KR102064476B1 - Microorganism for producing muconic acid precursor and method for manufacturing thereof - Google Patents

Abstract

The present invention discloses a genetically modified microorganism capable of effectively producing muconic acid, which is ultimately a precursor of bio-derived TPA or adipic acid, by possessing high 3-dehydroshikimate (DHS) production capacity. Specifically, the present invention redesigned the aromatic amino acid biosynthetic pathway of Escherichia coli to increase the DHS biosynthesis of the muconic acid precursor, the transformed Escherichia coli can have superior DHS and muconic acid production capacity than E. coli before transformation have.

Description

Microorganisms for producing muconic acid precursors and method for manufacturing

The present invention relates to a novel recombinant vector having a muconic acid precursor production ability, a microorganism comprising the same and a method for producing the same.

Fossil fuels used as raw materials for energy and chemicals are facing various environmental and economic problems, including global warming, along with continuous oil price rise and resource depletion. have. Among them, biosynthesis strategies using microorganisms are being actively studied, and in particular, it is possible to biosynthesize various chemicals, biofuels, amino acids and secondary metabolites of plants using recombinant microorganisms whose specific metabolic pathways have been genetically redesigned. .

Currently, the global polymer market is required to use bio-derived eco-friendly raw materials. Accordingly, large beverage companies such as Coca-Cola and Pepsi are focusing on the development of 100% plant-derived polyethylene terephthalate (PET). Meanwhile, PTT (polytrimethylene terephthalate), which has a structure similar to that of PET but has unique characteristics, has a high potential market size and is growing at an average annual growth rate of 17%. Therefore, like PET, PTT is a time point for bio-friendly polymer synthesis. Currently, PTT is produced through a condensation reaction between terephthalic acid (TPA) derived from petroleum and 1,3-PDO (1,3-propanediol) derived from biotechnology. On the other hand, bio-derived research on 1,3-PDO derived from bio, TPA derived from biotechnology is very poor worldwide. In particular, since most of the research on terephthalic acid (TPA) starts with petrochemicals, there is a need for development of bio-friendly TPA production process. However, a process for biosynthesizing TPA directly from a bio-derived carbon source using a bioprocess has not been developed yet. Therefore, in order to produce environmentally friendly TPA, it is necessary to first develop a bio-derived TPA precursor through a bioprocess, and to develop a fusion production process that converts the TPA precursor produced through the bioprocess into TPA through a chemical synthesis process.

Cis, cis-muconic acid (cis) is a compound that synthesizes synthetic resins and biodegradable polymers, and is well known as a precursor of adipic acid in addition to its use as a bio-derived precursor for TPA synthesis. . Adipic acid is used as a precursor to various materials such as nylon, lubricants, plastics and plasticizers, and consumes a large amount of 2 x 10 ⁹ kg per year worldwide. However, cyclohexane derived from benzene, which is currently used when adipic acid is synthesized, has a problem of generating N ₂ O which causes global warming during oxidation. In addition, various intermediate chemicals in each step are known as carcinogens as well as harmful to the human body. To solve this problem, development of adipic acid production process using bio-derived renewable raw materials is necessary.

Republic of Korea Patent Application Publication No. 10-2015-0120236 (2015. 10. 27 published)

Alper, H., Miyaoku, K., & Stephanopoulos, G. (2005). Construction of lycopene-overproducing E. coli strains by combining systematic and combinatorial gene knockout targets. Nature Biotechnology, (23), 612-616. Atsumi, S., Hanai, T., & Liao, J. C. (2008). Non-fermentative pathways for synthesis of branched-chain higher alcohols as biofuels. Nature, (451), 86-89. Berry, A. (1996). Improving production of aromatic compounds in escherichia coli by metabolic engineering. Trends in Biotechnology, 14 (7), 250-256. Bui, V., Coudray, L., & Frost, J. (2012). Process for preparing hexamethylenediamine and polyamides therefrom. (WO Patent 2012141993 A1 ed.) Bui, V., Lau, M., MacRae, D., & Schweitzer, D. (2013). Methods for producing isomers of muconic acid and muconate salts. (US Patent 20130030215 A1 ed.) Burk, M., Osterhout, R., & Sun, J. Semi-synthetic terephthalic acid via microorganisms that produce muconic acid. (US Patent 20110124911 A1 ed.) Chen, S. P., Jaffee, M., Glick, M., & Forschirm, A. (1992). Muconic acid grafted polyolefin compatibilizers. (EP Patent 0489584 A2 ed.) Fink, J. (2005). Reactive polymers fundamentals and applications: A concise guide to industrial polymers. (pp. 573-573) William Andrew. Frost, J., & Draths, K. (1995). Biocatalytic syntheses of aromatics from D-glucose: Renewable microbial sources of aromatic compounds. .Annual Review of Microbiology, (49), 557-579. Frost, J., Miermont, A., Schweitzer, D., Bui, V., Paschke, E., & Wicks, D. (2013). Biobased polyesters. (US Patent 8415496 B2 ed.) Frost, J., Miermont, A., Schweitzer, D., Bui, V., & Wicks, D. (2013). Cyclohexane 1,4-carboxylates. (US Patent 8367859 B2 ed.) Frost, J., Miermont, A., Schweitzer, D., Bui, V., & Wicks, D. (2013). Novel terephthalic and trimellitic based acids and carboxylate derivatives (US Patent 8367858 B2 ed.) Frost, J., Millis, J., & Tang, Z. (2010). Methods for producing dodecanedioic acid and derivatives (WO Patent 2010085712A3 ed.) Lin, Y., & Yan, Y. (2012). Biosynthesis of caffeic acid in escherichia coli using its endogenous hydroxylase complex. Microbial Cell Factories, 11 (42) Lin, Y., & Blaschek, H. P. (1983). Butanol production by a butanol-tolerant strain of clostridium acetobutylicum in extruded corn broth. Applied and Environmental Microbiology, (45), 966-973. Pandell, A. (1976). Enzymic-like aromatic oxidations. metal-catalyzed peracetic acid oxidation of phenol and catechol to cis, cis-muconic acid. The Journal of Organic Chemistry, 41, 3992-3996. Polen, T., Spelberg, M., & Bott, M. (2013). Toward biotechnological production of adipic acid and precursors from biorenewables. Journal of Biotechnology, 167 (2), 75-84. Sambrook, J., Fritsch, E. F., & Maniaitis, T. (1989). Molecular cloning: A laboratory manual (2nd ed.). New York: Cold Spring Harbor Laboratory. Schafer, A., Kalinowski, J., Simon, R., Seep-Feldhaus, A. H., & Puhler, A. (1990). High-frequency conjugal plasmid transfer from gram-Negative escherichia coli to various gram-positive coryneform bacteria. Journal of Biotechnology, 172 (3), 1663-1666. Schweitzer, D. (2012). Continuous dehydrogenation of 1,4-carboxylate substituted cyclohexenes. (WO Patent 2012082725 A1 ed.) Weber, C., Bruckner, C., Weinreb, S., Lehr, C., Essl, C., & Boles, E. (2012). Biosynthesis of cis, cis-muconic acid and its aromatic precursors, catechol and protocatechuic acid, from renewable feedstocks by saccharomyces cerevisiae. Applied and Environmental Microbiology, 78 (23), 8421-8430. Lee, S.J., Lee, D.Y., Kim, T.Y., Kim, B.H., Lee, J.W., Lee, S.Y. (2005). Metabolic engineering of Escherichia coli for enhanced production of succinic acid, based on genome comparison and in silico gene knockout simulation, Appl. Environ. Microbiol. 71 (12): 7880. Gosset, G., J, Yong-Xiao, A, Berry. (1996). A direct comparison of approaches for increasing carbon flow to aromatic biosynthesis in Escherichia coli. Journal of Industrial Microbiology. 17, 47-52. Pittard, J., Camakaris, H., Yang, J. (2005) The tyr regulon. Mol microbiol. 55 (1): 16-26 Munoz, A. J., Hernandez-Chavez, G ,. Anda, R.de., Martinez, A., Bolivar, F. (2014). Metabolic engineering of Escherichia coli for improving shikimate synthesis from glucose. Bioresource Technology. 166, 64-71

An object of the present invention is to provide an E. coli having a high DHS (3-dehydroshikimate) and muconic acid production ability through the redesign of the aromatic amino acid biosynthesis pathway for the production of precursors of muconic acid and a method for producing the same.

In order to achieve the above object, an embodiment of the present invention is aroE gene; And a recombinant E. coli and culture thereof in which one or more genes of the tyrR , ptsG , pykA and pykF genes are inactivated.

In addition, an embodiment of the present invention provides a DHS (3-dehydroshikimate) production method comprising the step of culturing the recombinant E. coli.

Another embodiment of the present invention is aroE gene; And tyrR, ptsG, polynucleotides and to one or more of the genes pykA and pykF gene inactivation and, encoding the polynucleotides, encoding the aroY ^{opt opt} asbF a polynucleotide encoding catA ^opt , an upstream of each of the three polynucleotides comprises a ribosome binding site (rbs) derived from E. coli, and a first transcribed polynucleotide of the three polynucleotides A recombinant E. coli, and a culture thereof, further transformed with a recombinant vector comprising a promoter upstream of the ribosomal binding site (rbs) of the present invention.

In addition, an embodiment of the present invention provides a cis, cis-muconic acid production method comprising culturing the recombinant E. coli.

Escherichia coli transformed with the recombinant vector according to the present invention possesses high DHS (3-dehydroshikimate) production capacity, thereby effectively producing muconic acid, which is ultimately a precursor of bio-derived TPA or adipic acid. Specifically, the aroE by redesigning the aromatic amino acid biosynthetic pathway of E. coli to increase the DHS biosynthesis of muconic acid precursors, In addition to inactivation of genes Escherichia coli with one or more of the tyrR , ptsG , pykA and pykF genes inactivated Only genes can have about 10 times higher DHS production capacity than E. coli that is missing.

1 shows biosynthetic pathways and regulatory pathways of aromatic amino acids and cis, cis-muconic acids in Escherichia coli, and abbreviations described in FIG. 1 are as follows: erythrose-4-phosphate (E4P), phosphoenolpyruvate (PEP), DAHP (3-deoxy-d-arabinoheptulosonate-7-phosphate), DHQ (dehydroquinate), DHS (3-dehydroshikimate), SA (Shikimate), PCA (Protocatechuic acid), CA (Catechol), CCM (cis, cis-muconic acid ).
2 shows E. coli lacking aroE AB2834 Δ aroE ( ΔE ) and E. coli further lacking tyrR Respectively culturing the aroE △ △ AB2834 tyrR (△ △ R E) is a diagram showing a result of comparing each DHS production.
Figure 3 is a diagram showing the results of comparing the respective DHS production by incubating the recombinant microorganisms inactivated various genes in a flask (flask).
Figure 4 is a diagram showing each growth curve in 5L incubator culture of the recombinant microorganisms inactivating various genes.
Figure 5 is a diagram showing the DHS productivity in 5L incubator culture of the recombinant microorganisms inactivating various genes.
Figure 6 is a diagram showing the production of muconic acid in the culture of 5L incubator of the strain introduced three foreign genes necessary for producing muconic acid in the recombinant microorganisms inactivated various genes.
7 is a polynucleotide encoding asbF ^opt which is three foreign genes required for producing muconic acid by E. coli , a polynucleotide encoding aroY ^opt , and Figure schematically shows one operon containing a polynucleotide encoding catA ^opt .

Hereinafter, the present invention will be described in detail.

3-dehydroshikimate (DHS) is an important metabolic intermediate required to produce aromatic compounds. The DHS is a potential antioxidant and used as a feedstock for the production of many industrially important compounds such as cis, cis-muconic acid (CCM), adipic acid and aromatic amino acids. Useful starting compound. In particular, cis, cis-muconic acid made from DHS is an important platform chemical that is used as a precursor to synthesize nylon, plastics, coatings, polytrimethylene terephthalate (PTT), resins, and the like. Structural isomers of cis and cis-muconic acid, such as biodegradable intermediates and terephthalic acid, can be applied to various products. Since the cis, cis-muconic acid is mainly synthesized from petroleum-based benzene by using a high concentration of heavy metal catalysts, serious environmental and economic problems are encountered. Therefore, environmentally and continuously renewable cis, cis-muconic acid biosynthesis methods have been studied to supplement these problems.

Escherichia coli used as an embodiment of the present invention coli ) is a gram-negative aerobic bacterium that is non-toxic and has the advantage of being very fast and easy and inexpensive to grow in laboratories and industrial sites. However, since there are no genes capable of synthesizing muconic acid in Escherichia coli, it is necessary to introduce a foreign gene to produce muconic acid. The present inventors have already introduced cis, cis- from DHS, an intermediate of the aromatic amino acid biosynthetic pathway, by introducing three foreign genes into Escherichia coli for the synthesis of cis, cis-muconic acid in Korean Patent Publication No. 10-2015-0120236. It has been confirmed that muconic acid is biosynthesized, and the patent document is incorporated herein by reference in its entirety.

 The present inventors have invented the present invention to increase the production of DHS preferentially by optimizing the aromatic amino acid biosynthetic pathway in order to produce microorganisms capable of producing cis, cis-muconic acid in higher yield. .

Aromatic amino acid biosynthesis from plant-derived microorganisms, including tyrosine, tryptophan, and phenylaniline, is a D-erythrate produced by phosphoenolpyruvic acid (PEP) and pentophosphate, produced from glucose during glucose neosynthesis and glycolysis Based on the condensation reaction of los-4-phosphate (E4P), biosynthesis is known to occur through 3-dehydroshikimate (DHS), shikimic acid and chorismic acid. Therefore, the present invention is a gene involved in biosynthesis of DHS in order to increase the production of cis , cis -muconic acid (CCM), mutant accumulated in the Escherichia coli DHS, a precursor of CCM from the metabolic point of view Was recombined to optimize the relevant metabolic pathways.

1 is a diagram showing a schematic diagram of the aromatic amino acid biosynthetic pathway in Escherichia coli and the CCM biosynthetic pathway using the same. The genes shown in bold in FIG. 1 are among genes involved in synthesizing DHS, a precursor of CCM from glucose, and are expected to play an important role in CCM biosynthesis.

Therefore, an embodiment of the present invention, in order to remove other competitive pathways except for the pathway required for synthesizing DHS in the aromatic amino acid biosynthetic pathway of Figure 1, aroE In addition to inactivation of the gene, one or more of the tyrR , ptsG , pykA and pykF genes are inactivated Provides recombinant E. coli. In addition, an embodiment of the present invention aroE In addition to inactivation of genes, it is possible to provide recombinant E. coli in which the tyrR , ptsG , pykA and pykF genes are sequentially inactivated. Specifically, the E. coli aroE gene; And tyrR and ptsG, gene, tyrR , ptsG And pykA gene or tyrR , ptsG , pykA and pykF genes are inactivated It may be. The recombinant E. coli may be an increase in DHS (3-dehydroshikimate) biosynthesis by inactivation of the genes. The order of inactivation of the four genes is not limited to the order in which the genes are described.

As used herein, the term "inactivation" includes both the removal of some or all of a specific gene, the addition of another sequence within a specific gene, or the substitution of a specific gene with another gene. In one embodiment, the inactivation of the gene may be due to deletion of the gene in E. coli.

In one embodiment, tyrR , ptsG , pykA and pykF from E. coli Deletion methods of one or more of the genes may specifically include plasmid construction, transformation, single recombination induction and double recombination for deletion.

Specifically, the plasmid preparation step for the deletion is cloning (up region) and the lower region (down region) of the gene to be deleted in the E. coli suicide vector (suicide vector) to prepare pure DNA dissolved in distilled water It may include the step. The transformation step may include inserting the deletion plasmid using electroporation into the strain to introduce the prepared plasmid, that is, the deletion plasmid into the desired strain. The single recombination induction step is to raise the temperature to 30-45 ℃ in order to induce a single recombination in the transformed plasmid inserted into the chloroamphenicol-added broth (broth), and then added chloramphenicol Plating on LB plates and incubating at 30-45 ° C. may include removing a single non-recombinant strain to the chromosome. In the dual recombination induction step, the single recombined strain is cultured in LB medium without antibiotics at a temperature of 30-45 ° C. to induce double recombination, ie, gene deletion, and the cultured strains contain 10% sucrose. Plating onto the entered LB plate may comprise selecting strains from which the plasmid has been removed and the gene has been deleted.

In one embodiment, the tyrR gene modulates the aroG gene encoding DHAP synthase (2-dehydro-3-deooxy-phosphoheptonate-aldolase) in the amino acid biosynthetic pathway. The TyrR protein encoded by the tyrR gene is a tyrosine inhibitor, and has a function of inhibiting the expression of the aroG gene when tyrosine is present in the medium, which affects subsequent metabolic pathways. Therefore, when inactivating the tyrR gene, the aroG gene will continue to be expressed with or without tyrosine, thereby enabling continuous biosynthesis of DHS. In one embodiment, the polynucleotide encoding the tyrR may include a nucleotide sequence represented by SEQ ID NO: 1.

In one embodiment, the ptsG gene is involved in moving glucose present outside the cell into the cell. Glucose phosphotransferase IIBC (Glc) encoded by the gene; Glucose permease can reduce PHS accumulation in cells by converting PEP, a precursor of DHS, to pyruvate while transferring glucose present in the cell into the cell. Even if the ptsG gene is inactivated, other genes that convert glucose to glucose-6P (G6P) ( galM gene, glk gene, etc.) are present in Escherichia coli, so there will be no significant effect on glucose consumption. One embodiment of the present invention After homologous armadillo (homologue arm) on both sides of the ptsG gene through PCR, homologous recombination can be used to inactivate the ptsG gene in strains in which the aroE and tyrR genes are inactivated. At this time, as an example, the polynucleotide encoding the ptsG may include a nucleotide sequence represented by SEQ ID NO: 2.

In one embodiment, the pykA and pykF genes, like the ptsG gene, are involved in converting PEP, a precursor of DHS, to pyruvate. PykA Gene Pyruvate Kinase II Coding With pykF Gene Each of the coding pyruvate kinases I converts PEP to pyruvate, which is involved in the production of energy by entering the carbon cycle into the trichloroacetic acid (TCA) cycle. Inactivating the two genes is advantageous in terms of consuming PEP, a precursor of DHS. In one embodiment, the polynucleotide encoding pykA may include a nucleotide sequence represented by SEQ ID NO: 3. As an example, the polynucleotide encoding the pykF may include a nucleotide sequence represented by SEQ ID NO: 4.

The E. coli according to an embodiment of the present invention may be E. coli, which is deficient in the aroE gene, and has lost Aro E enzyme activity. In one embodiment, the polynucleotide encoding the aroE may include a nucleotide sequence represented by SEQ ID NO: 5. For example, E. coli AB2834 ( E. coli Genetic Stock Center) may be used as E. coli that has lost the A ro E enzyme activity. Aro the E gene DHS (3-dehydroshikimic acid) in the gene encoding DHS dehydratase that converts to a SA (shikimic acid) aroE When the gene is deleted, the DHS can be converted to SA to block metabolic flow toward muconic acid biosynthesis by blocking DHS from being used for aromatic amino acid biosynthesis. Biosynthetic efficiency can be further increased. In addition, when biosynthesis of aromatic amino acids is blocked, phosphoenolpyruvate (PEP) and erythrose-4-phosphate (E4P), which are early metabolic pathways, release (inhibition) of feedback inhibition of the conversion to DAHP, resulting in muconic acid biosynthesis. The metabolic flow is smooth. However, since the aromatic amino acid is not synthesized due to the deletion of the aroE gene, the aromatic amino acid should be added to the culture medium. At this time, if the excess aromatic amino acid is added, feedback inhibition occurs again.

The present invention can provide a culture of E. coli as described above as an example. In one embodiment, the recombinant E. coli is inactivated aroE gene, additionally tyrR , ptsG , pykA and pykF Since at least one of the genes is more inactivated, the culture may comprise 3-dehydroshikimate (DHS). Specifically, the culture may include DHS at a concentration of 10 to 80 g / L, but the concentration of DHS included in the culture is not limited thereto.

In addition, an embodiment of the present invention aroE gene; And One or more of tyrR , ptsG , pykA and pykF genes can provide a method for producing DHS (3-dehydroshikimate) comprising culturing a recombinant E. coli inactivated.

The DHS production method, specifically, the primary growth culture step of E. coli production strain comprising inoculating E. coli single colony to LB medium containing glucose and cultured for one day; A secondary growth culture step of inoculating the primary growth culture solution with LB medium containing glucose and shaking culture for 4-8 hours; And a culturing step of producing DHS inoculating and culturing the second growth culture solution in the production medium. More specifically, inoculating E. coli monocolon in 5 ml of LB medium containing 10 g / L glucose (tryptone 10 g / L, Yeast extract 5 g / L, NaCl 5 g / L, Glucose 10 g / L) Primary growth culture step of E. coli production strain comprising overnight culture in a rotary shaker at 37 ℃, 220rpm; A second growth culture step comprising adding 50 ml of LB medium containing 10 g / L glucose to a 250 ml baffle flask and inoculating 1% of the first growth culture solution and shaking culture at 220 rpm for 30 hours at 30 ° C .; And 50 ml of the production medium may be added to a 250 ml baffle flask and inoculated with 1% of the secondary growth culture solution, followed by culturing at 220 rpm and 30 ° C. to produce DHS.

Another embodiment of the present invention is aroE gene; And After inactivating one or more of the tyrR , ptsG , pykA and pykF genes , biosynthesis of muconic acid from DHS to provide a recombinant E. coli for the production of cis, cis-muconic acid As genes needed to do this, asbF , aroY And E. coli introduced with genes encoding catA , respectively.

Specifically, aroE gene; And polynucleotides encoding the recombinant Escherichia coli having a defective polynucleotide encoding at least one of the tyrR, ptsG, pykA and pykF, asbF ^opt polynucleotide, encoding the aroY ^opt and a polynucleotide encoding catA ^opt and upstream of each of the three polynucleotides comprises a ribosome binding site (rbs) derived from E. coli, the first transcribed polynucleotide of the three polynucleotides It is possible to provide a recombinant E. coli further transformed with a recombinant vector comprising a promoter upstream of the ribosomal binding site (rbs).

In one embodiment the polynucleotide is the first transfer of the three polynucleotides is any one selected from a polynucleotide encoding the polynucleotide and catA ^opt encoding polynucleotides, aroY ^opt encoding asbF ^opt, of the three genes The arrangement order is not limited to the order in which the genes are described. For example, the three genes are polynucleotides encoding the polynucleotides, encoding the aroY asbF ^{opt opt} in a recombinant vector for the production of MU-conic acid and The polynucleotides encoding catA ^opt may be arranged in order. Or, it may be arranged in a polynucleotide, the polynucleotide encoding order of the polynucleotide and coding for the aroY asbF ^{opt opt} encoding a catA ^opt.

Referring to FIG. 1, a carbohydrate metabolic pathway of Escherichia coli includes a pathway for biosynthesizing aromatic amino acids phenylalanine (Phenylalanine, Phe), tyrosine (Tyros), and tryptophan (Tryptophan, Try). In this case, in order to produce muconic acid from DHS (3-dehydroshikimate), which is an intermediate, three kinds of foreign genes may be introduced into E. coli. Specifically, DHS dehydratase (DHS dehydratase) for encoding the coding asbF, PCA decarboxylation enzyme (protocatechuic acid decarboxylase) which aroY, catechol 1,2-oxygenated enzyme (catechol 1,2-dioxygenase) encoding the catA . With the introduction of these three foreign genes, it is possible to synthesize muconic acid from DHS via PCA and catechol.

More specifically, the embodiment of the present invention, in order to improve the muconic acid production capacity by increasing the expression rate in E. coli in introducing the three kinds of foreign genes in E. coli, the asbF , aroY And a catA can synthesize poly coding for one of asbF ^opt nucleotide sequence transformed into the E. coli codon oligonucleotide, a polynucleotide encoding the polynucleotide and coding for the aroY catA ^{opt opt.} And ribosomal binding sites of the first polynucleotide to be transcribed, including the three polynucleotides and a ribosome binding site derived from E. coli upstream of each of the three polynucleotides. It can be prepared as a recombinant vector comprising a promoter (upstream) upstream of the). In one embodiment, the polynucleotide encoding the asbF ^opt comprises SEQ ID NO: 6, the polynucleotide encoding the aroY ^op comprises SEQ ID NO: 7, the polynucleotide encoding the catA ^op is SEQ ID NO: 8 It may include. The ribosomal binding site may comprise SEQ ID NO: 9. One embodiment provides a host cell transformed with the recombinant vector prepared as described above, and provides E. coli comprising the host cell.

This leads to asbF ^opt , aroY ^opt and E. coli according to an embodiment of the present invention comprising catA ^opt includes each of the three foreign genes as a single operon structure, thereby asbF ^opt , aroY ^opt and Transcription amount of each polynucleotide encoding catA ^opt can be implemented as 0.9 ~ 1.1: 0.9 ~ 1.1: 0.9 ~ 1.1.

The three types of polynucleotides efficiently utilize the corresponding enzymes, DHS dehydratase, PCA decarboxylase, and catechol 1,2-dioxygenase. To express.

In one embodiment the polynucleotide is the first transfer of the three polynucleotides is any one selected from a polynucleotide encoding the polynucleotide and catA ^opt encoding polynucleotides, aroY ^opt encoding asbF ^opt, the three polynucleotide The order of insertion and arrangement of is not limited to the order in which the genes are described. For example, the three genes are polynucleotides encoding the polynucleotides, encoding the aroY asbF ^{opt opt} in a recombinant vector for the production of MU-conic acid and The polynucleotides encoding catA ^opt may be arranged in order. Or, it may be arranged in a polynucleotide, the polynucleotide encoding order of the polynucleotide and coding for the aroY asbF ^{opt opt} encoding a catA ^opt.

In one embodiment, the E. coli is the accession number KCCM11922P be a genetically modified Escherichia coli (E.coli AB2834 aroEtyrRptsGpykApykF) or a genetically modified Escherichia coli ^{(E.coli AB2834 aroEtyrRptsGpykApykF / Plac aroZ OPT} , aroY OPT, catA OPT) Accession number KCCM11882P have.

The present invention can provide a culture of E. coli as described above as an example. In one embodiment the recombinant E. coli aroE gene; And one or more of the tyrR , ptsG, pykA and pykF genes are inactivated, or an aroE gene; And tyrR and ptsG Gene, tyrR , ptsG And pykA gene or tyrR , ptsG , pykA and pykF genes are inactivated and required for biosynthesis of muconic acid from DHS, asbF , aroY And a gene encoding catA , respectively, has been introduced, the culture may comprise cis, cis-muconic acid. Specifically, the culture may include cis, cis-muconic acid at 10 to 60 g / L, but the concentration is not limited thereto.

In addition, an embodiment of the present invention aroE gene; And tyrR, ptsG, and one or more genes pykA and pykF genes are non-active, a gene required for the biosynthesis in the mu-conic acid from DHS, asbF, aroY And it can provide a cis, cis-muconic acid production method comprising the step of culturing the recombinant E. coli introduced genes encoding catA respectively.

The cis, cis-mu conic acid production method, E. coli 1 primary growth phase culture of E.coli production strain is cultured for one day single colonies was inoculated on LB medium containing ampicillin (Ampicillin) and glucose in detail ; A second growth culture step of inoculating the primary growth culture solution with LB medium containing ampicillin and glucose and shaking culture for 4-8 hours; And inoculating and culturing the secondary growth culture solution on the production medium to produce muconic acid. More specifically, LB medium containing 100 mg / L Ampicillin and 10 g / L glucose (tryptone 10 g / L, Yeast extract 5 g / L, NaCl 5 g / L, Glucose 10 g / L) Inoculate 5 ml of E. coli single colony and the primary growth culture step of E. coli production strain cultured overnight overnight in a rotary shaker at 37 ℃, 220rpm; A second growth culture step of adding 50 ml of LB medium containing ampicillin 100 mg / L and 10 g / L glucose to a 250 ml baffle flask and inoculating 1% of the first growth culture solution with shaking culture at 220 rpm for 30 hours at 30 ° C .; And adding 50 ml of the production medium to a 250 ml baffle flask and inoculating 1% of the secondary growth culture solution at 220 rpm and shaking at 30 ° C. to produce muconic acid.

Hereinafter, the present invention will be described in detail with reference to production examples and test examples of the present invention. These are only presented by way of example only to more specifically describe the present invention, it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these preparation and test examples. .

[Production example]

Recombinant Escherichia coli microorganism according to an embodiment of the present invention was prepared according to the following method.

Medium and culture conditions

For cell proliferation, inoculation preparation and deletion plasmid preparation, all E. coli strains were grown at 37 ° C. in LB (Luria-Bertani) medium or agar plates. The LB medium comprises 10 g of tryptone 1 L, 5 g of NaCl, and 5 g of yeast extract. Plasmid removed in LB medium further comprising various concentrations of appropriate antibiotics or sucrose, specifically 100 μg / ml ampicillin, 25 μg / ml chloramphenicol and 10% sucrose Colonies were selected.

Bacterial Strains and Plasmids

E. coli E. coli AB2834 strain was obtained from the genetic stock. E. coli DH5α (purchased from TaKaRa) was used as a host in the production of recombinant plasmids. Plasmid pUC19 (Addgene) was used as an intermediate vector for gene deletion. Plasmid pKOV (Addgene) was used as a deletion vector by the use of restriction enzymes (upstrip fragments: BamHI & XbaI , downstream fragments: XbaI & SalI ). Plasmid pUC18 with activated gene overexpression and expression was purchased from Addgene. The prepared plasmids were confirmed by sequencing and restriction enzyme analysis. All strains and plasmids used or prepared in this experiment are listed in Table 1 and Table 2 below. In Table 2 below, the term “UP & DOWN” refers to an up region (up steam, left region, forward region) and a down gene fragment, which are the upper gene fragments of a gene that is deleted during preparation of a plasmid for deleting target genes. Represents a region (down steam, right region).

In this experiment, standard protocols were used for polymerase chain reactions (PCR) amplification, DNA purification, plasmid extraction, enzyme restriction and ligation reactions. Primers used in this experiment are listed in Table 3 below.

Microorganisms (E. coli ) Related property Ref. E. coli DH5α lacZ ￠ M15 hsdR recA TaKaRa E. coli AB2834 ΔE aroE 353 ( aroE- deficient E. coli ) - △ ER AB2834 △ aroE △ tyrR This work △ ERG AB2834 △ aroE △ tyrR △ ptsGrR This work △ ERGA AB2834 △ aroE △ tyrR △ ptsGrR △ pykA This work △ ERGAF AB2834 △ aroE △ tyrR △ ptsGrR △ pykA △ pykF This work △ ERGAF / pM1 AB2834 △ aroE △ tyrR △ ptsGrR △ pykA △ pykF / pMESK1 This work

Plasmid (vector) Related property pUC19 Amp ^R , lacZ α, f1 ori, lac promoter (multiple cloning site) pKOV Cm ^R , sacB , Rep101, f1 ori pUC18_01 lacZ ￠ M15 hsdR recA pMESK01 aroZ ^Eopt , aroY ^Eopt and catA ^Eopt Containing pUC18_01 pKOV- △ tyrR pKOV with tyrR UP & DOWN pKOV- △ ptsG pKOG with ptsG UP & DOWN pKOV- △ pykA pKOV with pykA UP & DOWN pKOV- △ pykF pKOV with pykF UP & DOWN

primer SEQ ID NO: Sequence (5 '→ 3') Target ptsG _UP_F 10 TTACATATGCGGGATCCGGTAGGCGAACGT AB2834 ptsG _UP_R 11 CATGGTTTTAACCATCTAGACATAGGCAACAACTCGAGCCAGCGCGGATA AB2834 ptsG _DOWN_F 12 TCCACGCGATTCTAGAAGGCCTGGCATTCCCAAGCTTTATTCTTCTGGGG AB2834 ptsG _DOWN_R 13 GTCGACCTACGCCAGCTATA AB2834 tyrR _UP_F 14 CAGGTGATGGATGTCGACAAACCACTACCG AB2834 tyrR _UP_R 15 TCGACAGAGAGCAAAGCTTCAGGCAACGCC AB2834 tyrR _DOWN_F 16 ACTGACACAACTCGAGGGTTCTGAGCTGCG AB2834 tyrR _DOWN_R 17 GCATCGCAACGCCTGGATCCGCCAATAGCT AB2834 pykA _UP_F 18 CGTTTCTAGACACCGTCTCGAGGTTCAGTTCGAC AB2834 pykA _UP_R 19 CCGCCAAGGATCCGTGATCCCATTCT AB2834 pykA _DOWN_F 20 CAACCGCGCCGTCGACTTGCTC AB2834 pykA _DOWN_R 21 CAAACGGCTTCTAGACGTTCAAGCTTGGCAACAA AB2834 pykF _UP_F 22 GAATATCAGGATCCAGCTTACCGCCTCATCCT AB2834 pykF _UP_R 23 GCAACAAAGTCTAGACCTTGTTCGCAACCA AB2834 pykF _DOWN_F 24 GAACAGCCGTCACTAGTTCAACAATGACAAC AB2834 pykF _DOWN_R 25 ACAGCGTCGACTTGCGCGTCAGTTCA AB2834

Genetic recombination

Gene inactivation was used in homologous recombination systems. First, the deletion vector was inserted into the receiving strain by electroporation, and single recombination was confirmed by PCR amplification. Double recombinant strains were selected on LB plates containing 25 mg / L chloramphenicol and 10% sucrose and confirmed by PCR amplification. All prepared plasmids were confirmed by sequencing and restriction enzyme analysis.

Flask Culture Conditions

Mutant strains were isolated from stock and placed in LB medium containing appropriate antibiotics and incubated at 37 ° C. Primary growth culture (1 ^st seed culture) was made by incubating for 12 hours at 30 ℃ 220 rpm in 3 ml of LB medium with a single colony. Second growth culture (2 ^nd seed culture) was done by incubating for 6 hours at 30 ℃ 220 rpm in 5ml LB medium. Since the main culture (main culture) was made by incubation for 24 hours at 30 ℃ 220 rpm in 50ml E. coli production medium, induction solution (15g / l glycerol, 10g / l lactose) or non-induction solution (no induction solution; 15 g / l glycerol) was added.

In the experiment, a method of deleting a target gene by inserting a deletion vector into the receiving strain is as follows.

Deletion vector (plasmid) production step: Cloning up and down regions of the genes (tyrR, ptsG, pykA and pykF) to be deleted in the pKO V vector, an E. coli suicide vector, and copying the gene into a plasmid prep kit kit) to prepare pure DNA dissolved in tertiary distilled water.

Transformation Step: In order to introduce the prepared deletion vector into the desired strain, the strain is taken between OD ₆₀₀ and 0.8 and 1, and the medium is removed using 10% glycerol. 50 μl of cells suspended in 10% glycerol were mixed with 2 μl of the defective vector DNA, and electroporation was performed using a BioRad Micro Pulsar machine and a cuvet of 2 mm intervals. After 1 ml of LB medium was added to the cells, the cells were incubated at 30 ° C. for one hour, plated on LB plates containing chloramphenicol, and then cultured at 30 ° C., and transformants were selected.

Single recombination induction step: To induce single recombination in transformants, the temperature was raised to 37 ° C., incubated in chloramphenicol-added LB medium, and then plated on chloramphenicol-added LB plates, followed by 37 ° C. Remove single unrecombinant strains on chromosomes grown in.

Double recombination induction step: A single recombinant strain is incubated in 37 ° C. LB medium without antibiotics to induce double recombination, ie gene deletion. The cultured strains are plated on LB plates containing 10% sucrose to select strains from which the plates are removed and whose genes are missing.

[Test Example 1]

The production curve and the metabolite DHS production of the recombinant E. coli prepared in Preparation Example were analyzed.

Specifically, the cells were separated by centrifuging 1 ml of the collected culture solution at 6,000 × g for 5 minutes and the supernatant was filtered through a 0.2 μm membrane filter. Cell growth was monitored by measuring absorbance (OD ₆₀₀ ) at ₆₀₀ nm, and the culture medium was diluted with deionized water (1:10). Biosynthesized DHS was separated and analyzed by HPLC (High Performance Liquid Chromatography), the column used was Aminex HPX-87H (300 x 7.8 mm; 9 mm Bio-rad), the mobile phase was 5 mM H ₂ SO ₄ , the analytical temperature was 65 ° C. The column was subjected to isocratic elution at a flow rate of 0.6 ml / min. Under these conditions, UV detection was performed in DHS (236 nm), PCA (259 nm) and CCM (262 nm). Standards used for quantitative analysis (DHS, PCA, Catechol, CCM: Sigma) were each dissolved in distilled water and filtered through a 0.25 μm membrane.

E. coli tyrR remove the genes in E. coli AB2834 is E. coli AB2834 Δ on either side of tyrR gene of the aroE it was prepared homologous armadillo (homologue arm) then obtained by PCR using the homologous recombination method aroE gene tyrR gene in the inactivated strain AB2834 △ aroE △ tyrR (△ ER ) mutant. This is E. coli AB2834 △ aroE Compared with, it was confirmed that the DHS production increased by about 4 times about 4.0 g / L biosynthesis (Fig. 2). This means that optimization of metabolic pathways can affect high production of DHS.

The AB2834 △ △ aroE tyrR (△ ER) After a inactivate the ptsG gene in the recombinant strain, AB2834 △ aroE △ tyrR (△ ER) AB2834 ΔaroEΔtyrRΔptsG mutant, in which ptsG gene was inactivated than recombinant strain, increased about 1.6 times the amount of DHS and biosynthesis was achieved (FIG. 3). Also, aroE In addition to gene defects AB2834 △ aroE △ tyrR △ ptsG △ pykA △ pykF ( △ ERGAF ) Recombinant strain was confirmed that the DHS production increased about 5 times compared to the existing strain AB2834 (Fig. 3). This means that more DHS can be accumulated in microorganisms by inactivating the activities of genes involved in pathways other than the pathway to DHS as predicted by analyzing the aromatic amino acid biosynthetic pathway.

In addition, the results are summarized in Figure 4 shows the dry cell weight of each of the recombinant strains that can be seen how the effect on the cell growth as the genes are sequentially removed from the AB2834, the primary strain in culture in a 5L fermenter 5 shows the DHS production of mutants over time.

E. coli AB2834 △ aroE △ tyrR strain was supplied with a feeding medium (glucose, mineral, nitrogen source yeast extract) from 17 hours of incubation, the time spent all the initial sugar in PB4-MD5 medium. As a result, the OD value was 63 and the dry cell weight was 42 g / L. In addition, no organic acid was produced, and DHS produced up to 45 g / L at 72 hours (see FIGS. 4 and 5).

E. coli AB2834 △ aroE △ tyrR △ ptsG strain was fed to the feeding medium (glucose, minerals, nitrogen source yeast extract) from 26 hours of incubation of the initial sugar consumption in PB4-MD5 medium. As a result, the OD value was 51 and the dry cell weight was 37 g / L. In addition, no organic acid was produced, and DHS produced up to 74 g / L in 120 hours (see FIGS. 4 and 5).

E. coli AB2834 △ aroE △ tyrR △ ptsG △ pykA strain was fed to the feeding medium (glucose, minerals, nitrogen source yeast extract) from 26 hours of incubation time of the initial sugar consumption in PB4-MD5 medium. As a result, the OD value was 46 and the dry cell weight was 36 g / L. In addition, no organic acid was produced, and DHS produced up to 81 g / L at 120 hours (see FIGS. 4 and 5).

E. coli AB2834 △ aroE △ tyrR △ ptsG △ pykA △ pykF strain was supplied with a feeding medium ( yield glucose, minerals, nitrogen source yeast extract) from 26 hours of incubation of the initial sugar consumption in PB4-MD5 medium medium. As a result, the OD value was 40 and the dry cell weight was 32 g / L. In addition, no organic acid was produced, and DHS produced up to 74 g / L in 96 hours (see FIGS. 4 and 5).

Overall, when the genes are inactivated one by one in the recombinant strains, the cell weight tends to be lower, and in DHS production, the DHS production of AB2834 Δ aroE △ tyrR strain, which has the least gene defect, is approximately 45 g / L. In addition , the production of DHS of the strains in which the △ ptsG , △ pykA , and △ pykF genes were sequentially inactivated was approximately doubled to produce 74-81 g / L of DHS.

[Test Example 2]

The production curve of the recombinant Escherichia coli prepared in the preparation example and the production of cis, cis-muconic acid, which are metabolites, were analyzed in the same manner as in [Test Example 1]. At this time, AB2834 △ aroE △ tyrR △ ptsG △ pykA △ pykF ( △ ERGAF ) In order to produce CCM in recombinant strains, the recombinant E. coli (pMESK01), which introduced three foreign genes synthesized according to the E. coli codon, was cultured. Specifically, RBS was added to each of the three foreign genes separately to make it easier to express the protein, and a single operon system was constructed using the lac promoter in front of the RBS of the first foreign gene. Three foreign genes using one promoter AB2834 △ aroE △ tyrR △ ptsG △ pykA △ pykF ( △ ERGAF ) It was introduced into the recombinant strain. Recombinant Escherichia coli (AB2834 aroEtyrRptsGpykApykF / pMESK1 ( ERGAF / pM1 ) mutant) prepared in the above preparation was cultured in a fermenter to analyze the culture characteristics and muconic acid production of the strain.

Specifically, LB medium containing 100 mg / L Ampicillin and 10 g / L glucose, isolated from stock as the primary growth culture of fermenter culture (Tryptone 10 g / L, yeast extract 5 g / L, NaCl 5 g / L, glucose 10 g / L) was inoculated with a single colony of the production strain was incubated for one day (24hr) in a rotary shaker at 37 ℃, 220rpm. Then, 50 ml of LB medium containing 100 mg / L ampicillin and 10 g / L glucose was added to a 250 ml baffle flask and inoculated with 1% of the first growth culture medium, followed by shaking culture at 220 rpm for 30 hours at 30 ° C. for 2 nd growth. The culture was carried out. 5L fermenter for producing muconic acid As a main culture, prepare 3L of production medium containing 100 mg / L of ampicillin, add it to the fermenter, and inoculate 1% of the secondary growth culture solution at 450 ~ 950rpm, 1vvm, and 30 ℃. E. coli production strains were cultured to produce muconic acid. After incubation, the glucose in the medium was consumed to induce muconic acid by induction with 0.1mM IPTG, and feeding was performed when the concentration of glucose added to the initial production medium dropped below 5 g / L. ) The medium was supplied and continuously supplied using an inflow pump so that the concentration of glucose supplied was maintained at a constant concentration (2-5 g / L).

As a result, as shown in Figure 6, E. coli AB2834 △ aroE △ tyrR △ ptsG △ pykA △ pykF / M1 strain 0.1 mM at the same time supplying the feeding medium (glucose, minerals, nitrogen source yeast extract) from 26 hours of incubation of the initial sugar consumption in PB4-MD5 medium Induction of IPTG showed an OD value of 33 and a dry cell weight of 25 g / L. In addition, no organic acid was produced and no intermediate metabolites DHS, PCA, and catechol were accumulated. Muconic acid produced up to 42.2 g / L in 120 hours.

Korea Microorganism Conservation Center (overseas) KCCM11922P 20161028 Korea Microorganism Conservation Center (overseas) KCCM11882P 20160901

<110> STR biotech <120> Microorganism for producing muconic acid precursor and method for          manufacturing <130> 13p556ind <160> 25 <170> KopatentIn 2.0 <210> 1 <211> 1542 <212> DNA <213> Artificial Sequence <220> <223> tyrR coding DNA <400> 1 atgcgtctgg aagtcttttg tgaagaccga ctcggtctga cccgcgaatt actcgatcta 60 ctcgtgctaa gaggcattga tttacgcggt attgagattg atcccattgg gcgaatctac 120 ctcaattttg ctgaactgga gtttgagagt ttcagcagtc tgatggccga aatacgccgt 180 attgcgggtg ttaccgatgt gcgtactgtc ccgtggatgc cttccgaacg tgagcatctg 240 gcgttgagcg cgttactgga ggcgttgcct gaacctgtgc tctctgtcga tatgaaaagc 300 aaagtggata tggcgaaccc ggcgagctgt cagctttttg ggcaaaaatt ggatcgcctg 360 cgcaaccata ccgccgcaca attgattaac ggctttaatt ttttacgttg gctggaaagc 420 gaaccgcaag attcgcataa cgagcatgtc gttattaatg ggcagaattt cctgatggag 480 attacgcctg tttatcttca ggatgaaaat gatcaacacg tcctgaccgg tgcggtggtg 540 atgttgcgat caacgattcg tatgggccgc cagttgcaaa atgtcgccgc ccaggacgtc 600 agcgccttca gtcaaattgt cgccgtcagc ccgaaaatga agcatgttgt cgaacaggcg 660 cagaaactgg cgatgctaag cgcgccgctg ctgattacgg gtgacacagg tacaggtaaa 720 gatctctttg cctacgcctg ccatcaggca agccccagag cgggcaaacc ttacctggcg 780 ctgaactgtg cgtctatacc ggaagatgcg gtcgagagtg aactgtttgg tcatgctccg 840 gaagggaaga aaggattctt tgagcaggcg aacggtggtt cggtgctgtt ggatgaaata 900 ggggaaatgt caccacggat gcaggcgaaa ttactgcgtt tccttaatga tggcactttc 960 cgtcgggttg gcgaagacca tgaggtgcat gtcgatgtgc gggtgatttg cgctacgcag 1020 aagaatctgg tcgaactggt gcaaaaaggc atgttccgtg aagatctcta ttatcgtctg 1080 aacgtgttga cgctcaatct gccgccgcta cgtgactgtc cgcaggacat catgccgtta 1140 actgagctgt tcgtcgcccg ctttgccgac gagcagggcg tgccgcgtcc gaaactggcc 1200 gctgacctga atactgtact tacgcgttat gcgtggccgg gaaatgtgcg gcagttaaag 1260 aacgctatct atcgcgcact gacacaactg gacggttatg agctgcgtcc acaggatatt 1320 ttgttgccgg attatgacgc cgcaacggta gccgtgggcg aagatgcgat ggaaggttcg 1380 ctggacgaaa tcaccagccg ttttgaacgc tcggtattaa cccagcttta tcgcaattat 1440 cccagcacgc gcaaactggc aaaacgtctc ggcgtttcac ataccgcgat tgccaataag 1500 ttgcgggaat atggtctgag tcagaagaag aacgaagagt aa 1542 <210> 2 <211> 1434 <212> DNA <213> Artificial Sequence <220> P223G coding DNA <400> 2 atgtttaaga atgcatttgc taacctgcaa aaggtcggta aatcgctgat gctgccggta 60 tccgtactgc ctatcgcagg tattctgctg ggcgtcggtt ccgcgaattt cagctggctg 120 cccgccgttg tatcgcatgt tatggcagaa gcaggcggtt ccgtctttgc aaacatgcca 180 ctgatttttg cgatcggtgt cgccctcggc tttaccaata acgatggcgt atccgcgctg 240 gccgcagttg ttgcctatgg catcatggtt aaaaccatgg ccgtggttgc gccactggta 300 ctgcatttac ctgctgaaga aatcgcctct aaacacctgg cggatactgg cgtactcgga 360 gggattatct ccggtgcgat cgcagcgtac atgtttaacc gtttctaccg tattaagctg 420 cctgagtatc ttggcttctt tgccggtaaa cgctttgtgc cgatcatttc tggcctggct 480 gccatcttta ctggcgttgt gctgtccttc atttggccgc cgattggttc tgcaatccag 540 accttctctc agtgggctgc ttaccagaac ccggtagttg cgtttggcat ttacggtttc 600 atcgaacgtt gcctggtacc gtttggtctg caccacatct ggaacgtacc tttccagatg 660 cagattggtg aatacaccaa cgcagcaggt caggttttcc acggcgacat tccgcgttat 720 atggcgggtg acccgactgc gggtaaactg tctggtggct tcctgttcaa aatgtacggt 780 ctgccagctg ccgcaattgc tatctggcac tctgctaaac cagaaaaccg cgcgaaagtg 840 ggcggtatta tgatctccgc ggcgctgacc tcgttcctga ccggtatcac cgagccgatc 900 gagttctcct tcatgttcgt tgcgccgatc ctgtacatca tccacgcgat tctggcaggc 960 ctggcattcc caatctgtat tcttctgggg atgcgtgacg gtacgtcgtt ctcgcacggt 1020 ctgatcgact tcatcgttct gtctggtaac agcagcaaac tgtggctgtt cccgatcgtc 1080 ggtatcggtt atgcgattgt ttactacacc atcttccgcg tgctgattaa agcactggat 1140 ctgaaaacgc cgggtcgtga agacgcgact gaagatgcaa aagcgacagg taccagcgaa 1200 atggcaccgg ctctggttgc tgcatttggt ggtaaagaaa acattactaa cctcgacgca 1260 tgtattaccc gtctgcgcgt cagcgttgct gatgtgtcta aagtggatca ggccggcctg 1320 aagaaactgg gcgcagcggg cgtagtggtt gctggttctg gtgttcaggc gattttcggt 1380 actaaatccg ataacctgaa aaccgagatg gatgagtaca tccgtaacca ctaa 1434 <210> 3 <211> 1443 <212> DNA <213> Artificial Sequence <220> <223> pykA coding DNA <400> 3 atgtccagaa ggcttcgcag aacaaaaatc gttaccacgt taggcccagc aacagatcgc 60 gataataatc ttgaaaaagt tatcgcggcg ggtgccaacg ttgtacgtat gaacttttct 120 cacggctcgc ctgaagatca caaaatgcgc gcggataaag ttcgtgagat tgccgcaaaa 180 ctggggcgtc atgtggctat tctgggtgac ctccaggggc ccaaaatccg tgtatccacc 240 tttaaagaag gcaaagtttt cctcaatatt ggggataaat tcctgctcga cgccaacctg 300 ggtaaaggtg aaggcgacaa agaaaaagtc ggtatcgact acaaaggcct gcctgctgac 360 gtcgtgcctg gtgacatcct gctgctggac gatggtcgcg tccagttaaa agtactggaa 420 gttcagggca tgaaagtgtt caccgaagtc accgtcggtg gtcccctctc caacaataaa 480 ggtatcaaca aacttggcgg cggtttgtcg gctgaagcgc tgaccgaaaa agacaaagca 540 gacattaaga ctgcggcgtt gattggcgta gattacctgg ctgtctcctt cccacgctgt 600 ggcgaagatc tgaactatgc ccgtcgcctg gcacgcgatg caggatgtga tgcgaaaatt 660 gttgccaagg ttgaacgtgc ggaagccgtt tgcagccagg atgcaatgga tgacatcatc 720 ctcgcctctg acgtggtaat ggttgcacgt ggcgacctcg gtgtggaaat tggcgacccg 780 gaactggtcg gcattcagaa agcgttgatc cgtcgtgcgc gtcagctaaa ccgagcggta 840 atcacggcga cccagatgat ggagtcaatg attactaacc cgatgccgac gcgtgcagaa 900 gtcatggacg tagcaaacgc cgttctggat ggtactgacg ctgtgatgct gtctgcagaa 960 actgccgctg ggcagtatcc gtcagaaacc gttgcagcca tggcgcgcgt ttgcctgggt 1020 gcggaaaaaa tcccgagcat caacgtttct aaacaccgtc tggacgttca gttcgacaat 1080 gtggaagaag ctattgccat gtcagcaatg tacgcagcta accacctgaa aggcgttacg 1140 gcgatcatca ccatgaccga atcgggtcgt accgcgctga tgacctcccg tatcagctct 1200 ggtctgccaa ttttcgccat gtcgcgccat gaacgtacgc tgaacctgac tgctctctat 1260 cgtggcgtta cgccggtgca ctttgatagc gctaatgacg gcgtagcagc tgccagcgaa 1320 gcggttaatc tgctgcgcga taaaggttac ttgatgtctg gtgacctggt gattgtcacc 1380 cagggcgacg tgatgagtac cgtgggttct actaatacca cgcgtatttt aacggtagag 1440 taa 1443 <210> 4 <211> 1413 <212> DNA <213> Artificial Sequence <220> <223> pykF coding DNA <400> 4 atgaaaaaga ccaaaattgt ttgcaccatc ggaccgaaaa ccgaatctga agagatgtta 60 gctaaaatgc tggacgctgg catgaacgtt atgcgtctga acttctctca tggtgactat 120 gcagaacacg gtcagcgcat tcagaatctg cgcaacgtga tgagcaaaac tggtaaaacc 180 gccgctatcc tgcttgatac caaaggtccg gaaatccgca ccatgaaact ggaaggcggt 240 aacgacgttt ctctgaaagc tggtcagacc tttactttca ccactgataa atctgttatc 300 ggcaacagcg aaatggttgc ggtaacgtat gaaggtttca ctactgacct gtctgttggc 360 aacaccgtac tggttgacga tggtctgatc ggtatggaag ttaccgccat tgaaggtaac 420 aaagttatct gtaaagtgct gaacaacggt gacctgggcg aaaacaaagg tgtgaacctg 480 cctggcgttt ccattgctct gccagcactg gctgaaaaag acaaacagga cctgatcttt 540 ggttgcgaac aaggcgtaga ctttgttgct gcttccttta ttcgtaagcg ttctgacgtt 600 atcgaaatcc gtgagcacct gaaagcgcac ggcggcgaaa acatccacat catctccaaa 660 atcgaaaacc aggaaggcct caacaacttc gacgaaatcc tcgaagcctc tgacggcatc 720 atggttgcgc gtggcgacct gggtgtagaa atcccggtag aagaagttat cttcgcccag 780 aagatgatga tcgaaaaatg tatccgtgca cgtaaagtcg ttatcactgc gacccagatg 840 ctggattcca tgatcaaaaa cccacgcccg actcgcgcag aagccggtga cgttgcaaac 900 gccatcctcg acggtactga cgcagtgatg ctgtctggtg aatccgcaaa aggtaaatac 960 ccgctggaag cggtttctat catggcgacc atctgcgaac gtaccgaccg cgtgatgaac 1020 agccgtctcg agttcaacaa tgacaaccgt aaactgcgca ttaccgaagc ggtatgccgt 1080 ggtgccgttg aaactgctga aaaactggat gctccgctga tcgtggttgc tactcagggc 1140 ggtaaatctg ctcgcgcagt acgtaaatac ttcccggatg ccaccatcct ggcactgacc 1200 accaacgaaa aaacggctca tcagttggta ctgagcaaag gcgttgtgcc gcagcttgtt 1260 aaagagatca cttctactga tgatttctac cgtctgggta aagaactggc tctgcagagc 1320 ggtctggcac acaaaggtga cgttgtagtt atggtttctg gtgcactggt accgagcggc 1380 actactaaca ccgcatctgt tcacgtcctg taa 1413 <210> 5 <211> 819 <212> DNA <213> Artificial Sequence <220> <223> aroE coding DNA <400> 5 atggaaacct atgctgtttt tggtaatccg atagcccaca gcaaatcgcc attcattcat 60 cagcaatttg ctcagcaact gaatattgaa catccctatg ggcgcgtgtt ggcacccatc 120 aatgatttca tcaacacact gaacgctttc tttagtgctg gtggtaaagg tgcgaatgtg 180 acggtgcctt ttaaagaaga ggcttttgcc agagcggatg agcttactga acgggcagcg 240 ttggctggtg ctgttaatac cctcatgcgg ttagaagatg gacgcctgct gggtgacaat 300 accgatggtg taggcttgtt aagcgatctg gaacgtctgt cttttatccg ccctggttta 360 cgtattctgc ttatcggcgc tggtggagca tctcgcggcg tactactgcc actcctttcc 420 ctggactgtg cggtgacaat aactaatcgg acggtatccc gcgcggaaga gttggctaaa 480 ttgtttgcgc acactggcag tattcaggcg ttgagtatgg acgaactgga aggtcatgag 540 tttgatctca ttattaatgc aacatccagt ggcatcagtg gtgatattcc ggcgatcccg 600 tcatcgctca ttcatccagg catttattgc tatgacatgt tctatcagaa aggaaaaact 660 ccttttctgg catggtgtga gcagcgaggc tcaaagcgta atgctgatgg tttaggaatg 720 ctggtggcac aggcggctca tgcctttctt ctctggcacg gtgttctgcc tgacgtagaa 780 ccagttataa agcaattgca ggaggaattg tccgcgtga 819 <210> 6 <211> 843 <212> DNA <213> Artificial Sequence <220> <223> optimized asbF coding DNA <400> 6 atgaaatact ccctgtgcac tattagcttc cgtcatcaac tgatttcttt cactgacatc 60 gttcagttcg cgtacgaaaa cggttttgaa ggcatcgagc tgtggggtac tcatgcccag 120 aacctgtaca tgcaggagcg tgaaaccacc gagcgtgagc tgaacttcct gaaagataag 180 aacctggaaa tcaccatgat ctctgactac ctggatattt ccctgtccgc cgacttcgag 240 aaaaccattg aaaaatccga acagctggtg gtgctggcaa actggttcaa caccaacaag 300 atccgtacct ttgcgggcca gaaaggtagc aaggactttt ctgaacagga acgtaaagag 360 tacgtaaagc gcatccgtaa aatctgcgac gtttttgcac agcataacat gtacgtcctg 420 ctggaaactc atccgaacac cctgaccgac actctgccta gcaccattga actgctggaa 480 gaagtgaacc atccaaacct gaaaatcaac ctggatttcc tgcatatttg ggaaagcggc 540 gcgaatccaa tcgactcttt ccatcgcctg aaaccgtgga ctctgcacta ccatttcaaa 600 aacatctcct ccgcggatta cctgcacgtg ttcgaaccga ataacgtcta cgccgctgca 660 ggctcccgta ttggtatggt tccactgttt gagggcatcg ttaactacga cgaaatcatt 720 caagaagttc gtggcaccga cctgtttgct tctctggaat ggttcggcca caactctaaa 780 gagatcctga aggaagaaat gaaagtgctg atcaaccgta aactggaagt ggtgacgagc 840 tga 843 <210> 7 <211> 1509 <212> DNA <213> Artificial Sequence <220> <223> optimized aroY coding DNA <400> 7 atgactgcac caatccagga cctgcgcgac gcaatcgctc tgctgcaaca gcacgataac 60 cagtatctgg aaaccgatca cccagttgac ccgaatgcgg agctggcagg cgtctaccgt 120 catattggtg ccggtggcac tgttaaacgc ccgacccgca tcggcccagc aatgatgttt 180 aacaacatca aaggctaccc gcacagccgc atcctggtag gcatgcacgc ttctcgtcaa 240 cgtgcggcac tgctgctggg ctgtgaagca tctcagctgg ctctggaggt gggcaaggcc 300 gtcaaaaagc cggtggcgcc ggttgttgtt ccggcatctt ccgctccttg ccaggaacag 360 attttcctgg ccgatgatcc ggacttcgac ctgcgtacgc tgctgccggc tcacacgaac 420 actccgatcg acgcgggtcc gtttttctgc ctgggtctgg ctctggcgtc tgacccggtg 480 gatgcgagcc tgaccgacgt gaccatccac cgcctgtgcg ttcagggtcg tgacgaactg 540 agcatgttcc tggcagcagg tcgtcacatt gaagtattcc gccaaaaagc ggaagccgcc 600 ggtaaaccgc tgcctattac catcaacatg ggtctggacc cggcgatcta catcggcgct 660 tgctttgaag cacctacgac tccgttcggt tacaacgaac tgggtgtagc cggtgctctg 720 cgccagcgtc cggtggaact ggtacagggc gtgagcgtcc cagaaaaagc catcgcacgc 780 gctgaaatcg taatcgaagg cgaactgctg ccgggcgtcc gcgttcgtga agaccagcac 840 accaacagcg gtcacgcaat gcctgaattc ccgggctact gtggcggtgc caacccgtcc 900 ctgccggtta ttaaggttaa agctgttact atgcgtaaca acgcgattct gcagactctg 960 gtcggtccgg gtgaggaaca cacgaccctg gcgggcctgc cgactgaagc ctctatttgg 1020 aatgcggttg aagcagccat cccgggcttc ctgcagaatg tttacgctca taccgcgggt 1080 ggcggtaaat tcctgggtat cctgcaggtt aaaaagcgcc agccggcaga tgaaggtcgc 1140 caaggtcagg ctgccctgct ggcgctggct acctactctg aactgaaaaa catcattctg 1200 gttgacgaag atgtcgatat ctttgattcc gacgacatcc tgtgggctat gacgactcgt 1260 atgcagggcg atgtttctat caccaccatc ccgggcatcc gtggtcacca gctggacccg 1320 tcccagactc cggaatattc cccgagcatc cgcggcaacg gcatctcctg taaaaccatt 1380 ttcgactgca ccgttccgtg ggctctgaaa tcccacttcg agcgtgcgcc gtttgcggac 1440 gttgatccgc gtccgttcgc accggagtat ttcgctcgtc tggagaaaaa tcagggttcc 1500 gcgaaataa 1509 <210> 8 <211> 923 <212> DNA <213> Artificial Sequence <220> <223> optimized catA coding DNA <400> 8 atgaaccgtc agcagatcga cgcgctggtt aaacagatga acgtggatac cgctaagggc 60 gaagttgacg ctcgcgtaca gcagattgta gtacgtctgc tgggtgacct gttccaggca 120 atcgaagatc tggatattca gccgtctgaa gtgtggaaag gtctggagta tttcaccgat 180 gctggtcagg cgaacgaact gggtctgctg gcggccggtc tgggcctgga gcactatctg 240 gacctgcgtg cggatgaagc agatgcaaaa gcaggtgtga ccggtggtac tccgcgtacc 300 attgaaggtc cgctgtatgt tgcaggtgct ccggaaagcg ttggtttcgc gcgtatggat 360 gacggtactg aatctggtaa aatcgatact ctgatcattg aaggcaccgt caccgacacc 420 gacggtaata tcatcgaaaa cgctaaagta gaggtttggc acgcgaactc tctgggcaac 480 tattctttct ttgataaatc ccagtccgac ttcaacctgc gtcgtaccat tctgaccgat 540 gcggacggta aatatgttgc gctgacgacg atgccagtag gctatggctg tccgccggaa 600 ggtaccaccc aagcgctgct gaacaaactg ggtcgccacg gtaaccgtcc ttctcacgta 660 cactatttcg tgtctgctcc gggctaccgt aaactgacga cccaattcaa tatcgagggt 720 gacgaatacc tgtgggatga tttcgctttt gctacccgtg atggtctggt ggcgaccgcg 780 gtagacgtga ccgatccagc tgaaatccag cgtcgcggcc tggatcacgc ttttaaacac 840 atcaccttca acattgaact ggttaaagat gcagccgcgg cacctagcac tgaggtagaa 900 cgccgtcgtg cgtccgctta att 923 <210> 9 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> ribosome binding site <400> 9 gaagga 6 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ptsG_UP Forward primer <400> 10 ttacatatgc gggatccggt aggcgaacgt 30 <210> 11 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> ptsG_UP Reverse primer <400> 11 catggtttta accatctaga cataggcaac aactcgagcc agcgcggata 50 <210> 12 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> ptsG_DOWN_Forward primer <400> 12 tccacgcgat tctagaaggc ctggcattcc caagctttat tcttctgggg 50 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ptsG_DOWN_Reverse primer <400> 13 gtcgacctac gccagctata 20 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> tyrR_UP_Forward primer <400> 14 caggtgatgg atgtcgacaa accactaccg 30 <210> 15 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> tyrR_UP_Reverse primer <400> 15 tcgacagaga gcaaagcttc aggcaacgcc 30 <210> 16 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> tyrR_Down_Forward primer <400> 16 actgacacaa ctcgagggtt ctgagctgcg 30 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> tyrR_Down_Reverse primer <400> 17 gcatcgcaac gcctggatcc gccaatagct 30 <210> 18 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pykA_UP_Forward primer <400> 18 cgtttctaga caccgtctcg aggttcagtt cgac 34 <210> 19 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> pykA_UP_Reverse primer <400> 19 ccgccaagga tccgtgatcc cattct 26 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> pykA_Down_Forward primer <400> 20 caaccgcgcc gtcgacttgc tc 22 <210> 21 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pykA_Down_Reverse primer <400> 21 caaacggctt ctagacgttc aagcttggca acaa 34 <210> 22 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> pykF_UP_Forward primer <400> 22 gaatatcagg atccagctta ccgcctcatc ct 32 <210> 23 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pykF_UP_Reverse primer <400> 23 gcaacaaagt ctagaccttg ttcgcaacca 30 <210> 24 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> pykF_Down_Forward primer <400> 24 gaacagccgt cactagttca acaatgacaa c 31 <210> 25 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> pykF_Down_Reverse primer <400> 25 acagcgtcga cttgcgcgtc agttca 26

Claims (11)

aroE , tyrR and ptsG genes;
aroE , tyrR, ptsG and pykA genes;
aroE , tyrR, ptsG and pykF genes; or
AroE , tyrR , ptsG , pykA and pykF genes; genetically modified E. coli. delete The recombinant E. coli of claim 1, wherein the inactivation of the gene is deletion of the gene in the E. coli. The genetically engineered Escherichia coli according to claim 1 or 3, wherein the recombinant Escherichia coli is Escherichia coli having increased DHS (3-dehydroshikimate) biosynthesis. 3. A method according to claim 1 or 3, wherein the E. coli is asbF ^opt polynucleotide, aroY ^opt polynucleotides and catA ^opt including the polynucleotide, and each upstream (upstream) of the three polynucleotides encoding the encoding the encoding the Recombination comprising a ribosome binding site (rbs) derived from E. coli, and a promoter upstream of the ribosome binding site (rbs) of the first transcribed polynucleotide of the three polynucleotides It is further transformed with a vector, recombinant E. coli. The E. coli of claim 5, wherein the E. coli is produced for cis, cis-muconic acid. A culture of the recombinant E. coli of claim 1 or 3. Culture of the genetically modified Escherichia coli of claim 5. The culture of claim 8, wherein the culture comprises cis, cis-muconic acid. A method for producing 3-dehydroshikimate (DHS) comprising culturing the recombinant E. coli of claim 1 or claim 3. A method for producing cis, cis-muconic acid, comprising culturing the recombinant E. coli of claim 5.

Images