KR101613897B1 - Shuttle vector comprising a promoter inducibly expressed under bile acid and composition comprising the same - Google Patents

Abstract

The present invention relates to a shuttle vector comprising a promoter which is induced by bile acid expression and a composition comprising the promoter. More particularly, the present invention relates to a shuttle vector comprising a promoter inducible by bile acid expression from a genome of Lactobacillus johnsonii strain and a lactobacillus salivarius ( Lactobacillus salvarius ) CPM 7 is linked to an Escherichia coli-derived vector, and a shuttle vector having a characteristic that the expression is specifically increased by bile acids present in the intestines of a human or an animal .
The shuttle vector comprising the promoter in which the expression is induced by bile acid according to the present invention and the composition comprising the same are characterized in that they are specifically expressed and expressed in bile acids present in the intestines of animals, Can specifically express a useful gene and can be used as a vaccine carrier for oral use as well as as a backbone vector for development of probiotics with new functions.

Description

[0001] SHUTTLE VECTOR COMPRISING A PROMOTER INDUCIBLY EXPRESSED UNDER BILE ACID AND COMPOSITION COMPRISING THE SAME [0002] The present invention relates to a shuttle vector comprising a promoter,

The present invention relates to a shuttle vector comprising a promoter which is induced by bile acid expression and a composition comprising the promoter. More particularly, the present invention relates to a shuttle vector comprising a promoter inducible by bile acid expression from a genome of Lactobacillus johnsonii strain and a lactobacillus salivarius A shuttle vector having a property of specifically expressing by a bile acid present in the intestines of a human or an animal produced by linking a lactic acid bacterial plasmid isolated from Lactobacillus salvarius CPM 7 to an Escherichia coli-derived vector will be.

In the human intestines, about 1 kg of microorganisms are inhabited, and the amount of food and the amount of microorganisms are almost the same, and the contents of the feces to be excreted every day occupy about 40% of bacteria except moisture. Microscopic examination of human feces reveals that it is composed of almost homogeneous masses. About 99% of these fungi are anaerobes. In healthy infants who are breastfed, more than 90% of the fecal bacterium is composed of Bifidobacterium , but as the age increases, Bifidobacterium is decreased and the intestinal bacteria are increased. Probiotics is a function that helps maintain the distribution of intestinal microflora in a healthy state during this normal aging process. Probiotics refers to strains that provide a beneficial environment to the intestinal environment when ingested and reached the intestines. In other words, the probiotics that reach the intestine and grow in the intestinal mucosa produce lactic acid, which makes the intestinal inflammation acidic. The number of lactic acid bacteria that can not survive in the acidic environment decreases, and the more beneficial bacteria that grow in acidity, the more it propagates, and the intestinal environment becomes healthier.

Most probiotics known to date are lactic acid bacteria. These lactic acid bacteria have been recognized for a long time as a GRAS (Generally Accepted As Safe) strain and have been used for foods, medicines and animal feed additives. Particularly, Lactobacillus sp. Lactic acid bacteria are attracting attention as candidates for oral carriers due to their acid resistance and resistance to acne, adhesion and adhesiveness to intestinal mucosa, and health promoting effect as probiotics. Currently, gene expression systems using lactic acid bacteria are currently being studied mainly in Europe and the United States. To date, Lactococcus lactis lactis , Lactobacillus < RTI ID = 0.0 > casei), Lactobacillus tareom Plan (Lactobacillus plantarum ) and the like have been developed. However, a vector system that can be expressed specifically by reacting with bile acids present in human or animal intestines has not been developed yet.

Accordingly, the present invention provides a shuttle vector containing a promoter and a lactic acid bacterial plasmid that are induced to express by bile acid from Lactobacillus johnsonii strain, and thus can be specifically expressed in a bile acid present in an intestine of an animal We want to lay the foundation for the development of probiotics for new functions.

Application No. 10-2007-0000797 E. coli-Lactobacillus shuttle vector replicable in lactic acid bacteria and its application

An object of the present invention is for expressing a useful gene specifically via a characteristic that is expressed in response to the specific by the bile acids in the intestine of humans or animals and for use as vaccine carriers for oral, Lactobacillus zone Sony (Lactobacillus johnsonii) A promoter in which expression is induced by a bile acid separated from the genome of the strain and a lactic acid bacterial plasmid isolated from Lactobacillus salvarius CPM 7 are linked to a vector derived from Escherichia coli to express And a shuttle vector having the property that expression is increased.

The above object of the present invention is achieved by providing a shuttle vector having a characteristic of specifically increasing expression by bile acids present in the intestines of a person or an animal.

Also, the shuttle vector is a promoter of a gene encoding a DADA (D-alanyl-D-alanine ligase) protein isolated from Lactobacillus johnsonii genome, and is a promoter of DADA_P (D- alanyl-D-alanine ligase_Promoter).

In addition, the shuttle vector is a plasmid DNA derived from Lactobacillus salivarius CPM 7, which is a lactic acid bacterium that can be used as an oral carrier, and is characterized by comprising a plasmid DNA comprising the nucleotide sequence of SEQ ID NO: 4.

Also, the above object of the present invention can be achieved by a recombinant DNA microarray comprising: a) a promoter of a gene encoding a DADA (D-alanyl-D-alanine ligase) protein from the genome of a Lactobacillus johnsonii strain, Amplifying the DADA_P (D-alanyl-D-alanine ligase_Promoter) promoter region by a PCR method and cloning into a vector; b) isolating Lactobacillus salivarius Lactobacillus salivarius CPM 7, (B) separating the plasmid DNA comprising the nucleotide sequence of SEQ ID NO: 4 with a plasmid DNA derived from Lactobacillus salivarius CPM 7 and cloning the plasmid DNA into a pUC19 vector; c) in order to optimize the size of the vector, Lactobacillus salivarius , a lactic acid bacterium that can be used as an oral carrier, Amplification of an E. coli replication origin site, an ampicillin antibiotic resistance gene and a multiple cloning site (MCS) using a plasmid DNA containing the nucleotide sequence of SEQ ID NO: 4 as a DNA template, , d) constructing a shuttle vector pC19 by ligating each of the amplification products produced in step c) with a restriction enzyme, e) adding a shuttle vector pC19 prepared in step d) to a clone capable of replicating in lactic acid bacteria A plasmid DNA comprising the nucleotide sequence of SEQ ID NO: 4 as a plasmid DNA derived from Lactobacillus salivarius CPM 7, which is a lactic acid bacterium which can be used as an oral carrier isolated in step b), is used as a template, F) amplifying the amplification product produced in step e) with a restriction enzyme , Wherein d) connects the pC19 produced in step step to create pC29, g) Lactobacillus lactic in order to clone the erythromycin (Erythromycin) resistance gene used as a selection marker (selection marker) of the genus Lactobacillus, Bacillus, John Sony ( A step of amplifying an Erythromycin resistance gene using the Lactobacillus johnsonii genome as a template by PCR; h) a step of amplifying the amplified product produced in step g) pC29 to produce pCE29, i) constructing pBCE29 by linking the DADA_P promoter cloned in step a) with pCE29 produced in step h), j) preparing a selection marker of lactic acid bacteria Glucuronidase gene (Beta-glucuronidase) used as a template, pNZ8008 plasmid vector was used as a template and β-glucuronidase ronidase gene by PCR; and k) constructing a shuttle vector by ligating the amplification product produced in step j) with pBCE29 produced in step i) The present invention provides a method for producing a shuttle vector having a characteristic that expression is specifically increased by bile acids present in a human or an intestine of an animal.

In addition, the DADA_P promoter region in step a) is characterized in that it is amplified with a primer set comprising the nucleotide sequence of SEQ ID NO: 2 and SEQ ID NO: 3.

Also, the E. coli replication origin site and the ampicillin antibiotic resistance gene of step c) are amplified with a primer set containing the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6.

In addition, the multiple cloning site (MCS) of step c) is characterized in that it is amplified with a primer set comprising the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8.

In addition, the origin of replication of the lactic acid bacteria in step e) is characterized in that it is amplified with a primer set comprising the nucleotide sequence of SEQ ID NO: 9 and SEQ ID NO: 10.

Also, the Erythromycin resistance gene of step g) is characterized in that it is amplified with a primer set comprising the nucleotide sequence of SEQ ID NO: 11 and SEQ ID NO: 12.

Also, the β-glucuronidase gene of step j) is characterized in that it is amplified with a primer set containing the nucleotide sequence of SEQ ID NO: 13 and SEQ ID NO: 14.

Further, the above object of the present invention is achieved by providing a Lactobacillus transformant transformed with a shuttle vector having a characteristic of specifically increasing expression by bile acids present in a human or animal intestine.

As described above, the shuttle vector containing the promoter in which the expression is induced by bile acid and the composition comprising the same have specific properties to be expressed by reacting with bile acid present in the intestine of an animal, And can be used as a vaccine carrier for oral use as well as as a backbone vector for the development of probiotics with new functions.

1. Plasmid DNA derived from Lactobacillus salivarius CPM 7, which is a lactic acid bacterium which can be used as an oral carrier, and which cleaves a plasmid DNA comprising the nucleotide sequence of SEQ ID NO:
Fig. 2. Cleavage map of pC19 shuttle vector prepared by linking the multi-cloning site (MCS) part with the Escherichia coli origin point region and the site containing the ampicillin antibiotic resistance gene
3. Lactobacillus salivarius CPM 7-derived plasmid DNA, which is a lactic acid bacterium, which can be used as an oral carrier. The plasmid DNA of pC29 produced by linking the replication factor region of the plasmid DNA containing the nucleotide sequence of SEQ ID NO: 4 with the pC19 shuttle vector Shuttle vector clear map
Figure 4. Cleavage map of the pCE29 shuttle vector prepared by linking the plasmid pC29 with the erythromycin resistance gene
Fig. 5. Cleavage map of pBCE29 shuttle vector prepared by linking plasmid pCE29 and DADA_P, a promoter region of DADA gene
6. A shuttle vector cleavage map having a characteristic that expression is specifically increased by bile acid existing in a human or animal intestine produced by linking the plasmid pBCE29 with the? -Glucuronidase gene
Fig. 7. Production process of a shuttle vector having a characteristic that the expression is specifically increased by bile acids present in intestines of a person or an animal capable of replication in Escherichia coli and Lactobacillus sp. Lactic acid bacteria
8. Experimental results confirming the presence or absence of plasmid DNA of Lactobacillus johnsonii lactic acid bacteria isolated from healthy pig feces
9. The results of investigation of the expression level of the? -Glucuronidase gene introduced into the transformed lactic acid bacteria

Hereinafter, the present invention will be described in more detail by way of specific examples.

However, it should be understood that the present invention is not limited by the following examples, and that various changes and modifications can be made therein without departing from the spirit and scope of the present invention.

Example 1 Cloning of Promoter DAD_P Induced by Expression by Bile Acid and Its Sequence Analysis

The promoter whose expression is induced by the bile acid of the present invention is a promoter of a gene encoding DADA (D-alanyl-D-alanine ligase) protein isolated from the genome of Lactobacillus johnsonii strain, As follows.

The upstream part of DADA (D-alanyl-D-alanine ligase) gene, whose expression is increased by the addition of bile acid, was cloned from the genome of Lactobacillus johnsonii strain and named DADA_P. More specifically, DADA_P, which is a promoter that is induced by the bile acid sequence as shown in SEQ ID NO: 1, was amplified from the genomic DNA of Lactobacillus johnsonii using primers as shown in Table 1, and then pGEMT (R) -T easy vector (Promega, USA).

primer Primer sequence Recognized restriction enzyme DADA_P-F 5'-AAC GGGCCC GAGCGTTATCATTATCGGTT-3 ' GGGCCC: Apa I DADA_P-R 5'-AAC GCCGGC ATTTTTATCTCCTTTTTGTCC-3 ' GCCGGC: Nae I

Example 2. Separation of plasmid DNA containing the nucleotide sequence of SEQ ID NO: 4 with plasmid DNA derived from Lactobacillus salivarius CPM 7 which is a lactic acid bacterium which can be used as an oral carrier for plasmid isolation

Colonization occurs well in the intestine of pigs. In order to obtain lactic acid bacteria that can be used as an oral carrier, pig feces collected from Cheonan area pigs are diluted with physiological saline, and then cultured on MRS plate medium containing Na-azide . After incubation at 37 ° C for 48 hours in an anaerobic state, 50 plasmids (Plasmid DNA) were extracted from 50 typical Lactobacillus sp. Colonies, and 2 to 10 kb plasmid DNA Were selected.

16s rRNA gene analysis and phenotype analysis using API CH50L kit were performed to identify Lactobacillus species selected by plasmid analysis. The strain was named " Lactobacillus salivarius CPM 7" and deposited on November 16, 2007 at the Korean Agricultural Microbiology Resource Center (KACC) (Accession No .: KACC 91332P).

To isolate the plasmid DNA from Lactobacillus salivarius CPM 7, Lactobacillus salivarius CPM 7 strain was cultured in MRS liquid medium and then centrifuged to recover the cells. After washing with phosphate buffer, lysozyme and mutanolysin enzyme were added and reacted for 30 to 60 minutes. After the supernatant was removed by centrifugation, the supernatant was removed and then suspended in 100 μl of Solution I (50 mM glucose, 25 mM Tris-Cl, 10 mM EDTA, pH 8.0) and 200 μl of 0.2 M NaOH, 1% SDS Were added and mixed well. 150 mu l of 5M potassium acetate solution (pH 4.8) was added and mixed. After that, it was centrifuged at 12,000 × g for 20 minutes, and the supernatant was recovered. The same volume of phenol: chloroform: isoamyalcohol (25: 24: 1) was added and stirred. The supernatant was recovered by centrifugation at 12,000xg for 20 minutes, and 1/10 volume of 3M NaOAc and 2 times ethanol were added thereto. The mixture was stored at -20 ° C for 30 to 60 minutes, and then stored at 12,000xg for 20 minutes Followed by centrifugation to induce precipitation of plasmid DNA. This was washed gently with 70% ethanol and dried. Then, an appropriate amount of distilled water was added to dissolve the plasmid DNA. Then, electrophoresis was performed on agarose gel of 0.7-1.0% and stained with ethidium bromide (EtBr) to confirm the presence and size of the plasmid DNA.

As a result of treating the plasmid DNA containing the nucleotide sequence of SEQ ID NO: 4 with the plasmid DNA derived from Lactobacillus salivarius CPM 7, which is a lactic acid bacterium usable as the oral carrier thus produced, the restriction enzyme was treated with Sau3A I restriction enzyme recognition Since the site was presumed to exist in one place, pCPM72 treated with Sau3A I restriction enzyme was cloned into pUC19 treated with BamH I (SEQ ID NO: 4, FIG. 1). As a result of the base sequence analysis, the plasmid DNA derived from Lactobacillus salivarius CPM 7, which is a lactic acid bacterium which can be used as an oral carrier, is composed of 2579 bp nucleotide, The G + C content was 30.77%. There are also two ORFs (open reading frames), and it is confirmed that there is an ori (origin of replication) in which 22 bp repeats

Among the two ORFs, ORF 1 was composed of 314 amino acids and showed high homology of 50 to 95% with the replication protein of other lactic acid bacteria. ORF 2 is composed of 144 amino acids and has about 30% homology with other microbial ribbon helix-turn-helix proteins.

Example 3. Preparation of shuttle vector

It was prepared in Lactobacillus bacteria (Lactobacillus) shuttle vector (shuttle vector) - Example 2 E. coli are based on results from an analysis (E. coli).

3-1. minimization of pUC19 vector

In order to optimize the final size of the vector to be completed, the E. coli vector pUC19 was used as a template, and a portion containing the Escherichia coli origin point region and an ampicillin antibiotic resistance gene portion and a multi-cloning site portion were subjected to PCR using the primers shown in Table 2 PCR method. Thereafter, the amplified PCR products were each digested with Nco I restriction enzyme and ligated with T4 DNA ligase to complete 1.85 kb pC19 having a map as shown in FIG.

primer Primer sequence Perceived
Restriction enzyme MCS (multi cloning site) -F 5'-CAACA CCATGG GGGCCCGCCGGCCATATGGCATGCCTGCAGGTC-3 ' CCATGG: Nco I MCS (multi cloning site) -R 5'-ACACA CCATGG GCTAGCTTAGAATTCGAGCTCGGTACC-3 ' CCATGG: Nco I Ap-Ori-F 5'-ACACA CCATGG CAGCTGCTCGAGCCCCTATTTGTTTAT-3 ' CCATGG: Nco I Ap-Ori-R 5'-ACACA CCATGG CTCGAGGTAAAAAGGCCGC-3 ' CCATGG: Nco I

3-2. Cloning of the replication origin of lactic acid bacteria

A plasmid DNA comprising the nucleotide sequence of SEQ ID NO: 4 is used as a plasmid DNA derived from Lactobacillus salivarius CPM 7 which is a lactic acid bacterium which can be used as an oral carrier to clone a replication factor region replicable in Lactobacillus sp. PCR was performed using pCPM-ori-F and pCPM-ori-R as shown in Table 3, and the PCR products were treated with Nhe I restriction enzyme. Thereafter, the pC19 prepared in Example 3-1 was digested with Nhe I restriction enzyme and then ligated with the PCR reaction product and the T4 DNA ligase enzyme to obtain a 2.92 kb DNA fragment having a map as shown in FIG. 3 pC29.

primer Primer sequence Perceived
Restriction enzyme pCPM-ori-F 5'-ACACG GCTAGC AGTGTAATAATTACTC -3 ' GCTAGC: Nhe I pCPM-ORi-R 5'-CAACG GCTAGC ATTATTCTATCCAGT -3 ' GCTAGC: Nhe I

3-3. Cloning of the Erythromycin resistance gene

PCR was performed using the Lactobacillus johnsonii genome as a template in order to clone an erythromycin resistance gene used as a selection marker (selection marker) of Lactobacillus sp. Lactic acid bacteria. Table 4 shows the primers used.

primer Primer sequence Recognized restriction enzyme pCPM-erm-F 5'-AAA CAGCTG TTTCGCAGTAACTCTATTATCAAC -3 ' CAGCTG: Pvu II pCPM-erm-R 5'-AAA CAGCTG GCACCCCTTAACTTTATCTATTAA -3 ' CAGCTG: Pvu II

The amplified 821 bp PCR product and pC29 produced in Example 3-2 were amplified with Pvu Ⅱ restriction enzyme and then ligated with T4 DNA ligase to construct a 3.74 kb pCE29 having the map as shown in Fig.

3-4. Cloning of the bile acid inducible promoter

DADA_P cloned through Example 1 and pCE29 prepared in Example 3-3 were incubated with Apa I and Nae I restriction enzyme, and then ligated with T4 DNA ligase. Thus, 4.24 kb pBCE29 having the map shown in FIG. 5 was prepared.

3-5. Cloning of the beta-glucuronidase gene

The β-glucuronidase enzyme degrades the X-gluc substrate and changes its color to blue. Since the lactobacillus lactic acid bacteria do not have this gene, the β-glucuronidase gene is frequently used as a selection marker for lactic acid bacteria . PCR was performed using a commercially available pNZ8008 plasmid vector as a template. Table 5 shows the primers used. The amplified 1809 bp PCR product and pBCE29 were digested with Nde I and EcoR I restriction enzymes, respectively, and then ligated with T4 DNA ligase, resulting in a 6.05 kb sized human or animal bile map A shuttle vector having the characteristic of specifically increasing the expression was finally produced and the process of producing the shuttle vector having the characteristic that expression is specifically increased by the bile acid present in the human or animal intestine as described above is shown in FIG. Respectively.

primer Primer sequence Recognized restriction enzyme pCPM-glu-F 5'-AGCGGT CATATG TTACGTCCTGTAGAAACCCC-3 ' CATATG: Nde I pCPM-glu-R 5'-AGCGGTGAATTCTCTTGTTTGCCTCCCTGCT-3 ' GAATTC: EcoR I

Example 4. Escherichia coli-Lactobacillus Transformation of Lactobacillus sp. Strain by a shuttle vector having a characteristic of specifically increasing expression by bile acid present in a human or an intestine of an animal

The shuttle vector having the characteristic of specifically increasing expression by the bile acid present in the intestines of the person or animal finally produced through Example 3 was introduced into lactic acid bacteria Lactobacillus johnsonii .

Lactobacillus johnsonii was isolated by diluting pig feces collected from pigs in Cheonan area with physiological saline followed by smearing on MRS plate medium containing Na-azide. Using 16s rRNA gene analysis and API CH50L kit The strain was named " Lactobacillus johnsonii " through phenotypic analysis. As shown in FIG. 7, the strain was found to be suitable as a transforming host because it was a plasmid-free strain.

Lactobacillus johnsonii strain was inoculated on an MRS liquid medium containing 1% glycine and cultured until OD660 = 0.3-0.5, and then left on ice for 10 minutes. Then, the lactic acid bacteria were recovered by centrifugation at 5,000 × g for 20 minutes and then washed twice with phosphate buffer (5 mM sodium phosphate, 1 mM MgCl 2, pH 7.4). Suspended in 100 占 퐇 of 1 mM sucrose, 1 mM MgCl2 (pH 7.4) solution, and then mixed with pBCEG29. After left for a while in ice, electroporation was performed under conditions of 1 to 5 KV and 10 to 50 uF. After adding 500 M of MRS medium and incubating at 37 캜 for 2 to 3 hours, the cells were precipitated and spread on MRS solid medium containing erythromycin at a concentration of 5 to 10 / / ml. After culturing at 37 占 폚 for 48 to 72 hours, the resulting colonies were picked and selected for transformation.

Example 5: Expression of beta-glucuronidase gene by bile acid-dependent expression by DADA_P promoter

The transformed lactic acid bacteria selected in Example 4 were inoculated into an MRS liquid medium containing erythromycin (5-10 μg / μl) and cultured at 37 ° C for 48 hours to 72 hours. 0.1% (v / v) of the culture medium was inoculated again onto the MRS liquid medium containing erythromycin and cultured until OD660 = 0.5, followed by addition of bile acid (Sigma, USA) Lt; / RTI > After completion of the culture, each culture was centrifuged to recover the cells, and the cells were disrupted using an ultrasonic disintegrator. Thereafter, the cell lysate was centrifuged to recover the supernatant, and then the expression level of β-glucuronidase, which is a reporter gene downstream of the DADA_P promoter, was examined to determine whether the DADA_P promoter was dependent on bile acid Respectively. The activity intensity of β-glucuronidase was measured by measuring the optical density at 405 nm using a spectrophotometer by using the color of the sample depending on the degree of decomposition of the X-gluc substrate. As shown in FIG. 9, the absorbance of the sample without addition of bile acid was only 0.11, but the absorbance of the sample added with 0.1% of bile acid and the absorbance of 1.07 and 0.3% of bile acid was 1.43 and the concentration of bile acid was increased The absorbance increased as well. This indicates that the gene expression is induced by the addition of bile acid, and furthermore, the gene expression is also increased as the bile acid concentration is increased. That is, it was confirmed that the DADA_P promoter according to the present invention can regulate the expression of genes downstream of the bile acid-dependent manner.

<110> DANKOOK University Industry Academic Cooperation Foundation <120> SHUTTLE VECTOR COMPRISING A PROMOTER INDUCIBLY EXPRESSED UNDER          BILE ACID AND COMPOSITION COMPRISING THE SAME <130> P14 <160> 14 <170> Kopatentin 2.0 <210> 1 <211> 500 <212> DNA <213> DADA (D-alanyl-D-alanine ligase) <400> 1 gtgatttgag cgttatcatt atcggtttta tttgttgaaa tacttggtaa gtcaaataaa 60 gctcggtaaa aattaatata atctaattga gaattgatat aagaatttgt aacagaaccg 120 ggtgaaaagg gagccgtgag atgaggagtg ctggcataaa gattatctgc attaaaattt 180 tttttaggta aatttttata ttgattttga atttgatgaa cttcttgaat ttcatcttta 240 gtaaaggttg cagcctgtgc gttagtaact ataacggtag aagtagttgt acttaacaca 300 atagttgcta aaaaagtggc tgcttttttg gtaaaagtca taattactcc ttttagcgaa 360 tcatatagta gcatgatagt aatatatata acgtaattat aaaaaaattg cattcttttt 420 agactttttt tcgaaattga tgcattatag cgtcacgatt gtttataata aggtttcgag 480 gacaaaaagg agataaaaat 500 <210> 2 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> DADA_P-F <400> 2 aacgggcccg agcgttatca ttatcggtt 29 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> DADA_P-R <400> 3 aacgccggca tttttatctc ctttttgtcc 30 <210> 4 <211> 2579 <212> DNA <213> The plasmid pCPM72 <400> 4 ggatctgtta ggatacgtac gttcaacaga aatcacagtt aatcgaaaag agaaaagttt 60 tcatcagcat atacatattc ttttagcagt atcgccaaca tattttaaaa agggtcatta 120 tttatctcaa gataattggt ctaaattgtg gcagaaagca cggaaattag attataaacc 180 agtggtaaat attaagactg tttcagacag taagaaagat aaaagccttg ttgcgagtgc 240 aaaagaagtt gcgaagtatc aagttaagag ttctgattac atcactgaag atgttgaaag 300 cgacttggaa tttttaaagg agttagaaaa agctttattt cataaacgtc aactttcatt 360 tggtggagag tttaaagtaa tcagaaaaga attaaaactt gaagatcatg aagatgattt 420 agtacacgtt gatggagaaa atacttctgc tgccgaaaca gaaaaaatta tttttctttg 480 gaataacgaa gtaaaaaatt atgtgaactg gatagaataa tttaagaact ggaatttttt 540 tcagttcttt tttttatttt ttgtttctgg aattgaagta gcagagaaaa tttttcttcc 600 agttattttt cgcaagaaaa aaaggaaact ggaagaaaaa ttattgttta acaaatgttt 660 tacgtaaaat aagcgtaaaa caaagtgtaa attaggtgta aaacaagtgt taaatagctg 720 tgtaacaagc gagaaaatta agtccctaag aaaacgccga tactatcggc tcccacgcac 780 ctgtgggacc attttctctt atgctcttta actctgtact ccagtttaga agatgccaaa 840 attttattct caaaattcgt taagtgggtt tgaagatttt tttctttgtt taattttttt 900 gaaaaagaaa aattaattt aagaaatttt tttggctcaa aattaaattt aaaaatcgaa 960 aatcaaagaa ttaaatcttc aaaagtttca aagcaaacat acaagttatt acaagcctta 1020 aaaatcgttt ctgagacgtt ttaaataaag ctgaatataa ataatagtca aggggcaaaa 1080 aagcgacgta ggagcttttg agacgccgta gggcaaccct tgactatttt aagcataaag 1140 acgctgagaa aaaagaaagc aagcttgctt tctcgagaca cgtgtcggcg aacggttccc 1200 caatgcaatg gggcggaggg gttaagataa tattatttta ttagtagctt taatttgtag 1260 ctacaaaatg ttataataat tttgaggtgg taaagatgtt taaacgtgaa aatagagatg 1320 aagttgtaag acttagagta acgacagaag aaaaagaaat tttaaaaaag tttgctcaag 1380 aaaaagattt gactatgtca gcagtaatag ctcaagcctt agataactat ttggatgcaa 1440 caactccaaa agattttgag caaatggaag tttattataa tggcaaaaag gataaagcat 1500 tgacacgtaa agctcaaaat gccttagctt tttctaaacg ctatgatgaa atcatgggca 1560 ataagacttc tttgtttgat atggaaaaag aatatcaaga acattatttt gagagattga 1620 aaaaattggt tgctgaagat gaagaattga aaaagttgag aaaattgcag tcaaagaaag 1680 caaaaattga gcagtaaaaa agttggcttt agccaacttt taaactcgcg aagcgagttt 1740 cttcttatct tgatactata tagaaataac gccatttttt ttttgagtca aaaaaagtgc 1800 gataaacgtt gatataataa cgtttataag gggtcaaaaa ggtcgaaaat gggttgaatg 1860 gattgtttat aatattttaa ctttttatga ctttttggct tgtatagatt tttttgaaaa 1920 ttgagggtat actcgttttt agaataaaaa aattaatgca aaaaaaaact catgctgaaa 1980 gtttgggacg acctaagcaa gagttttaaa gcaaaatatt attgtgttta ttacggtttt 2040 agtgtaataa ttactcacta cattatagag atgttaggtg gaatagtcaa taattgttgt 2100 tataatgctt taggactctg acagcatgag taaagaaagg aagttcttct catgtttgga 2160 gatgaaattt tagtagataa ggcaaaaaat ggcaaggtta gaccctggaa agaaaagaaa 2220 ttagctaatt taacctatgc tgaatattta cagattctgg aaataaaaaa agcttttaga 2280 gt; caaacatggt tttgtaagag tcgcctatgt ccattgtgtg cttggcgtta cgctatgaaa 2400 aatagctatg aattgagttc gattttagat gtcttttata aacgatatcc aaaatcaaga 2460 tttttatttt taactctaac tgaagaaaac gcaaaacagg gagaattaaa agaaaaatta 2520 gctgagatga acagggcttt atataagctt tttcagtata aaaaagttca aaaggatcc 2579 <210> 5 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Ap-Ori-F <400> 5 acacaccatg gcagctgctc gagcccctat ttgtttat 38 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Ap-Ori-R <400> 6 acacaccatg gctcgaggta aaaaggccgc 30 <210> 7 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> MCS (multi cloning site) -F <400> 7 caacaccatg ggggcccgcc ggccatatgg catgcctgca ggtc 44 <210> 8 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> MCS (multi cloning site) -R <400> 8 acacaccatg ggctagctta gaattcgagc tcggtacc 38 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> pCPM-ori-F <400> 9 acacggctag cagtgtaata attactc 27 <210> 10 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> pCPM-ori-R <400> 10 caacggctag cattattcta tccagt 26 <210> 11 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> pCPM-erm-F <400> 11 aaacagctgt ttcgcagtaa ctctattatc aac 33 <210> 12 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> pCPM-erm-R <400> 12 aaacagctgg caccccttaa ctttatctat taa 33 <210> 13 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> pCPM-glu-F <400> 13 agcggtcata tgttacgtcc tgtagaaacc cc 32 <210> 14 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> pCPM-glu-R <400> 14 agcggtgaat tctcattgtt tgcctccctg ct 32

Claims (11)

D-alanyl-D-alanine ligase (DADA) protein isolated from Lactobacillus johnsonii genome as a shuttle vector having a specific expression increase by bile acid present in human or animal intestine (D-alanyl-D-alanine ligase_Promoter) consisting of the nucleotide sequence of SEQ ID NO: 1 as the promoter of the coding gene and the plasmid DNA derived from Lactobacillus salivarius CPM 7 which is the lactic acid bacterium which can be used as an oral carrier. 4 &lt; / RTI &gt; comprising the plasmid DNA. delete delete a) a promoter of a gene coding for DADA (D-alanyl-D-alanine ligase) protein from the genome of Lactobacillus johnsonii strain, DADA_P (D-alanyl-D-alanine ligase_Promoter) promoter region by a PCR method and cloning into a vector;
b) Lactobacillus raised bariwooseu (Lactobacillus salivarius) CPM raised lactic acid bacteria of Lactobacillus bacteria that can be used as oral carriers from the 7 strains bariwooseu (Lactobacillus salivarius) CPM separate the plasmid DNA consisting of a plasmid DNA of 7 derived from the nucleotide sequence of SEQ ID NO: 4, pUC19 Cloning into a vector;
c) In order to optimize the size of the vector, a plasmid DNA consisting of the nucleotide sequence of SEQ ID NO: 4 as the plasmid DNA derived from Lactobacillus salivarius CPM 7, which is a lactic acid bacterium usable as an oral carrier prepared in the step b) Amplifying an E. coli replication origin site, an ampicillin antibiotic resistance gene and a multiple cloning site (MCS) by a PCR method;
d) constructing a shuttle vector pC19 by ligating each of the amplification products produced in the step c) with a restriction enzyme;
e) Lactobacillus salivarius CPM 7, which is a lactic acid bacterium which can be used as an oral carrier isolated in step b) for cloning a replication factor region replicable in lactic acid bacteria in the shuttle vector pC19 produced in step d) Amplifying the origin of replication of the lactic acid bacteria using a plasmid DNA consisting of the nucleotide sequence of SEQ ID NO: 4 as a plasmid DNA as a template;
f) constructing pC29 by ligating the amplification product produced in step e) with pC19 produced in step d) after the restriction enzyme treatment;
g) an Erythromycin resistance gene having the genome of Lactobacillus johnsonii as a template for cloning an Erythromycin resistance gene used as a selection marker of Lactobacillus sp. A PCR method;
h) constructing pCE29 by ligating the amplification product produced in step g) with pC29 produced in step f), followed by restriction enzyme treatment;
i) constructing pBCE29 by ligating the DADA_P promoter cloned in step a) to the pCE29 produced in step h) after restriction enzyme treatment;
j) In order to clone the beta-glucuronidase gene used as a selection marker of lactic acid bacteria, beta-glucuronidase gene was amplified by PCR using pNZ8008 plasmid vector as a template Amplifying; And
k) constructing a shuttle vector by ligating the amplification product produced in step j) with pBCE29 produced in step i), after the restriction enzyme treatment; Wherein the expression of the shuttle vector is specifically expressed by a bile acid present in the intestines of a person or an animal, 5. The method of claim 4,
Wherein the DADA_P promoter region in step (a) is amplified with a primer set consisting of the nucleotide sequence of SEQ ID NO: 2 and SEQ ID NO: 3, wherein the expression of the DADA_P promoter is specifically amplified by bile acids present in the intestines of a human or animal. Lt; / RTI &gt; 5. The method of claim 4,
Wherein the E. coli replication origin site and the ampicillin antibiotic resistance gene of step c) are amplified with a primer set consisting of the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6. Wherein the expression of the shuttle vector is expressed by a specific expression. 5. The method of claim 4,
Wherein the multiple cloning site (MCS) of step c) is amplified with a primer set consisting of the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8. 5. The method of claim 4,
Wherein the origin of replication of the lactic acid bacteria in step e) is amplified with a primer set consisting of the nucleotide sequences of SEQ ID NO: 9 and SEQ ID NO: 10, characterized in that the expression is specifically increased by bile acids present in the intestines of humans or animals / RTI &gt; 5. The method of claim 4,
Wherein the erythromycin resistance gene of step g) is amplified with a primer set consisting of the nucleotide sequences of SEQ ID NO: 11 and SEQ ID NO: 12, wherein the erythromycin resistance gene is specifically expressed by a bile acid present in the intestines of a human or animal. Lt; RTI ID = 0.0 &gt; a &lt; / RTI &gt; shuttle vector. 5. The method of claim 4,
Wherein the β-glucuronidase gene of step j) is amplified with a primer set consisting of the nucleotide sequences of SEQ ID NO: 13 and SEQ ID NO: 14. Wherein the expression of the shuttle vector is expressed by a specific expression. 10. A Lactobacillus intransformant transformed with a shuttle vector having the characteristic that the expression is specifically increased by bile acids present in the intestines of a person or an animal produced by any one of claims 6 to 10.

Images