CN101111599B - Expression carrier used for treating bacterial infection - Google Patents

Abstract

The present invention is compositions and methods for producing anti-bacterial polypeptides, and for using those compositions and methods for treating diseases and conditions caused by a bacterial infection. More specifically, the compositions and methods include treating a gram-negative bacterium with a gram-positive host that produces a polypeptide effective against the gram-negative bacterium.

Description

Be used for the treatment of the expression vector that bacterium infects

The application is the part continuation application of U.S.'s sequence number 09/883,34360/054 (submission on June 19 calendar year 2001), and the latter is the continuation application of U.S.'s sequence number 08/924,629 (now United States Patent (USP) 6,403,082); Part continuation application with U.S.'s sequence number 10/916,641 (submission on August 9th, 2004).

I. invention field

The present invention relates to expression vector, it can be used at least a heterologous gene being transferred to gram negative bacterium, preferred lactic-acid-bacterium (LAB) and expressing therein.The invention still further relates to the antibacterium purposes of host, the heterologous gene products that transforms, the fermented product that contains described host and/or gene product or its combination.

II. background of invention

Many bacteriums produce antibacterium peptide or protein (for example, bacteriocin), and it has activity to other bacteriums, common closely-related bacterium usually.The exemplary lists of bacterium and their bacteriocin is displayed in Table 1.

Typical bacteriocin is the Colicine that intestinal bacteria (Escherichia coli) produce.Most Colicines are relatively large protein compounds, and it is not secreted on one's own initiative from bacterial cell.The Microbial anticorrosive additive that intestinal bacteria produce is from the peptide of emiocytosis or polypeptide and be translated rear modification (I quasi-microorganism element) or be not (the II quasi-microorganism element) of posttranslational modification by special output pathway.Posttranslational modification need to produce the enzyme of the peptide of modifying the rrna translation.

The bacteriocin that LAB produces has activity to other gram positive bacteriums, particularly closely-related LAB usually.Similarly, the bacteriocin of gram negative bacterium generation has activity to Gram-negative target bacterial strain.For example, a kind of bacteriocin Colicine V of intestinal bacteria generation has activity to multiple other intestinal bacteria.

Colicine V is the first Colicine of finding from intestinal bacteria.It is II quasi-microorganism element, and it is synthetic as 105 amino acid whose propetides (leader sequence+bacteriocin), and it is cut and discharges 88 amino acid whose mature peptides.Colicine V operon comprises structure gene, immunity gene and two special transporter genes.

Many LAB produce bacteriocin, comprise wool sulphur antibacterial peptide (I class); Non-wool sulphur antibacterial peptide (II class); And protein (III class).The wool sulphur antibacterial peptide that Lactococcus lactis subsp.lactis (Lactococcus lactis subsp.lactis) produces such as nisin are translated rear modification and have genetic manipulation by 11 kinds of genomic constitutions, are used for their synthetic, immunity, modification and export from cell.Non-lantibiotics (II class) bacteriocin is being similar to Colicine V aspect the hereditary complicacy.These bacteriocins produce with propetide, and it is cut the ripe peptide of formation and exports from cell in the mode identical with Colicine V, for example, and carno bacteriocin s A and B2, leucocin A and pediocin PA-1.Blazon the generation of the non-lantibiotics divergicin A that meat bacillus (Carnobacterium divergens) UAL9 produces and only need two kinds of genes from emiocytosis.Secrete under the control of general secretion (sec) approach that is in cell.Predivergicin A is comprised of signal peptide and divergicin A.A kind of gene or nucleotide coding bacteriocin.Another kind of genes encoding immune protein.

Do not find also that so far the bacteriocin that LAB produces has activity to gram negative bacterium such as intestinal bacteria.More be apparent to reason owing to hereinafter becoming, wish to select generation to the Gram-positive host of the activated bacteriocin of one or more gram negative bacteriums.For example, if with LAB genetic modification (GMO) to produce bacteriocin (such as Colicine V) or to the activated bacteriocin of another kind of target bacteria, LAB can decide intestinal bacteria by target so.

In addition, use to express effectively the gram positive bacterium for the bacteriocin of gram negative bacterium, can decide gram negative bacterium such as intestinal bacteria by target, prompting may exist also arbitrary disease of causing for gram negative bacterium or alternative or additional therapy or the prophylactic treatment scheme of situation.The example of this situation is diarrhoea (PWD) after the wean, is also referred to as scours, and it is caused by the intestinal bacteria in the pig.

The outburst of intestinal bacteria PWD or scours is the problem that occurs during pig produces.PWD or scours cause losing weight significantly of infected animal usually.

Need between period of infection, promote the treatment that body weight increases or causes at least body weight further not alleviate.

II. summary of the invention

The invention provides the technology of the use that depends on LAB, described LAB is decided the heterologous polypeptide of the pathogenic agent of disease by genetic modification (GMO) to produce specific target, such as bacteriocin.A kind of perhaps many specific end use of the compositions and methods of the invention comprise suffer from diarrhoea after the wean that causes of enterotoxigenic Escherichia coli in the weanling pig for the treatment of (PWD).

This technology can be applied to Gram-positive LAB and grow in specific environment and do not cause harm anywhere.These environment comprise animal-feed, such as silage; Food and anoxic or the vacuum-packed food of fermentation are such as that give birth to and food, vegetables and dough product processing; And animal (and people) gi tract (GI) or genitourinary tract.

In addition, some LAB bacterial strains can be (that is, promotion health) that benefit is given birth to, but their " target is fixed " special pathogens not.According to the present invention, some LAB can be by genetic modification and for special pathogen, such as intestinal bacteria.In addition, composition of the present invention and/or method can be the large rather than healing property of prevention.In these embodiments of the present invention, composition and method can be effectively as feeding the microbiotic of raising inferior treatment level such as substituting for the preventive of GI disease.

Accompanying drawing has shown the property illustrated embodiment of the present invention, and the purpose of these and other, novel feature and advantage will be apparent from these embodiments.

IV. accompanying drawing summary

Fig. 1 is the diagram of pCaT.

Fig. 2 is the diagram of pCV22, and illustrates with Colicine V (col V) Gene Replacement pCaT motion gene (mob).

Fig. 3 is the diagram of pCB12, and illustrates with meat Bacillaceae (Carnobacterium) immunity gene (cbiA) replacement pCaT streptomycin resistance gene and Replb gene.

Fig. 4 is pCB15 to diagram, and illustrates with brochocin C immunity gene (brcl) and replace cbiA gene ground pCB12.PCB15 comprises that Colicine V (diagram to) and pCB15s comprise Colicine VM (not diagram).

Fig. 5 provides Nucleotide and the aminoacid sequence of Colicine V and Colicine VM.Fig. 5 A and 5C have shown respectively the large Nucleotide of Colicine V and aminoacid sequence; Fig. 5 B and 5D have shown respectively Nucleotide and the aminoacid sequence of Colicine VM.

Fig. 6 is the diagram of pCB21, and illustrates from pCB15 and remove the EcoRV restriction site.

Fig. 7 is the diagram of pCB22, and illustrates from pCB21 and remove the cat gene.

Fig. 8 is the diagram of pCB23m and a kind of feed grade carrier; And illustrate the change of the Colicine VM gene (col VM) in the pCB23m of Colicine V gene among the pCB22.

Fig. 9 is the diagram of pCB19, and illustrates and comprise the polylinker that contains a plurality of cloning sites.

Figure 10 is the nucleotide sequence of p15 promotor.

Figure 11 is the recombinant PCR technology for generation of the dna fragmentation that contains p15 promotor and Colicine V gene.Mark restriction site (EcoRI and KpnI) and the primer that uses.PGKV210-p15 and pCB15 are as the template of first round PCR.SP=signal peptide divergicin A; ColV=Colicine V gene; The p15=p15 promotor.

Figure 12 is the diagram of pCB101.

Figure 13 is the diagram of pCB103.

Figure 14 is the diagram of pCB104.

Figure 15 is the diagram of pCB110.

Figure 16 illustrates expression vector pMvB of the present invention.

V. detailed Description Of The Invention

The present invention relates to for expressing gram (-) polypeptide Gram-positive host such as lactic-acid-bacterium, such as composition and the method for bacteriocin.The present invention comprises that also the polypeptide that the host of Gram-positive host according to genetic modification of the present invention, this genetic modification produces, the composition that comprises GMO bacterium and/or polypeptide and its are combined in the purposes in the treatment sensitive bacterial.

The present invention also comprises and is suitable for transforming Gram-positive host and secretion effectively for the expression vector of gram negative bacterium.In these embodiments of the present invention, the technician will recognize easily that expression vector can be according to the promotor of host's selection, use and polypeptide and structure differently.In a preferred embodiment of the invention, expression vector comprises signal peptide, preferred diVergicin a-signal peptide, and at least one bacteriocin immunity gene.In the most preferred embodiment of the present invention, expression vector is suitable for use in LAB host.

The present invention also comprises and is used for the treatment of disease that sensitive bacterial and sensitive bacterial cause or composition and the method for situation.In a preferred embodiment of the invention, some compositions of the present invention and method are used for the treatment of intestinal bacteria.In the most preferred embodiment of the present invention, composition and method are used for the treatment of scours.

One embodiment of the invention comprise for suddenly change the to get expression vector of Colicine V bacteriocin (being called Colicine VM) of expression.In this embodiment of the present invention, expression vector comprises the nucleotide sequence of coding Colicine VM.The Exemplary core nucleotide sequence includes but not limited to show those among Seq.I.D.No.1 and the Seq.I.D.No.3.Those that exemplary amino acid sequence includes but not limited to show among Seq.I.D.No.2 and the Seq.I.D.No.4.Other conventional elements that those skilled in the art will recognize that multiple promotor signal peptide, selective marker and functional expression carrier can be used for expressing Colicine VM.

Exemplary of the present invention comprises the pCB carrier, and it comprises P15 or P32 promotor; Divergicin a-signal peptide; The nucleotide sequence of coding Colicine VM; Selective marker includes but not limited to bacteriocin immunity gene (such as brochocin C); With one or more suitable duplicate fields.In the expression vector that in Fig. 4, shows, expression vector comprises the nucleotide sequence of P32 promotor, divergicinA signal peptide, coding Colicine VM, the nucleotide sequence of coding brochocin C immunity gene, with (see Jewell, wait the people from the moving duplicate field Rep1A of pCaT and RepB; Current Microbiology:19:343-346 (1989)).

In a preferred embodiment of the invention, the host of expression vector and expression vector conversion is food or feed grade.In the most preferred embodiment of the present invention, host and expression vector do not contain coding or give gene or the nucleotide sequence of antibiotics resistance.

Another embodiment of the present invention comprises the host cell that expression vector of the present invention transforms.In a preferred embodiment of the invention, composition and method lactobacillus reuteri (Lactobacillusreuteri) the host CB4 that comprises CB4, transform with the expression vector of the nucleotide sequence that contains coding Colicine VM bacteriocin.CB4 is deposited in American type culture collection (10801University Boulevard, Manassas, Virginia USA20118) on December 8th, 2004.Preserving number is PTA-6426.

In these embodiments of the present invention, one or more polypeptide can be expressed or secrete to the host lactic-acid-bacterium, comprises one or more bacteriocins, and comprise the expression vector that allows as described herein one or more bacteriocins of secretion.Can in host bacteria, introduce expression vector by joint, conversion, protoplast fusion or other genes or Nucleotide transfer method.

Another embodiment of the present invention comprises expression vector and its using method, and wherein carrier comprises and is selected from but is not limited to the bacteriocin immunity gene of brochocin C and carno bacteriocin A.

Another embodiment of the present invention comprises animal-feed, bacterium or its combination that its host who comprises the host bacteria that transforms with expression vector of the present invention, conversion of the present invention produces.

Another embodiment of the present invention comprises probiotic composition, bacterium or its combination that its host who comprises the host bacteria that transforms with expression vector of the present invention, conversion of the present invention produces.

Another embodiment of the present invention comprises the method for the bacterium infection of using among combination treatment animal or the people, and described composition comprises bacterium or its combination of host's generation of the host bacteria that transforms with expression vector of the present invention, conversion of the present invention.

Another embodiment of the present invention comprises and being used for the treatment of responsive any colibacillary composition and the method for arriving of the bacteriocin of expressing according to the present invention.Preferred composition of the present invention comprises disease and the situation that treatment intestinal bacteria and/or intestinal bacteria cause.The most preferred embodiment of the present invention comprises that the wean venter posterior rushes down or scours in the treatment pig, and/or promotes body weight to increase or prevent to lose weight.

Expression vector of the present invention can be from LAB, especially the LAB of lactobacillus.Plasmid of the present invention can advantageously be stablized to transfer to and belongs in meat Bacillaceae (Carnobacterium), leuconos toc (Leuconostoc), lactobacillus, Pediococcus (Pediococcus) or enterococcus spp (Enterococcus) etc. etc. the lactic-acid-bacterium.

The invention still further relates to plasmid or with the host of previously defined Plasmid Transformation; described plasmid comprises nucleotide sequence SEQID No.1 or Seq.LD.No.3, perhaps by inserting, lack or suddenling change one to several base pairs and and the still sequence of the ability of conservative replication different from this sequence.The invention still further relates to plasmid or with the host of previously defined Plasmid Transformation, described plasmid expression comprises the aminoacid sequence of Seq.ID No.2 or Seq.LD.No.4 or by inserting, lack or the sequence of the ability of and the conservative replication different from this sequence to several amino acid that suddenlys change.

The invention still further relates to the expression vector as showing among Fig. 2-4,6-9 and 12-15, this carrier comprise as directed nucleotide sequence or by insert, lack or suddenly change one to several to and different from this sequence and keep plasmid in suitable host bacterium such as LAB, to stablize the sequence of replication.

The invention still further relates to the bacterial host cell that comprises according to expression vector of the present invention.Exemplary expression carrier of the present invention includes but not limited to pJKM37, pCV22, pCB12, pCB15, pCB15s, pCB21, pCB22, pCB23M, pCB19, pGKV210, pGKV210-P15, pCB101, pCB103, pCB104, pCB110 and pCB111.The exemplary host of at least a conversion by these expression vectors includes but not limited to two kinds of other bacterial strains of Carnobacterium maltaromaticum UAL26, lactobacillus reuteri CB4, lactobacillus reuteri and a kind of bacterial strain of Lactobacillus johnsonii (Lactobacillusjohnsonii).

Because can be used for the wide region of the host cell of conversion purpose, plasmid according to the present invention has formed the outstanding instrument that is used at host LAB clone and expressing heterologous nucleotide sequence.

Particularly, plasmid of the present invention can be used for expressing heterologous protein, and the protein such as bacteriocin and anti-these bacteriocins is also referred to as immune protein.

Each of these compositions will be described now in more detail.

According to the present invention, can use any appropriate host bacterium.In a preferred embodiment of the invention, host bacteria is gram positive bacterium.In the most preferred embodiment of the present invention, host bacteria is lactic-acid-bacterium (LAB).Exemplary appropriate host includes but not limited to, those shown in table 1 and the embodiment.Being chosen within these those skilled in the art limit of power of appropriate host.

In a preferred embodiment of the invention, the host is lactobacillus reuteri.In the most preferred embodiment of the present invention, the host is L. reuteri strain CB4.

According to the present invention, can be suitable for use in any promotor of expressing the bacteriocin gene.For example, can use the arbitrary promotor compatible with host strain, wherein use excretory system of the present invention.The selection of suitable promotor and concrete promotor is that those skilled in the art are apparent.Suitable exemplary promotor includes but not limited to P15 and P32.See the United States Patent (USP) 5,939,317 that for example is incorporated herein by reference.In a preferred embodiment of the invention, expression vector comprises the P15 promotor, its effective binding purposes bacteriocin gene.According to the present invention, can use the promotor (seeing Figure 10) that has corresponding to the nucleotide sequence of Seq.ID No.5.

According to the present invention, can use to be suitable for use in any signal peptide of expressing the bacteriocin gene.Suitable signal peptide includes but not limited to, the signal peptide of divergicin A.In a preferred embodiment of the invention, expression vector comprises divergicin a-signal peptide, its effective binding purposes bacteriocin gene.According to the present invention, can use to have corresponding to United States Patent (USP) 6,403, the signal peptide of those disclosed nucleotide sequence is incorporated herein by reference this patent among 082 people such as () Stiles.

According to the present invention, can use any bacteriocin gene.See for example table 1.Suitable bacteriocin gene includes but not limited to Colicine V, Colicine Y101, Colicine VM, leucocin A and brochocin-C.In a preferred embodiment of the invention, expression vector comprises one or more Nucleotide or gene of the bacteriocin above the coding.In the most preferred embodiment of the present invention, expression vector comprises nucleotide sequence or the gene of coding Colicine VM.The Exemplary core nucleotide sequence of bacteriocin is well known to a person skilled in the art.See for example United States Patent (USP) 6,403,082 (Stiles waits the people).

According to the present invention, composition and method comprise host and/or expression vector, it comprises nucleotide sequence or the gene of the Colicine V of encoding mutant, and this nucleotide sequence or gene contain following nucleotide sequence gtggctggaggtgtggctggaggt (Seq.I.D.No.1).See Fig. 5 B.In the most preferred embodiment of the present invention, composition and method comprise host and/or expression vector, it comprises nucleotide sequence or the gene of the Colicine V of encoding mutant, and nucleotide sequence or gene contain the nucleotide sequence shown in Fig. 5 B (Seq.I.D.No.3).

According to the present invention, composition and method comprise host and/or expression vector, the Colicine VM aminoacid sequence VAGGVAGG (Seq.LD.No.2) that its coding is following.In the most preferred embodiment of the present invention, composition and method comprise host and/or expression vector, and its coding is corresponding to the Colicine VM aminoacid sequence of Seq.I.D.No.4.See Fig. 5.

According to the present invention, can use to be suitable for use in any selective marker of expressing the bacteriocin gene.Suitable selective marker includes but not limited to the bacteriocin gene of carno bacteriocin A, piscicolin126 and brochocin-C; And antibiotics resistance gene, such as paraxin, erythromycin and streptomycin resistance gene.In a preferred embodiment of the invention, expression vector comprises bacteriocin immunity gene, preferred brochocinC immunity gene, its effective binding purposes bacteriocin gene.The Exemplary core nucleotide sequence of immunity gene is well known to a person skilled in the art.For example see, United States Patent (USP) 6,403,082 (Stiles waits the people) is introduced into this paper as a reference.As mentioned above, can wish very much to produce and use feed grade carrier and host; Examples of such carriers and host lack the function antibiotics resistance gene, and according to the present invention, comprise nucleotide sequence or the gene of coding bacteriocin immunity.

The present invention also comprise by with following composition with or contact bacterium or animal treat method that bacterium infects or the method for the treatment of animal (comprising the people): the composition that comprises one or more hosts that transform by expression vector of the present invention; The composition that comprises one or more bacteriocins that produce by the host who transforms; One or more bacteriocins (seeing for example table 1) that natural generation or GMO produce; Perhaps its combination.

In a preferred embodiment of the invention, any composition of the present invention can be used for the treatment of bacillus coli or situation, includes but not limited to scours.In some embodiments of the present invention, any composition of the present invention can be used for promoting that the body weight of experimenter animal increases.In some embodiments of the present invention, any composition of the present invention can be used for the treatment of or affect the intrinsic micro-flora among the subject experimenter.

One embodiment of the invention comprise expression vector pMvB, and it comprises suitable promotor, for example, and P15; The coded signal peptide, for example, the DNA of divergicin a-signal peptide; Coded polypeptide, for example, the coding bacteriocin, include but not limited to Colicine V gene; Selective marker includes but not limited to bacteriocin immunity gene, for example, and brochocin C; With suitable duplicate field, such as pCat (by the obtainable plasmid of commercial sources).

In a preferred embodiment of the invention, will from the pCaT plasmid do not need and/or necessary sequence (such as antibiotic marker and motion gene) disappearance so that obtain can be as the fragment of the pCaT of replicon.According to the present invention, carry out some to the pCaT replicon and add, include but not limited to gene (such as bacteriocin and immunity gene), promotor (such as P15) and the expression signal of any hope.According to the present invention, can use the replication sequence that is suitable for use in the lactic-acid-bacterium host.Suitable replication sequence includes but not limited to the duplicate field of pCaT.In a preferred embodiment of the invention, replication sequence comprises from plant lactobacillus (L.plantarum).

Definition

Term " gene " refers to dna sequence dna as used herein, includes but not limited to be transcribed into mRNA and translates into polypeptide chain, is transcribed into rRNA or tRNA or as the dna sequence dna of the recognition site that participates in dna replication dna, the enzyme of transcribing and regulating and other protein.These genes include but not limited to structure gene, immunity gene and secretion (transhipment) gene.

Term used herein " carrier " refers to can be with transfer of genetic material any DNA material to the host bacterium biology.Carrier on topology can be linearity or ring-type and include but not limited to plasmid, food grade plasmid or phage.Carrier can comprise amplification gene, enhanser or selective marker and can integrate or unconformability in the genome of host living beings.Term " secretion vector " or " expression vector " refer to design and are used to provide polypeptide such as protein from the carrier of host living beings secretion.

Term used herein " signal peptide " refers to the amino terminal amino acid residue, and it allows this target polypeptide from cell output and cleavable signal peptide when being attached to the target polypeptide.Signal peptide enters general protein secreting approach.An example of signal peptide is the Divergicin a-signal peptide of describing in the United States Patent (USP) 6,403,082 that is incorporated herein by reference.It is well known by persons skilled in the art can using other signal peptides and its.

Term used herein " feed or food grade " refers to the source of DNA material and its composition.Therefore food grade points out that administration will consider described material from food source and is suitable for being included in food or the food, be generally used in the food and food of people or animal consumption.The biology of food grade can directly join in the food and not consider pathogenic such as lactic-acid-bacterium and the genus that plays other foundation of eozoan.Food used herein or feed grade refer to the quality of material, and particularly whether it cannot undesirable composition etc.Food of the present invention or feed grade expression vector or food or feed grade bacterium not or lack antibiotics resistance gene, perhaps not or lack effable or the function antibiotics resistance gene.In preferred embodiments, food of the present invention or feed grade composition can be used for or be included in silage, food, feed, milk preparation, meat, vegetables or dough/pasta.

Term used herein " bacteriocin " refers to polypeptide of bacteriogenic one or more bacterial species of inhibition etc.It includes but not limited to from the polypeptide of the specific bacterial strain of bacterium, from the protein of the biology of other types, the protein that perhaps produces by genetically engineered.Bacteriocin can be anti-bacteria or Bactericidal.

Term used herein " immunity gene " refers to produce a kind of gene of protein, the bacteriocin of described its generation of protein protection host living beings opposing.The immunity gene also can be used as selective marker.

Term used herein " sensitive bacterial " refers to kind or the bacterial strain of bacterium, and it is suppressed by one or more bacteriocins that exist in its environment.

Although described the present invention according to particularly preferred embodiment, the invention is not restricted to these embodiments.Those skilled in the art especially can make alternative embodiment, embodiment and the modification that the present invention still comprises with reference to the instruction of front.

Table 1

Provide the following examples to implement guidance of the present invention as those skilled in the art.

General materials and methods

With bacillus coli DH 5 alpha in the Luria of 37 ℃ of Growth of Cells Broth (LB) substratum (Difco Laboratories Inc.).Carnobacterium maltaromaticum UAL26 is grown in APT (the All Purpose Tween) substratum (Difco) at 25 ℃; Lactobacillus reuteri CB4 is grown in Bacterium lacticum MRS substratum (MRS at 37 ℃; Difco) in.Bacteria tested element such as former description (vanBelkum and Stiles, 1995) produces.Use is grown in the intestinal bacteria (DH5 α) that grow on the APT substratum that replenishes 1.5% (wt/vol) agar that is used for the solid plate inoculation are tested Colicine V as indicator organism generation.The selection concentration of be used for cultivating the paraxin of the UAL26 that contains recombinant plasmid and CB4 is respectively 5 and 10 μ g/ml.Operate such as cloning with DNA of the people such as Sambrook (1989) description.The enzyme that is used for molecular cloning obtains and as manufacturer's use of indicating from Invitrogen.Separate as carrying out plasmid as described in van Belkum and the Stiles (1995).Nucleotide sequencing carries out with the fluorescence chain terminator based on the people's such as Sanger (1977) method and in the Perkin-ElmerABI-Prism DNA sequencer.In order to transform UAL26 and CB4 cell, cell is grown in the APT that replenishes 2% (wt/vol) glycine or MRS substratum respectively.The cell of harvest index growth and twice of ice-cold water washing and ice-cold electroporation damping fluid (0.5M sucrose, 10% glycerine, 1mM MgCl2,5mM potassium phosphate buffer [pH6] also concentrates 100 times in same buffer) washed twice.Cell is divided into 50 μ l parts and-70 ℃ of preservations.Such as the electroporation that carries out of van Belkum and Stiles (1995), the modification below using for CB4: with cell 44 ℃ cultivated 20 minutes and adding DNA before extra 10 minutes of cooled on ice.(Bio-Rad) carries out electroporation at the Gene-Pulser instrument.25 μ F, 200 Ω, the pulsatile once of 2.5kV is used for UAL26,25 μ F, 800 Ω, the pulsatile once of 1.0kV is used for CB4.

Embodiment 1 uses plasmid pCaT and its derivative as the cloning vector among the LAB

Fig. 1 has shown the diagram from the plasmid pCaT of plant lactobacillus caTC2R (Jewell and Collins-Thompson, 1989).The pCaT plasmid contains the genetic information (cat gene) of chlorampenicol resistant according to reports.The contriver has checked order fully to this plasmid and part characterizes.With this Plasmid Transformation to multiple meat bacillus, plant lactobacillus NC8 and L.casei ATCC393, in these bacterial strains, show chlorampenicol resistant people such as (, 1992) Ahn.The pCaT plasmid contains 8951 base pairs.Some genes of inferring have been located, comprise participate in copying (repB, repIa and repIb), motion (mob), to the gene of the antibiotics resistance of paraxin (cat) and Streptomycin sulphate (str), and the open reading-frame (ORF) (seeing Fig. 1) of the brachymemma of the transposase (Tase) of can encoding.The contriver used pCaT as and the protein that produces of gram positive bacterium as but be not limited to the relevant gene cloning carrier of bacteriocin.

Having separated P32 promotor people such as (, 1987) van der Vossen and this promotor from Lactococcus lactis subsp.lactis has been used for expressing Colicine V gene people such as (, 1999) McCormi ck at pJKM37.Plasmid pJKM37 contains P32 promotor, divergicin a-signal peptide and Colicine V gene (colV).In the PCR reaction, use pJKM37 as template, and use 28 aggressiveness oligonucleotide (5 '-CCC GCATGC TGA ATT CGG TCC TCG GGA T-3 ') (Seq.I.D.No.6) and 28 aggressiveness oligonucleotide (5 '-CCC GCA TGC GGT ACC ACT ATT TAT AAAC-3 ') (Seq.I.D.No.7), Seq.I.D.No.6 contains SphI restriction site (underlining), its add with pJKM37 in contain in the sequence of 5 ' terminal homology of nucleotide sequence of P32 promotor, Seq.I.D.No.7 contains SphI restriction site (underlining), its add with pJKM37 in contain in the sequence of 3 ' terminal homology of nucleotide sequence of structure gene of Colicine V.To contain the P32 promotor of fusion divergicin a-signal peptide and the PCR product of Colicine V gene (coN) is cloned among the pCaT by replacing with the 2.1kb SphI fragment that contains the motion gene of pCaT.Gained plasmid pCV22 (Fig. 2) is transformed among the host Carnobacterium maltaromaticum UAL26 of plasmid-free.The cell of these conversions suppresses the growth of the indicator strain bacillus coli DH 5 alpha of Colicine V sensitivity.

Embodiment 2

Importing is transformed in the pCaT derivative of the generation Colicine V among the LAB as selective marker with bacteriocin immunity gene

The immunity gene of bacteriocin is imported among the pCV22 as genetic selection marker.Select two kinds of different function polynucleotide sequences of coding bacteriocin immune protein for this step: carnobacteriocin A immunity gene and brochocin-C immunity gene (people such as Franz, 2000; The people such as McCormick, 1998).In plasmid pCF08, the intermediate sequence of coding carnobacteriocinA immunity is cloned into P32 promotor (function) back people such as (, 2000) Franz.With 28 aggressiveness oligonucleotide (5 '-TAT ATG ATC AGG TCC TCG GGA TAT GATA-3 ') (Seq.I.D.No.8) and 28 aggressiveness oligonucleotide (5 '-TAT ACT GCA GGG TAC CGTCTA CAG TCT G-3 ') (Seq.I.D.No.9) be used for the sequence that amplification is in the coding carnobacteriocin A immunity gene under the P32 control, Seq.I.D.No.8 contains BclI restriction site (underlining), it adds (the people such as Franz with pCF08,2000) contain in the sequence of 5 ' homology of nucleotide sequence of P32 promotor, Seq.I.D.No.9 contains PstI restriction site (underlining), and it adds 3 ' end of the nucleotide sequence of coding carnobacteriocin A immune protein among the pCF08.Use BclI and PstI restriction site, with this PCR product cloning in pCV22.The carnobacteriocin A immunity gene of gained plasmid pCB12 (Fig. 3) passes through the immunity Gene Replacement of bacteriocin brochocin-C subsequently.With 40 aggressiveness oligonucleotide (5 '-ATA TAT CGA TAG GAA GTA TGA TCAATG GTAAAAACT ATA C-3 ') (Seq.I.D.No.10) and 35 aggressiveness oligonucleotide (5 '-ATA TCT GCA GAT ATCTAG TTA GAG AAT ATA ATC CA-3 ') (Seq.I.D.No.11) be used for the immunity gene of amplification brochocin-C, Seq.I.D.No.10 contains and adds the pJKM61 (people such as McCormick, 1998) the ClaI restriction site (underlining) of 5 ' of brochocin-C immunity gene end in, Seq.I.D.No.11 contain the PstI restriction site (underlining) that adds 3 ' end of brochocin-C immunity gene among the pJKM61.This PCR product cloning in the ClaI and PstI restriction site of pCB12, is obtained plasmid pCB15 (Fig. 4).Plasmid pCB15 is transformed among the C.maltaromaticum UAL26.The bacterial strain that transforms suppresses the growth of the indicator organism of Colicine V sensitivity such as bacillus coli DH 5 alpha and demonstrates immunity to brochocin-C [from the supernatant liquor that exhausts of 20% thermal treatment of the culture of Brochothrix campestris ATCC43754 in the APT substratum (100 ℃ 5 minutes)].

Embodiment 3

Isolation and selection lactobacillus reuteri CB4 is used as the host to develop the biological host of directed benefit

The meat Package factory that checks from small-sized place obtains the gi tract (GIT) of two health pig when butchering.With the GIT excision, seal in front-end and back-end, and be transported to the animal science laboratory (Animal Science laboratory) (Edmonton, Canada) of University of AlbertaResearch Station.GIT washed to remove intestinal contents with tap water and from parsesophagea, ileum, jejunum, caecum and colon segment.The internal surface of sections of cutting is swiped to remove epithelial lining with aseptic microslide surface.

The chip of scraping is washed in the dilution bottle, and plating was cultivated 18 to 24 hours in Difco Bacterium lacticum MRS agar (MRS) and 37 ℃ of anaerobism.Select at random altogether bacterium colonies different on 18 forms and check that Gram-positive, catalase are negative, bar-shaped feature and be seeded in and be used in the MRS meat soup preserving.Check the bacteriology purity of these bacterial strains and test conversion capability with pCB15.The Bacterium lacticum of only selecting to be converted is used for further research.Isolate CB4 can be converted, and analyzes by 16S rDNA and to turn out to be lactobacillus reuteri people such as (, 1990) Willson.Select lactobacillus reuteri CB4 as the purpose bacterial strain based on the stability of the plasmid that transforms.

Embodiment 4

In lactobacillus reuteri CB4, produce the Colicine V bacteriocin Colicine VM of sudden change

The pCB15 electroporation that will separate from C.maltaromaticum UAL26 obtains low-conversion to lactobacillus reuteri CB4.Separated lactobacillus reuteri CB4 transformant, it contains the plasmid that is called pCB15s, and the bacteriocin of the growth that suppresses the responsive indicator organism of Colicine V such as bacillus coli DH 5 alpha is stablized and produced to this plasmid in host strain.Separate the C.maltaromaticum UAL26 that plasmid pCB15s and electroporation from lactobacillus reuteri CB4 turn back to plasmid-free from this transformant.When the pCB15s electroporation that will again separate from these C.maltaromaticum UAL26 transformant turns back to lactobacillus reuteri CB4, obtain obviously higher transformation frequency.The nucleotide sequencing of the intestinal bacteria plain gene that inserts is disclosed in and has sudden change in the Colicine V gene, and it is comprised of nucleotide sequence 5 ' GTGGCTGGAGGT3 ' repeating (Seq.I.D.No.12).The repetition that this causes the amino acid 29 to 32 of Colicine V obtains Val-Ala-Gly-Gly-Val-Ala-Gly-Gly (Seq.I.D.No.13).So, with the Colicine V called after Colicine VM of sudden change.Colicine VM forms (Fig. 5) by 92 amino acid rather than 88 amino acid forming Colicine V.The C.maltaromaticum UAL26 and the lactobacillus reuteri CB4 transformant that contain pCB15s have all suppressed bacillus coli DH 5 alpha, show that Colicine VM has kept for colibacillary antibacterial activity.

Embodiment 5

Use to produce the bacterium of genetic modification of recombination bacillus coli element VM as suffer from diarrhoea the afterwards prophylactic treatment of (PWD) of the wean for the treatment of pig

The host strain of this technology of being used for will be the microorganism of harmless or useful (benefit is given birth to), and it is accompanied by the gi tract of target animal usually.Cause the morbidity of pig or dead wean suffer from diarrhoea afterwards (PWD) be an example that can use the gastrointestinal tract disease of this technical prevention.

The host strain lactobacillus reuteri CB4 target that determined generation Colicine VM (colVM), contains the conversion of pCB15s causes wean venter posterior in the pig to rush down the effect of the enterotoxigenic Escherichia coli (ETEC) of (PWD) surely.This biology of test in the pig infection model of setting up.Measure the effect of this prophylactic treatment by normal type increase in the pig that alleviates He just weaning of PWD.

The piggy of the wean of 20 17 ages in days is divided into two groups, every group of 10 pigs.Group 1 is not processed and is organized 2 and uses with tap water the 1st day to the 9th day of experiment and to contain about 1 * 10 of pCB15s ⁹Individual lactobacillus reuteri CB4.At the 7th day, two groups all used about 5 * 10 ⁸Individual ETEC-F4 bacterial strain (the known PWD that causes) is attacked, and it is used by esophageal tube.In this model, select to exist the animal (to group responsive especially animal of building of ETEC-F4 bacterial strain) of F4 receptor positive to be used for analyzing separately.The healthy state of monitoring experiment animal was also implemented euthanasia at the 10th day to these pigs and is used for postmortem.

The ileum of the consistence of body weight increase, diarrhoea score, intestinal contents and attack bacterial strain is built the effect of group's measurement test organisms during by the analysis postmortem.

The result:

From attacking the same day to postmortem same day, every daily weight of group 2 increases (not the growing) that (continuing growth) is higher than group 1.In group 2, use the lactobacillus reuteri CB4 that contains pCB15s and cause the intestines consistence that improves, the especially consistence in jejunum and the ileum, and the diarrhoea score that reduces.

In group 2, attack bacterial strain with ETEC-F4 and compare with group 1 and reduce 1log the group that builds of ileum.

The Incidence of Diarrhea and the degree that increase and reduce by attacking rear lasting body weight have been illustrated the benefit of the piggy of wean being used the lactobacillus reuteri CB4 that contains pCB15s.In multiple test, to compare with the contrast piggy, the piggy body weight of significant number increased after intestinal bacteria were attacked; And compare with the contrast piggy, the mouse of significant number demonstrates replys intestinal bacteria and attacks the minimizing of diarrhoea and the reduction of degree.

Result by extra Attack Research confirms these data.

Embodiment 6

Produce the Colicine V bacteriocin Colicine VM of sudden change with the feed grade carrier

In these experiments, the feed grade carrier is to lack or contain the antibiotics resistance gene of brachymemma and use alternative selective system, such as bacteriocin immunity gene, is used for animal-feed and uses.For inactivation cat gene, preparation is called the pCB15 derivative of pCB21 (Fig. 6), and it has unique EcoRV and BstEII restriction site in the cat gene.To ensure that the cat gene is unique EcoRV site, the following procedure, removal of brochocin-C in pCB15 immunity gene immediately downstream of the EcoRV restriction site: as described in Example 2, 40-mer (5'-ATATAT, CGA, TAG, GAA, GTA, TGA, TCA, ATG, GTAAAAACTATA, C-3 ') (Seq.IDNo.14), fused to the pJKM61 containing the brochocin-C immunity gene at the 3' end with source PstI restriction site (underlined) of the 27-mer oligonucleotide (5'-ATA, TCT, GCAGTC, TAG, TTA, GAG, AATATA-3 ') (Seq.IDNo.15) for amplification immunity brochocin-C gene.This PCR product cloning is contained the brochocin-C immunity gene of downstream EcoRV restriction enzyme sites with replacement in the ClaI of pCB15 and the PstI restriction site and be transformed among the C.maltaromaticum UAL26.The plasmid pCB21 (Fig. 6) that obtains from transformant digests with EcoRV and BstEII, fills by dna polymerase i and dNTP, and self connects and is transformed among the C.maltaromaticum UAL26.By inoculating at the APT flat board of the supernatant liquor that exhausts that contains 20% thermal treatment that the Brochothrix campestris ATCC43754 that grows in the comfortable APT substratum (100 ℃ 5 minutes), select the UAL26 transformant.The UAL26 transformant of gained contains plasmid pCB22 (Fig. 7) and responsive to the Colicine V of paraxin and generation.

In order to realize producing Colicine VM with the feed grade carrier in the lactobacterium strain that can not produce natural Colicine V, carry out following cloning experimentation.Separate 1.5-kb EcoRI-PsfI fragment and be cloned into the EcoRI-PsfI restriction site of plasmid pCB22 from the plasmid pCB15s that contains Colicine VM gene.The plasmid pCB23M (Fig. 8) of gained has lost the 1.5-kb EcoRI-PsfI fragment that contains natural Colicine V gene, because it is contained the 1.5-kb EcoRI-PsfI fragment replacement of Colicine VM structure gene.The C.maltaromaticum UAL26 that contains pCB23M suppresses bacillus coli DH 5 alpha, to brochocin-C immunity and responsive to paraxin.Transfer to lactobacillus reuteri CB4 from C.maltaromaticum UAL26 separation quality grain pCB23M and by electroporation, use 4000AU/ml brochocin-C as selective agent.The transformant of CB4 that contains pCB23M is responsive to paraxin, to the brochocin-C immunity and suppress the growth of indicator organism bacillus coli DH 5 alpha.This result shows that we use the feed grade plasmid to obtain suppressing the bacterial strain of colibacillary lactobacillus reuteri CB4.

Embodiment 7

Plasmid pCB19 is as the cloning vector among the LAB

By introducing a plurality of cloning sites that can be used for clone's target DNA fragment, make up the cloning vector pCB19 based on pCaT.To (Seq.I.D.No.16) replace (Fig. 9) with the polylinker (5 '-GCATGC GAATTC GAG CTC GGT ACC CGGGGATCC TCC TGC AG-3 ') that contains a plurality of cloning sites from the pCaT4.6-kb SphI of pCaT-PstIDNA fragment, described 4.6-kbSphI-PstIDNA fragment fragment contains open reading-frame (ORF) and the chloramphenicol resistance gene of protein of the horizontal transfer of the participation plasmid of can encoding.Gained 4.3-kb plasmid pCB19 (seeing Fig. 8) can use in being transformed into lactic-acid-bacterium the time chloramphenicol resistance gene (cat) to select.This plasmid has been transformed in lactic-acid-bacterium such as C.maltaromaticum and the lactobacillus reuteri.Other selective markers include but not limited to bacteriocin immunity gene, can be cloned in a plurality of cloning sites of pCB19.The gene that the contriver has illustrated coding such as the protein of bacteriocin can be cloned in a plurality of cloning sites of pCB19, causes lactic-acid-bacterium output recombinant protein.

Embodiment 8

From C.maltaromaticum bacterial strain screening promotor

Whether can find that in order to study other suitable promotors of working as are used for expressing bacteriocin in LAB, have cloned the chromosomal DNA of C.maltaromaticum LV17.The contriver separates chromosomal DNA from C.maltaromaticum LV17, with restriction enzyme MboI complete digestion and be cloned among Promoter-trap vector pGKV210 people such as (, 1985) van der Vossen.To connect mixture by electroporation transfers among the C maltaromaticum UAL26 and at the APT agar plate that contains 20 μ g paraxin/ml and selects transformant.A kind of such transformant that is called pGKV210-P15 that gets is grown at the APT flat board, and its chloramphenicol concentration is up to 45 to 50 μ g/ml.Promotor among the pGKV210 that separates from C.maltaromaticum LV17 is labeled as P15.

Pair of primers: the MP11 forward primer 5 ' GAATTCGAGCTCGCCCGG3 ' that contains EcoRI restriction site (underlining) (Seq.I.D.No.17) (Seq.I.D.No.18) is used for amplification from the Insert Fragment of the P15 promotor of pGKV210-P15 with reverse primer 5 ' CTGCAGGTCGACTCTAGAG3 '.Sequence and demonstration that mensuration contains the fragment of P15 promotor contain 276 Nucleotide (Figure 10).

Express Colicine V gene ground plasmid with the recombinant PCR technique construction, use P15 promotor (Figure 11).With MP11 forward primer (5 ' GAATTCGAGCTCGCCCGG3 ') (Seq.I.D.No.19) and with 3 ' of the P15 promotor terminal complementary reverse primer A (5 ' TGTGATACCAAGATGCATTCAACCATATTTGAAG3 ') (Seq.I.D.No.20) and the DNA of the N of the leading peptide of coding divergicinA-end be used for the P15 promoter fragment that increases.Primer B (5 ' TATGGTTGAATGCATCTTGGTATCACAAACTAA3 ') (Seq.I.D.No.21) and (the Seq.I.D.No.22) (people such as McCormick of C (5＜1〉CCCGGTACCACTATTTATAAACAAACATCAC3 '), 1999) be used for the DNA of the signal peptide of amplification coding Colicine V and divergicin A, use plasmid pCB15DNA as template.3 ' the terminal complementation of the DNA of the N-terminal of the signal peptide of primer B and P15 promoter fragment and coding divergicin A.Primer C contains KpnI restriction site (underlining) and is used as the reverse primer of ColV.Subsequently, from two kinds of top PCR products as template and primer MP11 forward and C are used for recombinant PCR contain fragment from the DNA of two kinds of PCR products with amplification.Gained PCR product contains the P15 promotor, is thereafter the DNA of the coding Colicine V that merges with the signal peptide of divergicin A.

Top PCR fragment with the digestion of EcoRI and KpnI restriction enzyme and be inserted in the suitable site of pCB19, is obtained plasmid pCB101 (Figure 12).By electroporation plasmid pCB101 is transferred among the C.maltaromaticum UAL26.The bacterial strain that contains pCB101 has suppressed the growth of Colicine V indicator strain bacillus coli DH 5 alpha.

Embodiment 9

Use the feed grade carrier in C.maltaromaticum, to use the P15 promotor to produce Colicine V

Primer (5 ' the GTAAC that contains XbaI site (underlining) TCTAGAAGGAAGTATGATCAATGGTA3 ') (Seq.I.D.No.23) and contain the primer (5 ' TAT of XbaI site (underlining) CTG CAGTCTAGTTAG AG AATAT AATCCA3 ') (Seq.I.D.No.24) is used for amplification brochocin-C immunity gene, uses pCB15DNA as template.The PCR product is inserted into the suitable site of pCB101, obtains plasmid pCB103 (Figure 13).When pCB103 being transformed among the C.maltaromaticum UAL26, the bacterial strain that contains this plasmid has suppressed growth and the chloramphenicol resistance of bacillus coli DH 5 alpha.

In order to make up the feed grade carrier that contains colV, plasmid pCB103 is digested restriction enzyme sites EcoRV and the BstEII that is positioned at the intragenic uniqueness of cat, to remove most cat genes.By the dna polymerase i flat end, self connects and is transformed among the C.maltaromaticum UAL26 with linear fragment.Gained feed grade plasmid pCB104 contains coding and is fused to the signal peptide of divergicin A of Colicine V and the DNA of brochocin-C immunity, and it is in P15 promotor control lower (Figure 14).Select to contain the C.maltaromaticum UAL26 of pCB104 at the APT agar plate that contains 80AU brochocin-C/ml.Use such as (van Belkum and Stiles, 1995) of former description and to blazon meat bacillus LV13 people 1995 such as () Worobo as the activity unit of indication growth measurement brochocin-C.These bacterial strains suppress the growth of bacillus coli DH 5 alpha, and responsive to paraxin.

The C.maltaromaticum UAL26 that contains plasmid pCB101, pCB103 and pCB104 produces bacteriocin with similar level, and it suppresses the growth of bacillus coli DH 5 alpha.The C.maltaromaticum UAL26 that contains pCB104 demonstrates the resistance to brochocin-C, but to the susceptibility of paraxin.

Embodiment 10

Use promotor P15 in the feed grade carrier, to express the generation of Colicine VM

In order to use the feed grade carrier in the lactobacterium strain that can not produce Colicine V, to produce Colicine VM, carry out recombinant PCR technology and subclone.By pcr amplification P15 promotor, use primer M11 forward and primer A (seeing Figure 11) and template pGKV210-P15 as front.Use primer B and C and template pCB23M by pcr amplification colVM gene.Contain the signal peptide of P15 promotor, divergicin A and the fragment of colVM with the recombinant PCR amplification.Use primer MP11 forward and C and from the top PCR product that contains P15 promotor and colVM gene as this fragment of template amplification.

Obtain this fragment and be inserted into the suitable site of plasmid pCB104 by EcoRI/KpnI fragment among the replacement pCB104 by EcoRI and KnpI.Gained plasmid pCB110 is the feed grade carrier, the signal peptide (Figure 15) that it contains the P15 promotor and is fused to the divergicin A of colVM.Alternatively, by make up the feed grade plasmid that is called pCB111 with the P32 promotor among the P15 promoter replacement pCB23M.Plasmid pCB111 and pCB23M are similar, and just it contains the P15 promotor and replaces the P32 promotor.The C.maltatomaticum UAL26 that contains pCB110 or pCB111 demonstrates colibacillary activity, to the susceptibility of paraxin, and to the resistance of brochocin C.Be transformed among the lactobacillus reuteri CB4 with plasmid pCB110 or with pCB111.The lactobacillus reuteri CB4 that contains pCB110 or pCB111 suppresses colibacillary growth, the responsive and anti-brochocin C to paraxin.

Reference

Ahn，C，Collins-Thompson，D.，Duncan，C，and?Stiles，M.E.1992.Mobilization?and?location?of?the?genetic?determinant?ofchloramphenicol?resistance?from?Lactobacillus?plantarum?caTC2R.Plasmid27：16-176.

Franz，C.M.A.P.，van?Belkum，MJ.，Worobo，R.W.，Vederas，J.C，and?Stiles，M.E.2000.Characterization?of?the?genetic?locusresponsible?for?production?and?immunity?of?camobacteriocin?A：theimmunity?gene?confers?cross-protection?to?enterocin?B.Microbiology146：621-631.

Jewell，B.，and?Collins-Thompson，D.L.1989.Characterizationof?chloramphenicol?resistance?in?Lactobacillus?plantarum?caTC2R.Curr.Microbiol.19：343-346.

McCormick，J.K.，Poon，A.，Sailer，M.，Gao，Y，Roy，K.L.，McMullen，L.M.，Vederas，J.C，Stiles，M.E.，and?van?Belkum，M.J.1998.Genetic?characterization?and?heterologous?expression?ofbrochocin-C，an?antibotulinal，two-peptide?bacteriocin?produced?byBrochothrix?campestris?ATCC43754.Appl.Environ.Microbiol.64：4757-4766.

McCormick，J.K.，Klaenhammer，T.R.，and?Stiles，M.E.1999.Colicin?V?canbe?producedbylacticacid?bacteria.Lett.Appl.Microbiol.29：37-41.Sambrook，J.，Fritsch，E.R，and?Maniatis，T.1989.Molecular?Cloning：A?Laboratory?Manual，2<nd>edn.ColdSpring?Harbor，New?York：Cold?Spring?Harbor?Laboratory?Press.

Sanger，R，Nicklen，S.，Coulson，A.R.1977.DNA?sequencing?withchain-terminating?inhibitors.Proc.Natl.Acad.Sci.74：5463-5467.

Stiles，M.E.，Vederas，J.C.，van?Belkum，M.J.，Worobo，R.W.，Worobo，R.J.，McCormick，J.K.，Greer，G.G.，McMullen，L.M.，Leisner，J.J.，Poon，A.，Franz，C.M.A.P.2002.Bacteriocins，transport?and?vectorsy?stem?and?method?of?use?thereof.US?Pat.6,403,082.

vanBelkum，M.J.，and?Stiles，M.E.1995.Molecularcharacterization?of?genes?involved?in?the?production?of?thebacteriocin?leucocin?A?from?Leuconostoc?gelidum.Appl.Environ.Microbiol.61：3573-3579.

Van?der?Vossen，J.M.B.M.，Kok，J.，and?Venema，G.1985.Construction?of?cloning，promoter-screening，andterminator-screening?shuttle?vectors?for?Bacillus?subtilis?andLactococcus?lactis?subsp.lactis.Appl.Environ.Microbiol.50：540-542.

van?der?Vossen，J.M.B.M.，van?der?Lelie，D.，and?Venema，G.1987.Isolation?and?characterization?of?Streptococcus?cremorisWg2-specific?promoters.Appl.EnViron.Microbiol.53：2452-2457.Wilson，K.H.，Blitchington，R.B.，andGreene，R.C.1990.Amplification?of?bacterial16S?ribosomal?DNA?with?polymerase?chainreaction.J.Clin.Microbiol.28：1942-1946.

Worobo，R.W.，van?Belkum，M.J.，Sailer，M.，Roy，K.L.，Vederas，J.C，and?Stiles，M.E.1995.A?signal?peptide?secretion-dependentbacteriocin?from?Carnobacterium?divergens.J.Bacteriol.177：3143-3149.

Claims (16)

1. the expression vector that is used for secrete polypeptide, it comprises the dna sequence dna of the Colicine V of promotor, effective signal sequence in conjunction with described polypeptide, encoding mutant, and terminator, wherein said promotor is selected from the group that is comprised of P32 and P15, and described signal peptide is divergicin a-signal peptide, and the aminoacid sequence of wherein said expression vector production shown in Figure of description 5D.

2. the expression vector of claim 1, the sequence of the Colicine V of wherein said sudden change is shown in Figure of description 5B.

3. the expression vector of claim 1, described promotor comprises the P15 nucleotide sequence.

4. the expression vector of claim 1, wherein said carrier does not comprise the function antibiotics resistance gene.

5. composition, it comprises the expression vector of claim 1.

6. lactic-acid-bacterium, it comprises the expression vector of claim 1.

7. the application of the lactic-acid-bacterium host of significant quantity in the medicine of preparation treatment bacillus coli or situation has the expression vector of secreting the Colicine V bacteriocin that suddenlys change among this host; The Colicine V bacteriocin that described intestinal bacteria and contacting of described lactic-acid-bacterium allow described sudden change is for described intestinal bacteria effect, the aminoacid sequence of wherein said expression vector production shown in Figure of description 5D.

8. the application of gram positive bacterium in the medicine of preparation inhibition gram negative bacterium, described gram negative bacterium is used for contacting with gram positive bacterium, the effective antibacterium material for described gram negative bacterium of wherein said gram positive bacterium secretion, described antibacterium material is the Colicine V bacteriocin of sudden change, the aminoacid sequence of the Colicine V bacteriocin of wherein said sudden change is shown in Figure of description 5D, wherein said gram negative bacterium is intestinal bacteria, and described gram positive bacterium is lactic-acid-bacterium.

9. the application in the medicine of the lactic-acid-bacterium of significant quantity enterotoxigenic Escherichia coli in preparation treatment pig, described bacterium comprises the expression vector of the Colicine V bacteriocin that produces sudden change, the aminoacid sequence of wherein said expression vector production shown in Figure of description 5D.

10. the application of claim 9, wherein said expression vector are the feed grade carriers.

11. the application of claim 10, wherein said feed grade carrier comprises bacteriocin immunity gene.

12. the application of claim 9, wherein said expression vector comprise the signal peptide that is suitable for expressing the gram negative bacterium element in the Gram-positive host.

13. the application of claim 10, wherein said expression vector comprise divergicin a-signal peptide.

14. the application of claim 10, it also comprises the lactic-acid-bacterium of Chinese People's Anti-Japanese Military and Political College's enterobacteria material that generation is not the Colicine V bacteriocin of sudden change.

15. the application of claim 14, wherein said Chinese People's Anti-Japanese Military and Political College enterobacteria material comprises Colicine V.

16. the application of claim 9, wherein said expression vector is selected from pCB110, pCB111, pCB15s, pCB19, pCB22 and pCB23M.

Images