagatggga 3420 cgagccgttg caaagatctt tcagtataaa aaagtggcta aaaatttgtt gggttatgta 3480 cgttcaactg aggttaccat taatcacgaa gcagatcagc cgatgtatca ccaccatatg 3540 catgttttgc tttttatgaa atcgagttat tttacaggaa ctgataatta tatttcacaa 3600 gcagaatgga ctagatattg gcaacgagcg atgaaattag cttatgcgcc agttgtgaat 3660 gttgaagcgg ttaaaccgaa tgtgaaacgc cagaaaaatt ccttactggc tagtgcccaa 3720 gaaacggcta aatatcaggt gaagtccaaa gatattttaa ctaacaatca agaacaagat 3780 ctacaagtaa ttgatgattt ggagcaagct ttggctgggt cccggcaaat tagctatggg 3840 ggcttgctga aagaaattcg caagcagttg caattagaag acgttgaaaa tggggatttg 3900 attaatacgg atagtgatga tcaaaaaact ggtcaggtag tgcgtgaaat tgttgcaaaa 3960 tgggattatc agcgtaaaaa ttattttgtt tggtaaagat aataccaggg tattatcaac 4020 gacaaaaccg ttggatatac cctgattttt tgttgtcgcc attggcgact tctgatacag 4080 attttttggt tttagcacta ctccaattta tttggagtgt aagtgcgcct tgaactaata 4140 tttttgaatt ttgtcattgt cgaaatataa gacaatgcgc acttacacgt cactttcatg 4200 acgtcgtgcg ttctgactga aaaacgtcag aagggcgcac ttatactcca cgaaaataaa 4260 tggggtgtaa gttgcttaaa acctgtatca gaattcgctc cgctcaaact aaaactgacg 4320 ggggtcagtt tgaaacccaa aaagcagata agttcagtcg taaactcctt cgaacttttc 4380 tcctttttgg gttgctctca aaagcccaaa attgccttct aagccatttt aggaattaac 4440 aagctatttc gtcgtctgtc aacggtaaat cgacgtagat agccttattg agccgtacag 4500 gcgaaattag actatctagg aggctttaag gagttgatag actttgcaaa ttgaaagcta 4560 aacggcggaa agcagcttgc ctgttttccc gagcccgact ggcggcgaag tcgaaacggt 4620 caagctggtt cagcttgtca ggtttgggtg aaacccaagg tcttactttt ttggtcgtta 4680 aaactggaaa atttcacaaa ctttttaagc gggtctctct aactagcccg ctacccgttt 4740 gaaaatcaaa ccttttgctt ttttgttcac atgaaaaaat gtggtaatgt tctagtgttt 4800 tagaaagaga tttaaagggg attaataatg ccgaggattg acgaacgtag ttggaaaaag 4860 atttttgaat tgggtaataa cggtaaatac gatgatgaag cgtatgctga gattcttgct 4920 acagtattga atttgcgtgt tgaaaaaggc ttaactcaaa gtgacgttgc gagaatatct 4980 ggtttatcta cgagtatgat ctctaaaatt gaaagtcaat atacagtacc gagtgtaaaa 5040 aatttcttac gatatatttt cgccttagat ttggattggg aactcgttca taaacgttaa 5100 ttgaattttg ggtttaaaaa agaggttcag tatgaacctc ttttttgggg tttgaaagtg 5160 acgttttttg tcactttcct cttatcttga tactattaga aacaacgtca ttttaaaaaa 5220 ctgggataaa cccttgacac aactggactt aggcgtatta tgagtttata aaatgaataa 5280 agaaaaaacc cacgtgagaa ttcctagttt ggcgacccgg aacacgcgag ttaatcttga 5340 atattcgtat ttactagaca tagtttaaag cttgagttag taagcgtcaa gaccttagtt 5400 ttagtaaata cataaaagat tagctcttct cacgtggttg gatgagagga gctttttagt 5460 ttggctgata gaaaagtttt agttgatcga tcgcagtcgg gaaaagtacg accatggcga 5520 gaacataagt tagagaattt acagtatggt gattatttac aaatgttgca ctacaagaaa 5580 gcccatcgag ttaaagagtg tggtgaagta ttacgttttg tagaagataa aaatggtcac 5640 aaaaaattgg ctcagacttg gttttgtcat tcccgtttgt gtccgttatg taattggcgg 5700 cggtcaatga aacaatctaa ccagttgggg atcctctaga gtcgacctgc aggcatgcaa 5760 gcttggcact ggccgtcgtt ttacaacgtc gtgactggga aaaccctggc gttacccaac 5820 ttaatcgcct tgcagcacat ccccctttcg ccagctggcg taatagcgaa gaggcccgca 5880 ccgatcgccc ttcccaacag ttgcgcagcc tgaatggcga atggcgcctg atgcggtatt 5940 ttctccttac gcatctgtgc ggtatttcac accgcatatg gtgcactctc agtacaatct 6000 gctctgatgc cgcatagtta agccagcccc gacacccgcc aacacccgct gacgcgccct 6060 gacgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct 6120 gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc ga 6162 <210> 14 <211> 7941 <212> DNA <213> pEm1-4a <400> 14 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60 cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180 aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240 ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300 ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360 tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420 tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480 actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540 gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600 acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660 gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720 acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780 gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840 ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900 gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960 cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020 agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080 catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140 tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260 gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320 taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc 1380 ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440 tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560 cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620 agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980 cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040 cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100 acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160 cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220 accatgatta cgaattcggg acctctttag ctccttggaa gctgtcagta gtatacctaa 2280 taatttatct acattccctt tagtaacgtg taactttcca aatttacaaa agcgactcat 2340 agaattattt cctcccgtta aataatagat aactattaaa aatagacaat acttgctcat 2400 aagtaacggt acttaaattg tttactttgg cgtgtttcat tgcttgatga aactgatttt 2460 tagtaaacag ttgacgatat tctcgattga cccattttga aacaaagtac gtatatagct 2520 tccaatattt atctggaaca tctgtggtat ggcgggtaag ttttattaag acactgttta 2580 cttttggttt aggatgaaag cattccgctg gcagcttaag caattgctga atcgagactt 2640 gagtgtgcaa gagcaaccct agtgttcggt gaatatccaa ggtacgcttg tagaatcctt 2700 cttcaacaat cagatagatg tcagacgcat ggctttcaaa aaccactttt ttaataattt 2760 gtgtgcttaa atggtaagga atactcccaa caattttata cctctgtttg ttagggaatt 2820 gaaactgtag aatatcttgg tgaattaaag tgacacgagt attcagtttt aatttttctg 2880 acgataagtt gaatagatga ctgtctaatt caatagacgt tacctgttta cttattttag 2940 ccagtttcgt cgttaaatgc cctttacctg ttccaatttc gtaaacggta tcggtttctt 3000 ttaaattcaa ttgttttatt atttggttga gtactttttc actcgttaaa aagttttgag 3060 aatattttat atttttgttc atgtaatcac tccttcttaa ttacaaattt ttagcatcta 3120 atttaacttc aattcctatt atacaaaatt ttaagatact gcactatcaa cacactctta 3180 agtttgcttc taagtcttat ttccataact tcttttacgt ttccgccatt ctttgctgtt 3240 tcgattttta tgatatggtg caagtcagca cgaacacgaa ccggaattcg agctcggtac 3300 ccaactcaaa ttttgacaga aacagttaaa cagcgaaaaa cggggcggtt cttgttttta 3360 acgttgacgg taaagaatac tacaggggat ttgttgaaga gtgaattacg gcagatggga 3420 cgagccgttg caaagatctt tcagtataaa aaagtggcta aaaatttgtt gggttatgta 3480 cgttcaactg aggttaccat taatcacgaa gcagatcagc cgatgtatca ccaccatatg 3540 catgttttgc tttttatgaa atcgagttat tttacaggaa ctgataatta tatttcacaa 3600 gcagaatgga ctagatattg gcaacgagcg atgaaattag cttatgcgcc agttgtgaat 3660 gttgaagcgg ttaaaccgaa tgtgaaacgc cagaaaaatt ccttactggc tagtgcccaa 3720 gaaacggcta aatatcaggt gaagtccaaa gatattttaa ctaacaatca agaacaagat 3780 ctacaagtaa ttgatgattt ggagcaagct ttggctgggt cccggcaaat tagctatggg 3840 ggcttgctga aagaaattcg caagcagttg caattagaag acgttgaaaa tggggatttg 3900 attaatacgg atagtgatga tcaaaaaact ggtcaggtag tgcgtgaaat tgttgcaaaa 3960 tgggattatc agcgtaaaaa ttattttgtt tggtaaagat aataccaggg tattatcaac 4020 gacaaaaccg ttggatatac cctgattttt tgttgtcgcc attggcgact tctgatacag 4080 attttttggt tttagcacta ctccaattta tttggagtgt aagtgcgcct tgaactaata 4140 tttttgaatt ttgtcattgt cgaaatataa gacaatgcgc acttacacgt cactttcatg 4200 acgtcgtgcg ttctgactga aaaacgtcag aagggcgcac ttatactcca cgaaaataaa 4260 tggggtgtaa gttgcttaaa acctgtatca gaattcgctc cgctcaaact aaaactgacg 4320 ggggtcagtt tgaaacccaa aaagcagata agttcagtcg taaactcctt cgaacttttc 4380 tcctttttgg gttgctctca aaagcccaaa attgccttct aagccatttt aggaattaac 4440 aagctatttc gtcgtctgtc aacggtaaat cgacgtagat agccttattg agccgtacag 4500 gcgaaattag actatctagg aggctttaag gagttgatag actttgcaaa ttgaaagcta 4560 aacggcggaa agcagcttgc ctgttttccc gagcccgact ggcggcgaag tcgaaacggt 4620 caagctggtt cagcttgtca ggtttgggtg aaacccaagg tcttactttt ttggtcgtta 4680 aaactggaaa atttcacaaa ctttttaagc gggtctctct aactagcccg ctacccgttt 4740 gaaaatcaaa ccttttgctt ttttgttcac atgaaaaaat gtggtaatgt tctagtgttt 4800 tagaaagaga tttaaagggg attaataatg ccgaggattg acgaacgtag ttggaaaaag 4860 atttttgaat tgggtaataa cggtaaatac gatgatgaag cgtatgctga gattcttgct 4920 acagtattga atttgcgtgt tgaaaaaggc ttaactcaaa gtgacgttgc gagaatatct 4980 ggtttatcta cgagtatgat ctctaaaatt gaaagtcaat atacagtacc gagtgtaaaa 5040 aatttcttac gatatatttt cgccttagat ttggattggg aactcgttca taaacgttaa 5100 ttgaattttg ggtttaaaaa agaggttcag tatgaacctc ttttttgggg tttgaaagtg 5160 acgttttttg tcactttcct cttatcttga tactattaga aacaacgtca ttttaaaaaa 5220 ctgggataaa cccttgacac aactggactt aggcgtatta tgagtttata aaatgaataa 5280 agaaaaaacc cacgtgagaa ttcctagttt ggcgacccgg aacacgcgag ttaatcttga 5340 atattcgtat ttactagaca tagtttaaag cttgagttag taagcgtcaa gaccttagtt 5400 ttagtaaata cataaaagat tagctcttct cacgtggttg gatgagagga gctttttagt 5460 ttggctgata gaaaagtttt agttgatcga tcgcagtcgg gaaaagtacg accatggcga 5520 gaacataagt tagagaattt acagtatggt gattatttac aaatgttgca ctacaagaaa 5580 gcccatcgag ttaaagagtg tggtgaagta ttacgttttg tagaagataa aaatggtcac 5640 aaaaaattgg ctcagacttg gttttgtcat tcccgtttgt gtccgttatg taattggcgg 5700 cggtcaatga aacaatctaa ccagttgggg atcctctaga gtcttgaaga agtgaagaag 5760 cagagaggct attgaataaa tgagtagaaa gcgccatatc ggcgcttttc ttttggaaga 5820 aaatataggg aaaatggtat ttgttaaaaa ttcggaatat ttatacaata tcatatgttt 5880 cacattgaaa ggggaggaga atcatgaaac aacaaaaacg gctttacgcc cgattgctga 5940 cgctgttatt tgcctcatct tcttgctgcc tcattctgca gcagcggcgg caaatcttaa 6000 tgggacgctg atgcagtatt ttgaatggta catgcccaat gacggccaac attggaagcg 6060 cttgcaaaac gactcggcat atttggctga acacggtatt actgccgtct ggattccccc 6120 ggcatataag ggaacgagcc aagcggatgt gggctacggt gcttacgacc tttatgattt 6180 aggggagttt catcaaaaag ggacggttcg gacaaagtac ggcacaaaag gagagctgca 6240 atctgcgatc aaaagtcttc attcccgcga cattaacgtt tacggggatg tggtcatcaa 6300 ccacaaaggc ggcgctgatg cgaccgaaga tgtaaccgcg gttgaagtcg atcccgctga 6360 ccgcaaccgc gtaatttcag gagaacaccg aattaaagcc tggacacatt ttcattttcc 6420 ggggcgcggc agcacataca gcgattttaa atggcattgg taccattttg acggaaccga 6480 ttgggacgag tcccgaaagc tgaaccgcat ctataagttt caaggaaagg cttgggattg 6540 ggaagtttcc aatgaaaacg gcaactatga ttatttgatg tatgccgaca tcgattatga 6600 ccatcctgat gtcgcagcag aaattaagag atggggcact tggtatgcca atgaactgca 6660 attggacggt ttccgtcttg atgctgtcaa acacattaaa ttttcttttt tgcgggattg 6720 ggttaatcat gtcagggaaa aaacggggaa ggaaatgttt acggtagctg aatattggca 6780 gaatgacttg ggcgcgctgg aaaactattt gaacaaaaca aattttaatc attcagtgtt 6840 tgacgtgccg cttcattatc agttccatgc tgcatcgaca cagggaggcg gctatgatat 6900 gaggaaattg ctgaacagta cggtcgtttc caagcatccg ttgaaagcgg ttacatttgt 6960 cgataaccat gatacacagc cggggcaatc gcttgagtcg actgtccaaa catggtttaa 7020 gccgcttgct tacgctttta ttctcacaag ggaatctgga taccctcagg ttttctacgg 7080 ggatatgtac gggacgaaag gagactccca gcgcgaaatt cctgccttga aacacaaaat 7140 tgaaccgatc ttaaaagcga gaaaacagta tgcgtacgga gcacagcatg attatttcga 7200 ccaccatgac attgtcggct ggacaaggga aggcgacagc tcggttgcaa attcaggttt 7260 ggcggcatta ataacagacg gacccggtgg ggcaaagcga atgtatgtcg gccggcaaaa 7320 cgccggtgag acatggcatg acattaccgg aaaccgttcg gagccggttg tcatcaattc 7380 ggaaggctgg ggagagtttc acgtaaacgg cgggtcggtt tcaatttatg ttcaaagata 7440 gaagagcaga gaggacggat ttcctgaagg aaatccgttt ttttattttg cccgtcttat 7500 aaatttcttt gattacattt tagacctgca ggcatgcaag cttggcactg gccgtcgttt 7560 tacaacgtcg tgactgggaa aaccctggcg ttacccaact taatcgcctt gcagcacatc 7620 cccctttcgc cagctggcgt aatagcgaag aggcccgcac cgatcgccct tcccaacagt 7680 tgcgcagcct gaatggcgaa tggcgcctga tgcggtattt tctccttacg catctgtgcg 7740 gtatttcaca ccgcatatgg tgcactctca gtacaatctg ctctgatgcc gcatagttaa 7800 gccagccccg acacccgcca acacccgctg acgcgccctg acgggcttgt ctgctcccgg 7860 catccgctta cagacaagct gtgaccgtct ccgggagctg catgtgtcag aggttttcac 7920 cgtcatcacc gaaacgcgcg a 7941 <210> 15 <211> 7938 <212> DNA <213> pEm1-4por <400> 15 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60 cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180 aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240 ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300 ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360 tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420 tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480 actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540 gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600 acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660 gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720 acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780 gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840 ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900 gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960 cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020 agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080 catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140 tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260 gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320 taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc 1380 ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440 tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560 cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620 agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980 cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040 cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100 acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160 cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220 accatgatta cgaattccgg ttcgtgttcg tgctgacttg caccatatca taaaaatcga 2280 aacagcaaag aatggcggaa acgtaaaaga agttatggaa ataagactta gaagcaaact 2340 taagagtgtg ttgatagtgc agtatcttaa aattttgtat aataggaatt gaagttaaat 2400 tagatgctaa aaatttgtaa ttaagaagga gtgattacat gaacaaaaat ataaaatatt 2460 ctcaaaactt tttaacgagt gaaaaagtac tcaaccaaat aataaaacaa ttgaatttaa 2520 aagaaaccga taccgtttac gaaattggaa caggtaaagg gcatttaacg acgaaactgg 2580 ctaaaataag taaacaggta acgtctattg aattagacag tcatctattc aacttatcgt 2640 cagaaaaatt aaaactgaat actcgtgtca ctttaattca ccaagatatt ctacagtttc 2700 aattccctaa caaacagagg tataaaattg ttgggagtat tccttaccat ttaagcacac 2760 aaattattaa aaaagtggtt tttgaaagcc atgcgtctga catctatctg attgttgaag 2820 aaggattcta caagcgtacc ttggatattc accgaacact agggttgctc ttgcacactc 2880 aagtctcgat tcagcaattg cttaagctgc cagcggaatg ctttcatcct aaaccaaaag 2940 taaacagtgt cttaataaaa cttacccgcc ataccacaga tgttccagat aaatattgga 3000 agctatatac gtactttgtt tcaaaatggg tcaatcgaga atatcgtcaa ctgtttacta 3060 aaaatcagtt tcatcaagca atgaaacacg ccaaagtaaa caatttaagt accgttactt 3120 atgagcaagt attgtctatt tttaatagtt atctattatt taacgggagg aaataattct 3180 atgagtcgct tttgtaaatt tggaaagtta cacgttacta aagggaatgt agataaatta 3240 ttaggtatac tactgacagc ttccaaggag ctaaagaggt cccgaattcg agctcggtac 3300 ccaactcaaa ttttgacaga aacagttaaa cagcgaaaaa cggggcggtt cttgttttta 3360 acgttgacgg taaagaatac tacaggggat ttgttgaaga gtgaattacg gcagatggga 3420 cgagccgttg caaagatctt tcagtataaa aaagtggcta aaaatttgtt gggttatgta 3480 cgttcaactg aggttaccat taatcacgaa gcagatcagc cgatgtatca ccaccatatg 3540 catgttttgc tttttatgaa atcgagttat tttacaggaa ctgataatta tatttcacaa 3600 gcagaatgga ctagatattg gcaacgagcg atgaaattag cttatgcgcc agttgtgaat 3660 gttgaagcgg ttaaaccgaa tgtgaaacgc cagaaaaatt ccttactggc tagtgcccaa 3720 gaaacggcta aatatcaggt gaagtccaaa gatattttaa ctaacaatca agaacaagat 3780 ctacaagtaa ttgatgattt ggagcaagct ttggctgggt cccggcaaat tagctatggg 3840 ggcttgctga aagaaattcg caagcagttg caattagaag acgttgaaaa tggggatttg 3900 attaatacgg atagtgatga tcaaaaaact ggtcaggtag tgcgtgaaat tgttgcaaaa 3960 tgggattatc agcgtaaaaa ttattttgtt tggtaaagat aataccaggg tattatcaac 4020 gacaaaaccg ttggatatac cctgattttt tgttgtcgcc attggcgact tctgatacag 4080 attttttggt tttagcacta ctccaattta tttggagtgt aagtgcgcct tgaactaata 4140 tttttgaatt ttgtcattgt cgaaatataa gacaatgcgc acttacacgt cactttcatg 4200 acgtcgtgcg ttctgactga aaaacgtcag aagggcgcac ttatactcca cgaaaataaa 4260 tggggtgtaa gttgcttaaa acctgtatca gaattcgctc cgctcaaact aaaactgacg 4320 ggggtcagtt tgaaacccaa aaagcagata agttcagtcg taaactcctt cgaacttttc 4380 tcctttttgg gttgctctca aaagcccaaa attgccttct aagccatttt aggaattaac 4440 aagctatttc gtcgtctgtc aacggtaaat cgacgtagat agccttattg agccgtacag 4500 gcgaaattag actatctagg aggctttaag gagttgatag actttgcaaa ttgaaagcta 4560 aacggcggaa agcagcttgc ctgttttccc gagcccgact ggcggcgaag tcgaaacggt 4620 caagctggtt cagcttgtca ggtttgggtg aaacccaagg tcttactttt ttggtcgtta 4680 aaactggaaa atttcacaaa ctttttaagc gggtctctct aactagcccg ctacccgttt 4740 gaaaatcaaa ccttttgctt ttttgttcac atgaaaaaat gtggtaatgt tctagtgttt 4800 tagaaagaga tttaaagggg attaataatg ccgaggattg acgaacgtag ttggaaaaag 4860 atttttgaat tgggtaataa cggtaaatac gatgatgaag cgtatgctga gattcttgct 4920 acagtattga atttgcgtgt tgaaaaaggc ttaactcaaa gtgacgttgc gagaatatct 4980 ggtttatcta cgagtatgat ctctaaaatt gaaagtcaat atacagtacc gagtgtaaaa 5040 aatttcttac gatatatttt cgccttagat ttggattggg aactcgttca taaacgttaa 5100 ttgaattttg ggtttaaaaa agaggttcag tatgaacctc ttttttgggg tttgaaagtg 5160 acgttttttg tcactttcct cttatcttga tactattaga aacaacgtca ttttaaaaaa 5220 ctgggataaa cccttgacac aactggactt aggcgtatta tgagtttata aaatgaataa 5280 agaaaaaacc cacgtgagaa ttcctagttt ggcgacccgg aacacgcgag ttaatcttga 5340 atattcgtat ttactagaca tagtttaaag cttgagttag taagcgtcaa gaccttagtt 5400 ttagtaaata cataaaagat tagctcttct cacgtggttg gatgagagga gctttttagt 5460 ttggctgata gaaaagtttt agttgatcga tcgcagtcgg gaaaagtacg accatggcga 5520 gaacataagt tagagaattt acagtatggt gattatttac aaatgttgca ctacaagaaa 5580 gcccatcgag ttaaagagtg tggtgaagta ttacgttttg tagaagataa aaatggtcac 5640 aaaaaattgg ctcagacttg gttttgtcat tcccgtttgt gtccgttatg taattggcgg 5700 cggtcaatga aacaatctaa ccagttgggg atcctctaga gtcccatatg agagctcacc 5760 tcgttgatga gctctcatat caattttatt agtttgcttc acctctcacc tccgaacaaa 5820 tcctctcata accgtttcaa caaaataagc caaccaacga aaaacgactt ccagaaaatt 5880 acctgaaaca tataaagaag tttaatatta caagcgccat gcatcacttt tataacaaac 5940 atcaatcgat agcaacatat ttaccaaatt cactaaaaca gcaatgaata ataagattgg 6000 ttgaactata ttattacagt gcaaacacaa ggtttgcact acatccaaac tatttttaat 6060 atccacacat ttaaggataa ataatgaaat taccaatact ctctctactc accattgcca 6120 taaatcctgc tttcgcgaat gactgggatt ctattccaat tcctgcagag ttagacgaag 6180 gtcaacagtg ggagttacaa gaagcttatt ccgactcttt taactactcg ggtaaaaata 6240 ccactttcac gagcaagtgg aacgacacct attttcatgg atggaccggt ccaggtttaa 6300 cttattggca gtcgaacgag tcatgggttt cggatggaaa cctaattatc agcgcatctc 6360 gtcgtcaagg tacagaacaa gttaatgctg gcgttgtaac ctctaagacg aaagtaaaat 6420 atccaatttt catggaagct agaattaaag ttagtaatct agagctttca tcaaattttt 6480 ggttattgag tgaaaatgac gagcgcgaga ttgatattct cgaggtatat ggtggagcga 6540 aggatacctg gtttgcgaaa aacatgtcga ctaacttcca tgttttcctt agaaactctg 6600 ataacacaat taaaagtgat ttcaacgacc aaacacacaa cgaaccaagt tgggggacgt 6660 attggagaga tggtttccac cgctttgctg cctattggaa aagtcctaca gaagtgacgt 6720 tctatataaa tggtgtaaag acaccgaaag gttcgtggga acaagtgttg atgaaagaca 6780 aggattacac tggacaaact ctagataaga gccagtttaa catggatgaa gagatgttca 6840 ttatacttga cactgaagac cattcgtggc gttcagaggc tggtatcgtt gcttctgatg 6900 cggatctagc cgatagctcg aaaaataaaa tgtacgttga ctggattcgt gtttataaac 6960 cagttcgaga caacgataat aacggcattg tccctccgag tgatgcaact agtttacagt 7020 ttattcatag taatagatgt ctcgatgtaa aagatggagc aacgtggaat ggtagtacct 7080 atcaacaatg gagttgcaac acatcaaata gcaatcaacg tttcactttc actccagtat 7140 caaacagtga atatttaatt caatcagata aaagtcaact ctgcgttgag ttaaaaccag 7200 acgcatctca atggaaagat ggtgctacta tccagcagta tatttgtaat tcagcagaag 7260 aaaatcagtt gtggacgtta ttcgacaaag gcagtaacac ttttgagtta agaaataaga 7320 agacgggtaa gtgtcttgag gttgctaata accaagcaac taacggtggt agcattattc 7380 aagcgtcttg tgatggagga aacaaccaac gaattaagtt caagtaaatc gcttgcaacc 7440 taatctaatt agtacattca tttaatgact ttctattaaa tgaatgtgca tttttattgt 7500 tcatcggctc cttctcttcg acctgcaggc atgcaagctt ggcactggcc gtcgttttac 7560 aacgtcgtga ctgggaaaac cctggcgtta cccaacttaa tcgccttgca gcacatcccc 7620 ctttcgccag ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc 7680 gcagcctgaa tggcgaatgg cgcctgatgc ggtattttct ccttacgcat ctgtgcggta 7740 tttcacaccg catatggtgc actctcagta caatctgctc tgatgccgca tagttaagcc 7800 agccccgaca cccgccaaca cccgctgacg cgccctgacg ggcttgtctg ctcccggcat 7860 ccgcttacag acaagctgtg accgtctccg ggagctgcat gtgtcagagg ttttcaccgt 7920 catcaccgaa acgcgcga 7938 <210> 16 <211> 8254 <212> DNA <213> pEm1-4ap <400> 16 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60 cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180 aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240 ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300 ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360 tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420 tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480 actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540 gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600 acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660 gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720 acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780 gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840 ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900 gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960 cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020 agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080 catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140 tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260 gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320 taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc 1380 ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440 tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560 cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620 agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980 cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040 cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100 acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160 cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220 accatgatta cgaattccgg ttcgtgttcg tgctgacttg caccatatca taaaaatcga 2280 aacagcaaag aatggcggaa acgtaaaaga agttatggaa ataagactta gaagcaaact 2340 taagagtgtg ttgatagtgc agtatcttaa aattttgtat aataggaatt gaagttaaat 2400 tagatgctaa aaatttgtaa ttaagaagga gtgattacat gaacaaaaat ataaaatatt 2460 ctcaaaactt tttaacgagt gaaaaagtac tcaaccaaat aataaaacaa ttgaatttaa 2520 aagaaaccga taccgtttac gaaattggaa caggtaaagg gcatttaacg acgaaactgg 2580 ctaaaataag taaacaggta acgtctattg aattagacag tcatctattc aacttatcgt 2640 cagaaaaatt aaaactgaat actcgtgtca ctttaattca ccaagatatt ctacagtttc 2700 aattccctaa caaacagagg tataaaattg ttgggagtat tccttaccat ttaagcacac 2760 aaattattaa aaaagtggtt tttgaaagcc atgcgtctga catctatctg attgttgaag 2820 aaggattcta caagcgtacc ttggatattc accgaacact agggttgctc ttgcacactc 2880 aagtctcgat tcagcaattg cttaagctgc cagcggaatg ctttcatcct aaaccaaaag 2940 taaacagtgt cttaataaaa cttacccgcc ataccacaga tgttccagat aaatattgga 3000 agctatatac gtactttgtt tcaaaatggg tcaatcgaga atatcgtcaa ctgtttacta 3060 aaaatcagtt tcatcaagca atgaaacacg ccaaagtaaa caatttaagt accgttactt 3120 atgagcaagt attgtctatt tttaatagtt atctattatt taacgggagg aaataattct 3180 atgagtcgct tttgtaaatt tggaaagtta cacgttacta aagggaatgt agataaatta 3240 ttaggtatac tactgacagc ttccaaggag ctaaagaggt cccgaattcg agctcggtac 3300 ccaactcaaa ttttgacaga aacagttaaa cagcgaaaaa cggggcggtt cttgttttta 3360 acgttgacgg taaagaatac tacaggggat ttgttgaaga gtgaattacg gcagatggga 3420 cgagccgttg caaagatctt tcagtataaa aaagtggcta aaaatttgtt gggttatgta 3480 cgttcaactg aggttaccat taatcacgaa gcagatcagc cgatgtatca ccaccatatg 3540 catgttttgc tttttatgaa atcgagttat tttacaggaa ctgataatta tatttcacaa 3600 gcagaatgga ctagatattg gcaacgagcg atgaaattag cttatgcgcc agttgtgaat 3660 gttgaagcgg ttaaaccgaa tgtgaaacgc cagaaaaatt ccttactggc tagtgcccaa 3720 gaaacggcta aatatcaggt gaagtccaaa gatattttaa ctaacaatca agaacaagat 3780 ctacaagtaa ttgatgattt ggagcaagct ttggctgggt cccggcaaat tagctatggg 3840 ggcttgctga aagaaattcg caagcagttg caattagaag acgttgaaaa tggggatttg 3900 attaatacgg atagtgatga tcaaaaaact ggtcaggtag tgcgtgaaat tgttgcaaaa 3960 tgggattatc agcgtaaaaa ttattttgtt tggtaaagat aataccaggg tattatcaac 4020 gacaaaaccg ttggatatac cctgattttt tgttgtcgcc attggcgact tctgatacag 4080 attttttggt tttagcacta ctccaattta tttggagtgt aagtgcgcct tgaactaata 4140 tttttgaatt ttgtcattgt cgaaatataa gacaatgcgc acttacacgt cactttcatg 4200 acgtcgtgcg ttctgactga aaaacgtcag aagggcgcac ttatactcca cgaaaataaa 4260 tggggtgtaa gttgcttaaa acctgtatca gaattcgctc cgctcaaact aaaactgacg 4320 ggggtcagtt tgaaacccaa aaagcagata agttcagtcg taaactcctt cgaacttttc 4380 tcctttttgg gttgctctca aaagcccaaa attgccttct aagccatttt aggaattaac 4440 aagctatttc gtcgtctgtc aacggtaaat cgacgtagat agccttattg agccgtacag 4500 gcgaaattag actatctagg aggctttaag gagttgatag actttgcaaa ttgaaagcta 4560 aacggcggaa agcagcttgc ctgttttccc gagcccgact ggcggcgaag tcgaaacggt 4620 caagctggtt cagcttgtca ggtttgggtg aaacccaagg tcttactttt ttggtcgtta 4680 aaactggaaa atttcacaaa ctttttaagc gggtctctct aactagcccg ctacccgttt 4740 gaaaatcaaa ccttttgctt ttttgttcac atgaaaaaat gtggtaatgt tctagtgttt 4800 tagaaagaga tttaaagggg attaataatg ccgaggattg acgaacgtag ttggaaaaag 4860 atttttgaat tgggtaataa cggtaaatac gatgatgaag cgtatgctga gattcttgct 4920 acagtattga atttgcgtgt tgaaaaaggc ttaactcaaa gtgacgttgc gagaatatct 4980 ggtttatcta cgagtatgat ctctaaaatt gaaagtcaat atacagtacc gagtgtaaaa 5040 aatttcttac gatatatttt cgccttagat ttggattggg aactcgttca taaacgttaa 5100 ttgaattttg ggtttaaaaa agaggttcag tatgaacctc ttttttgggg tttgaaagtg 5160 acgttttttg tcactttcct cttatcttga tactattaga aacaacgtca ttttaaaaaa 5220 ctgggataaa cccttgacac aactggactt aggcgtatta tgagtttata aaatgaataa 5280 agaaaaaacc cacgtgagaa ttcctagttt ggcgacccgg aacacgcgag ttaatcttga 5340 atattcgtat ttactagaca tagtttaaag cttgagttag taagcgtcaa gaccttagtt 5400 ttagtaaata cataaaagat tagctcttct cacgtggttg gatgagagga gctttttagt 5460 ttggctgata gaaaagtttt agttgatcga tcgcagtcgg gaaaagtacg accatggcga 5520 gaacataagt tagagaattt acagtatggt gattatttac aaatgttgca ctacaagaaa 5580 gcccatcgag ttaaagagtg tggtgaagta ttacgttttg tagaagataa aaatggtcac 5640 aaaaaattgg ctcagacttg gttttgtcat tcccgtttgt gtccgttatg taattggcgg 5700 cggtcaatga aacaatctaa ccagttgggg atcctctaga gtcgacctgc agtgaaataa 5760 tgtgcttttt gttttttggc gttcagaaat tacttttcca ctgtttgatt taaaattctg 5820 ctaaaaaaca tttaacttta atttaaacta tggtatgatt atgaaatgtt agtgagccga 5880 agctgcgtga tgaaaggctt gctaataaaa atatttattt gtctaaagga gttaaggaaa 5940 cagatgcaga agaaaaaatc cgcacgccat ttgaacaaag tggctgaatt agccgcagca 6000 ctgctcctat cagcgagtcc actggcggga actttccagt cagccgcttg aaacaacaaa 6060 aacggcttta cgcccgattg ctgacgctgt tatttgcgct catcttcttg ctgcctcatt 6120 ctgcagcagc ggcggcaaat cttaatggga cgctgatgca gtattttgaa tggtacatgc 6180 ccaatgacgg ccaacattgg aagcgcttgc aaaacgactc ggcatatttg gctgaacacg 6240 gtattactgc cgtctggatt cccccggcat ataagggaac gagccaagcg gatgtgggct 6300 acggtgctta cgacctttat gatttagggg agtttcatca aaaagggacg gttcggacaa 6360 agtacggcac aaaaggagag ctgcaatctg cgatcaaaag tcttcattcc cgcgacatta 6420 acgtttacgg ggatgtggtc atcaaccaca aaggcggcgc tgatgcgacc gaagatgtaa 6480 ccgcggttga agtcgatccc gctgaccgca accgcgtaat ttcaggagaa caccgaatta 6540 aagcctggac acattttcat tttccggggc gcggcagcac atacagcgat tttaaatggc 6600 attggtacca ttttgacgga accgattggg acgagtcccg aaagctgaac cgcatctata 6660 agtttcaagg aaaggcttgg gattgggaag tttccaatga aaacggcaac tatgattatt 6720 tgatgtatgc cgacatcgat tatgaccatc ctgatgtcgc agcagaaatt aagagatggg 6780 gcacttggta tgccaatgaa ctgcaattgg acggtttccg tcttgatgct gtcaaacaca 6840 ttaaattttc ttttttgcgg gattgggtta atcatgtcag ggaaaaaacg gggaaggaaa 6900 tgtttacggt agctgaatat tggcagaatg acttgggcgc gctggaaaac tatttgaaca 6960 aaacaaattt taatcattca gtgtttgacg tgccgcttca ttatcagttc catgctgcat 7020 cgacacaggg aggcggctat gatatgagga aattgctgaa cagtacggtc gtttccaagc 7080 atccgttgaa agcggttaca tttgtcgata accatgatac acagccgggg caatcgcttg 7140 agtcgactgt ccaaacatgg tttaagccgc ttgcttacgc ttttattctc acaagggaat 7200 ctggataccc tcaggttttc tacggggata tgtacgggac gaaaggagac tcccagcgcg 7260 aaattcctgc cttgaaacac aaaattgaac cgatcttaaa agcgagaaaa cagtatgcgt 7320 acggagcaca gcatgattat ttcgaccacc atgacattgt cggctggaca agggaaggcg 7380 acagctcggt tgcaaattca ggtttggcgg cattaataac agacggaccc ggtggggcaa 7440 agcgaatgta tgtcggccgg caaaacgccg gtgagacatg gcatgacatt accggaaacc 7500 gttcggagcc ggttgtcatc aattcggaag gctggggaga gtttcacgta aacggcgggt 7560 cggtttcaat ttatgttcaa agatagaaga gcagagagga cggatttcct gaaggaaatc 7620 cgttttttta ttttgcccgt cttataaatt tctttgatta cattttataa ttaattttaa 7680 caaagtgtca tcagccctca ggaaggactt gctgacagtt tgaatcgcat aggtaaggcg 7740 gggatgaaat ggcaacgtta tctgatgtag caaagaaagc aaatgtgtcg aaaatgacgg 7800 tatcgcgggt gatcaatcga tcctgagact ggtgtcggat gaattgaaaa aagcttggca 7860 ctggccgtcg ttttacaacg tcgtgactgg gaaaaccctg gcgttaccca acttaatcgc 7920 cttgcagcac atcccccttt cgccagctgg cgtaatagcg aagaggcccg caccgatcgc 7980 ccttcccaac agttgcgcag cctgaatggc gaatggcgcc tgatgcggta ttttctcctt 8040 acgcatctgt gcggtatttc acaccgcata tggtgcactc tcagtacaat ctgctctgat 8100 gccgcatagt taagccagcc ccgacacccg ccaacacccg ctgacgcgcc ctgacgggct 8160 tgtctgctcc cggcatccgc ttacagacaa gctgtgaccg tctccgggag ctgcatgtgt 8220 cagaggtttt caccgtcatc accgaaacgc gcga 8254 <210> 17 <211> 8089 <212> DNA <213> pEm1-4epa <400> 17 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60 cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180 aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240 ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300 ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360 tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420 tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480 actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540 gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600 acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660 gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720 acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780 gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840 ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900 gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960 cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020 agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080 catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140 tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260 gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320 taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc 1380 ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440 tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560 cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620 agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980 cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040 cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100 acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160 cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220 accatgatta cgaattccgg ttcgtgttcg tgctgacttg caccatatca taaaaatcga 2280 aacagcaaag aatggcggaa acgtaaaaga agttatggaa ataagactta gaagcaaact 2340 taagagtgtg ttgatagtgc agtatcttaa aattttgtat aataggaatt gaagttaaat 2400 tagatgctaa aaatttgtaa ttaagaagga gtgattacat gaacaaaaat ataaaatatt 2460 ctcaaaactt tttaacgagt gaaaaagtac tcaaccaaat aataaaacaa ttgaatttaa 2520 aagaaaccga taccgtttac gaaattggaa caggtaaagg gcatttaacg acgaaactgg 2580 ctaaaataag taaacaggta acgtctattg aattagacag tcatctattc aacttatcgt 2640 cagaaaaatt aaaactgaat actcgtgtca ctttaattca ccaagatatt ctacagtttc 2700 aattccctaa caaacagagg tataaaattg ttgggagtat tccttaccat ttaagcacac 2760 aaattattaa aaaagtggtt tttgaaagcc atgcgtctga catctatctg attgttgaag 2820 aaggattcta caagcgtacc ttggatattc accgaacact agggttgctc ttgcacactc 2880 aagtctcgat tcagcaattg cttaagctgc cagcggaatg ctttcatcct aaaccaaaag 2940 taaacagtgt cttaataaaa cttacccgcc ataccacaga tgttccagat aaatattgga 3000 agctatatac gtactttgtt tcaaaatggg tcaatcgaga atatcgtcaa ctgtttacta 3060 aaaatcagtt tcatcaagca atgaaacacg ccaaagtaaa caatttaagt accgttactt 3120 atgagcaagt attgtctatt tttaatagtt atctattatt taacgggagg aaataattct 3180 atgagtcgct tttgtaaatt tggaaagtta cacgttacta aagggaatgt agataaatta 3240 ttaggtatac tactgacagc ttccaaggag ctaaagaggt cccgaattcg agctcggtac 3300 ccaactcaaa ttttgacaga aacagttaaa cagcgaaaaa cggggcggtt cttgttttta 3360 acgttgacgg taaagaatac tacaggggat ttgttgaaga gtgaattacg gcagatggga 3420 cgagccgttg caaagatctt tcagtataaa aaagtggcta aaaatttgtt gggttatgta 3480 cgttcaactg aggttaccat taatcacgaa gcagatcagc cgatgtatca ccaccatatg 3540 catgttttgc tttttatgaa atcgagttat tttacaggaa ctgataatta tatttcacaa 3600 gcagaatgga ctagatattg gcaacgagcg atgaaattag cttatgcgcc agttgtgaat 3660 gttgaagcgg ttaaaccgaa tgtgaaacgc cagaaaaatt ccttactggc tagtgcccaa 3720 gaaacggcta aatatcaggt gaagtccaaa gatattttaa ctaacaatca agaacaagat 3780 ctacaagtaa ttgatgattt ggagcaagct ttggctgggt cccggcaaat tagctatggg 3840 ggcttgctga aagaaattcg caagcagttg caattagaag acgttgaaaa tggggatttg 3900 attaatacgg atagtgatga tcaaaaaact ggtcaggtag tgcgtgaaat tgttgcaaaa 3960 tgggattatc agcgtaaaaa ttattttgtt tggtaaagat aataccaggg tattatcaac 4020 gacaaaaccg ttggatatac cctgattttt tgttgtcgcc attggcgact tctgatacag 4080 attttttggt tttagcacta ctccaattta tttggagtgt aagtgcgcct tgaactaata 4140 tttttgaatt ttgtcattgt cgaaatataa gacaatgcgc acttacacgt cactttcatg 4200 acgtcgtgcg ttctgactga aaaacgtcag aagggcgcac ttatactcca cgaaaataaa 4260 tggggtgtaa gttgcttaaa acctgtatca gaattcgctc cgctcaaact aaaactgacg 4320 ggggtcagtt tgaaacccaa aaagcagata agttcagtcg taaactcctt cgaacttttc 4380 tcctttttgg gttgctctca aaagcccaaa attgccttct aagccatttt aggaattaac 4440 aagctatttc gtcgtctgtc aacggtaaat cgacgtagat agccttattg agccgtacag 4500 gcgaaattag actatctagg aggctttaag gagttgatag actttgcaaa ttgaaagcta 4560 aacggcggaa agcagcttgc ctgttttccc gagcccgact ggcggcgaag tcgaaacggt 4620 caagctggtt cagcttgtca ggtttgggtg aaacccaagg tcttactttt ttggtcgtta 4680 aaactggaaa atttcacaaa ctttttaagc gggtctctct aactagcccg ctacccgttt 4740 gaaaatcaaa ccttttgctt ttttgttcac atgaaaaaat gtggtaatgt tctagtgttt 4800 tagaaagaga tttaaagggg attaataatg ccgaggattg acgaacgtag ttggaaaaag 4860 atttttgaat tgggtaataa cggtaaatac gatgatgaag cgtatgctga gattcttgct 4920 acagtattga atttgcgtgt tgaaaaaggc ttaactcaaa gtgacgttgc gagaatatct 4980 ggtttatcta cgagtatgat ctctaaaatt gaaagtcaat atacagtacc gagtgtaaaa 5040 aatttcttac gatatatttt cgccttagat ttggattggg aactcgttca taaacgttaa 5100 ttgaattttg ggtttaaaaa agaggttcag tatgaacctc ttttttgggg tttgaaagtg 5160 acgttttttg tcactttcct cttatcttga tactattaga aacaacgtca ttttaaaaaa 5220 ctgggataaa cccttgacac aactggactt aggcgtatta tgagtttata aaatgaataa 5280 agaaaaaacc cacgtgagaa ttcctagttt ggcgacccgg aacacgcgag ttaatcttga 5340 atattcgtat ttactagaca tagtttaaag cttgagttag taagcgtcaa gaccttagtt 5400 ttagtaaata cataaaagat tagctcttct cacgtggttg gatgagagga gctttttagt 5460 ttggctgata gaaaagtttt agttgatcga tcgcagtcgg gaaaagtacg accatggcga 5520 gaacataagt tagagaattt acagtatggt gattatttac aaatgttgca ctacaagaaa 5580 gcccatcgag ttaaagagtg tggtgaagta ttacgttttg tagaagataa aaatggtcac 5640 aaaaaattgg ctcagacttg gttttgtcat tcccgtttgt gtccgttatg taattggcgg 5700 cggtcaatga aacaatctaa ccagttgggg atcctctaga gtccggttcg tgttcgtgct 5760 gacttgcacc atatcataaa aatcgaaaca gcaaagaatg gcggaaacgt aaaagaagtt 5820 atggaaataa gacttagaag caaacttaag agtgtgttga tagtgcagta tcttaaaatt 5880 ttgtataata ggaattgaag ttaaattaga tgctaaaaat ttgtaattaa gaaggagtga 5940 ttacatgaaa caacaaaaac ggctttacgc ccgattgctg acgctgttat ttgcctcatc 6000 ttcttgctgc ctcattctgc agcagcggcg gcaaatctta atgggacgct gatgcagtat 6060 tttgaatggt acatgcccaa tgacggccaa cattggaagc gcttgcaaaa cgactcggca 6120 tatttggctg aacacggtat tactgccgtc tggattcccc cggcatataa gggaacgagc 6180 caagcggatg tgggctacgg tgcttacgac ctttatgatt taggggagtt tcatcaaaaa 6240 gggacggttc ggacaaagta cggcacaaaa ggagagctgc aatctgcgat caaaagtctt 6300 cattcccgcg acattaacgt ttacggggat gtggtcatca accacaaagg cggcgctgat 6360 gcgaccgaag atgtaaccgc ggttgaagtc gatcccgctg accgcaaccg cgtaatttca 6420 ggagaacacc gaattaaagc ctggacacat tttcattttc cggggcgcgg cagcacatac 6480 agcgatttta aatggcattg gtaccatttt gacggaaccg attgggacga gtcccgaaag 6540 ctgaaccgca tctataagtt tcaaggaaag gcttgggatt gggaagtttc caatgaaaac 6600 ggcaactatg attatttgat gtatgccgac atcgattatg accatcctga tgtcgcagca 6660 gaaattaaga gatggggcac ttggtatgcc aatgaactgc aattggacgg tttccgtctt 6720 gatgctgtca aacacattaa attttctttt ttgcgggatt gggttaatca tgtcagggaa 6780 aaaacgggga aggaaatgtt tacggtagct gaatattggc agaatgactt gggcgcgctg 6840 gaaaactatt tgaacaaaac aaattttaat cattcagtgt ttgacgtgcc gcttcattat 6900 cagttccatg ctgcatcgac acagggaggc ggctatgata tgaggaaatt gctgaacagt 6960 acggtcgttt ccaagcatcc gttgaaagcg gttacatttg tcgataacca tgatacacag 7020 ccggggcaat cgcttgagtc gactgtccaa acatggttta agccgcttgc ttacgctttt 7080 attctcacaa gggaatctgg ataccctcag gttttctacg gggatatgta cgggacgaaa 7140 ggagactccc agcgcgaaat tcctgccttg aaacacaaaa ttgaaccgat cttaaaagcg 7200 agaaaacagt atgcgtacgg agcacagcat gattatttcg accaccatga cattgtcggc 7260 tggacaaggg aaggcgacag ctcggttgca aattcaggtt tggcggcatt aataacagac 7320 ggacccggtg gggcaaagcg aatgtatgtc ggccggcaaa acgccggtga gacatggcat 7380 gacattaccg gaaaccgttc ggagccggtt gtcatcaatt cggaaggctg gggagagttt 7440 cacgtaaacg gcgggtcggt ttcaatttat gttcaaagat agaagagcag agaggacgga 7500 tttcctgaag gaaatccgtt tttttatttt gcccgtctta taaatttctt tgattacatt 7560 ttattctatg agtcgctttt gtaaatttgg aaagttacac gttactaaag ggaatgtaga 7620 taaattatta ggtatactac tgacagcttc caaggagcta aagaggtccc gacctgcagg 7680 catgcaagct tggcactggc cgtcgtttta caacgtcgtg actgggaaaa ccctggcgtt 7740 acccaactta atcgccttgc agcacatccc cctttcgcca gctggcgtaa tagcgaagag 7800 gcccgcaccg atcgcccttc ccaacagttg cgcagcctga atggcgaatg gcgcctgatg 7860 cggtattttc tccttacgca tctgtgcggt atttcacacc gcatatggtg cactctcagt 7920 acaatctgct ctgatgccgc atagttaagc cagccccgac acccgccaac acccgctgac 7980 gcgccctgac gggcttgtct gctcccggca tccgcttaca gacaagctgt gaccgtctcc 8040 gggagctgca tgtgtcagag gttttcaccg tcatcaccga aacgcgcga 8089 <210> 18 <211> 25 <212> DNA <213> Emr-F <400> 18 cggttcgtgt tcgtgctgac ttgca 25 <210> 19 <211> 25 <212> DNA <213> Emr-R <400> 19 gggacctctt tagctccttg gaagc 25 <210> 20 <211> 23 <212> DNA <213> 322-F <400> 20 ttgaagaagt gaagaagcag aga 23 <210> 21 <211> 26 <212> DNA <213> 322-R <400> 21 taaaatgtaa tcaaagaaat ttataa 26 <210> 22 <211> 20 <212> DNA <213> POR-F <400> 22 ccatatgaga gctcacctcg 20 <210> 23 <211> 18 <212> DNA <213> POR-R <400> 23 gaagagaagg agccgatg 18 <210> 24 <211> 20 <212> DNA <213> pEm1-4aw / op-F <400> 24 tgcagcagcg gcggcaaatc 20 <210> 25 <211> 21 <212> DNA <213> pEm1-4aw / op-R <400> 25 gattctcctc ccctttcaat g 21 <210> 26 <211> 26 <212> DNA <213> pEmw / oORF-F <400> 26 ttctatgagt cgcttttgta aatttg 26 <210> 27 <211> 27 <212> DNA <213> pEmw / oORF-R <400> 27 gtaatcactc cttcttaatt acaaatt 27 <210> 28 <211> 19 <212> DNA <213> a-ORFinitiation-F <400> 28 atgaaacaac aaaaacggc 19 <210> 29 <211> 683 <212> DNA <213> PrtB promoter structure <400> 29 ctgcagtgaa ataatgtgct ttttgttttt tggcgttcag aaattacttt tccactgttt 60 gatttaaaat tctgctaaaa aacatttaac tttaatttaa actatggtat gattatgaaa 120 tgttagtgag ccgaagctgc gtgatgaaag gcttgctaat aaaaatattt atttgtctaa 180 aggagttaag gaaacagatg cagaagaaaa aatccgcacg ccatttgaac aaagtggctg 240 aattagccgc agcactgctc ctatcagcga gtccactggc gggaactttc cagtcagccg 300 ctatgaaaca acaaaaacgg ctttacgccc gattgctgac gctgttattt gcgctcatct 360 tcttgctgcc tcattctgca gctgcagtga aataatgtgc tttttgtttt ttggcgttca 420 gaaattactt ttccactgtt tgatttaaaa ttctgctaaa aaacatttaa ctttaattta 480 aactatggta tgattatgaa atgttagtga gccgaagctg cgtgatgaaa ggcttgctaa 540 taaaaatatt tatttgtcta aaggagttaa ggaaacagat gcagaagaaa aaatccgcac 600 gccatttgaa caaagtggct gaattagccg cagcactgct cctatcagcg agtccactgg 660 cgggaacttt ccagtcagcc gct 683  

Claims (12)

A plasmid comprising a replication origin protein having a nucleotide sequence of SEQ ID NO: 1 and a replication initiation protein gene having a nucleotide sequence of SEQ ID NO: 3. The method of claim 1, The plasmid further comprises at least one selected from the group consisting of a replication origin having a nucleotide sequence of SEQ ID NO: 2, a protein gene having a nucleotide sequence of SEQ ID NO: 5 and a protein gene having a nucleotide sequence of SEQ ID NO: 7. The method of claim 1, The plasmid has a nucleotide sequence of SEQ ID NO: 9. A replication origin having a nucleotide sequence of SEQ ID NO: 1; Replication initiating protein having a nucleotide sequence of SEQ ID NO: 3; Vector comprising multiple cloning sites and selection markers. The method of claim 4, wherein The vector further comprises one or more selected from the group consisting of a replication origin having a nucleotide sequence of SEQ ID NO: 2, a protein gene having a nucleotide sequence of SEQ ID NO: 5 and a protein gene having a nucleotide sequence of SEQ ID NO: 7. The method of claim 4, wherein The multiple cloning site and the selection marker is a vector derived from E. coli vector. A replication origin having a nucleotide sequence of SEQ ID NO: 1; A replication initiation protein gene having the nucleotide sequence of SEQ ID NO: 3; multiple cloning site; Selectable markers; E. coli derived origin of replication; And a vector derived from E. coli and a shuttle vector capable of mutual replication in Lactobacillus and E. coli. The method of claim 7, wherein The shuttle vector is a shuttle vector having a nucleotide sequence selected from the group consisting of SEQ ID NO: 12 to SEQ ID NO: 17. A recombinant vector having a gene of interest inserted in the vector of claim 4. The transformant transformed the host cell with the recombinant vector of claim 9. The method of claim 10, The host cell is E. coli or lactic acid transformants. A host / vector system consisting of the vector of claim 4 or the shuttle vector of claim 7 and the Lactobacillus pentosus strain.

Images