KR102062664B1 - Primer sets for identifying species of necrophagous dermestidae and identification method using the same - Google Patents

Abstract

The present invention relates to a composition for identifying carrion carpet beetles, a kit for identifying carrion carpet beetles including the same, and a method for identifying carrion carpet beetles using the same. The method of the present invention, by amplifying the entire base sequence of a cytochrome c oxidase subunit I (COI) gene of carrion carpet beetles, can be advantageously used for identifying species of carrion carpet beetles.

Description

Primer sets for identifying species of necrophagous dermestidae and identification method using the same}

The present invention relates to a composition for identifying tasting worms, a kit for identifying fish worms including the same, and a method for identifying fish worms using the same.

Estimation of death time or postmortem interval (PMI) is very important in the event of the body. The decay that begins after all animals, including humans, dies is the involvement of intestinal flora and tasting arthropods, depending on the degree of decay, the species of necrophagous insects that enter the body ( species are different.

In addition to the commonly known flies, tasting insects include tasting beetles. Beetles are generally known to have longer larvae than flies. This means that beetles are useful not only in the initial decay stage but also in the late decay stage in estimating the minimum post mortem elapsed time (Midgley et al. 2010).

In particular, the Dermestes of the Dermestidae dermestinae among the tasting beetles are known as forensicly important skin beetles and can whiten the body in just 24 days (Byrd and Castner). , 2010). Common larvae are commonly found in the bodies of the sciatic or dry stages in the warm months of the room (Byrd and Castner, 2010).

Due to the forensic importance of this species, numerous breeding data, case studies, biological / legal procedural reviews, morphological search tables for adults (Hinton, 1945; Peacock, 1993) and morphological search tables for larvae (Zhantiev, 1998 and 1999) Was released. However, the difficulty of identifying species in the genus Lung is still recognized as one of the factors that hinder the forensic application of various biological information. In particular, in case of larvae, species identification is very difficult.

Domestic Publication No. 10-2009-0054965

The present inventors made diligent research efforts to develop a method for identifying species of tasting flounder. As a result, when using a primer set consisting of the base sequence of SEQ ID NO: 1 to the base sequence of SEQ ID NO: 6, it was found that the entire base sequence of the Cytochrome c Oxidase Subunit I (COI) gene of the pods Thus, the present invention has been completed.

Accordingly, it is an object of the present invention to provide a composition for identifying tasting dung.

It is another object of the present invention to provide a kit for identifying a worm, which includes a composition for identifying a worm.

Still another object of the present invention is to provide a method for identifying tasting roosts.

The present inventors made diligent research efforts to develop a method for identifying species of tasting flounder. As a result, when using a primer set consisting of the base sequence of SEQ ID NO: 1 to the base sequence of SEQ ID NO: 6, it was found that the entire base sequence of the Cytochrome c Oxidase Subunit I (COI) gene of the pods It was.

The present invention relates to a composition for identifying tasting worms, a kit for identifying fish worms including the same, and a method for identifying fish worms using the same.

Hereinafter, the present invention will be described in more detail.

One aspect of the invention the first primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO: 1; A second primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 3 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 4; And a third primer set including a forward primer consisting of a nucleotide sequence of SEQ ID NO: 5 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 6.

As used herein, the term "tempered dung beetle" refers to a dung beetle that grows and hatches in a body, and includes adult and larvae of dung beetles.

The Tasting Castle susireongyi will be susireongyi (Dermestes coarctatus), young female in black susireongyi (Dermestes frischi), dark brown susireongyi (Dermestes haemorrhoidalis), Cancer Black susireongyi (Dermestes maculatus), black susireongyi (Dermestes tesselatocollis) or hongtti susireongyi (Dermests vorax) However, it is not limited thereto.

As used herein, the term "primer" is a nucleic acid sequence having a short free 3 'hydroxyl group, which can form complementary templates and base pairs of plant nucleic acids, By a short nucleic acid sequence that serves as a starting point for.

The first primer set was designed to amplify the 545th base pair of the tRNA-Trp ~ tRNA-Cys ~ tRNA-Tyr ~ COI genes by referring to the tRNA-Trp gene of the tasting worm.

The second primer set was designed to amplify the 364th to 1298th base pairs of the COI gene with reference to the Cytochrome c Oxidase Subunit I (COI) gene.

The third primer set was designed to amplify the 966th base pair of the COI gene and the 10th base pair of the tRNA-Leu ~ COII gene with reference to the tRNA-Leu and Cytochrome c Oxidase Subunit II (COII) genes.

Another aspect of the invention the first primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 1; A second primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 3 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 4; And a third primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 5 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 6.

The kit can be used to identify tasting dung from samples.

The kit may include the first primer set, the second primer set, and the third primer set, as well as one or more other component compositions, solutions or devices suitable for the assay method.

The kit may be a kit containing the necessary elements necessary to perform PCR analysis, in addition to each of the above primer sets, test tubes or other suitable containers, reaction buffers (variable pH and magnesium concentrations), deoxynucleotides (dNTPs) , Enzymes such as Taq-polymerase, DNase, RNAse inhibitors, DEPC-water (DEPCwater) and sterile water, and the like.

When the kit is used for PCR analysis, PCR amplification products can be directly obtained from a sample without separate cDNA, and can be separated by agarose gel electrophoresis.

The kit is not limited to a specific form and may be implemented in various forms. For example, the kit may comprise a set of lyophilized primers contained in a container (eg, a disposable PCR tube, etc.). Where two or more primer sets are included, each primer set may be contained in each tube individually.

The sample may be used, but may not be limited to adult larvae or larvae.

Yet another aspect of the present invention relates to a method for identifying a rotting worm that includes the following steps.

A first primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 2; A second primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 3 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 4; And a sample using a kit for identifying a worm, comprising a composition for identifying a worm, comprising a forward primer consisting of a nucleotide sequence of SEQ ID NO: 5 and a reverse primer consisting of a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 6. An amplification step of obtaining a polymerase chain reaction (PCR) amplification product from the amplification product; And

Assay step to analyze PCR amplification products.

The overlapping contents of the tasting snail identification composition and the tasting snail identification kit including the same are omitted in consideration of the complexity of the present specification.

The sample may be used, but may not be limited to adult larvae or larvae.

The analysis may be performed by, for example, Sanger sequencing method, but is not limited thereto.

The method can identify the species of the tassier by amplifying the nucleotide sequence of the Cytochrome c Oxidase Subunit I (COI) gene (1545 base pairs).

The Tasting Castle susireongyi will be susireongyi (Dermestes coarctatus), young female in black susireongyi (Dermestes frischi), dark brown susireongyi (Dermestes haemorrhoidalis), Cancer Black susireongyi (Dermestes maculatus), black susireongyi (Dermestes tesselatocollis) or hongtti susireongyi (Dermests vorax) However, it is not limited thereto.

The present invention relates to a composition for identifying a squirrel, and to a method for identifying a squirrel, comprising the same, and a method for identifying a squirrel, using the same. Cytochrome c Oxidase Subunit I) By amplifying the entire nucleotide sequence of the gene, it can be usefully used for the identification of the species of the species.

1 is a result of a polymerase chain reaction of six species of aquatic mumps using the first primer set for identifying a musculus muroid according to an embodiment of the present invention.
Figure 2 is a result of the polymerase chain reaction of six species of aquatic mumps using the second primer set for identifying the musculous mumps in accordance with one embodiment of the present invention.
Figure 3 is a result of the polymerase chain reaction of six species of aquatic mumps using the third primer set for identifying the musculous mumps in accordance with one embodiment of the present invention.
Figure 4A is a result of the identification of six species of tadpoles according to an embodiment of the present invention, the result of the base pair 1-288 of the COI gene 1545 base pairs.
Figure 4B is the result of the identification of six species of tadpoles according to an embodiment of the present invention, the result of the 289-576th base pair of the COI gene 1545 base pairs.
Figure 4C is the result of the identification of six species of tadpoles according to an embodiment of the present invention, the result of the 577-864 base pair of the 1545 base pair COI gene.
Figure 4D is the result of the identification of six species of tadpoles according to an embodiment of the present invention, the result of the 865-1104 base pair of the COI gene 1545 base pairs.
Figure 4E is the result of the identification of six species of tadpoles according to an embodiment of the present invention, the result of the 1105-1344 base pair of the COI gene 1545 base pairs.
Figure 4F is the result of the identification of six species of tadpoles according to an embodiment of the present invention, the result of the 1345-1545 base pair of the 1545 base pair COI gene.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

Example 1. Primer Preparation

The nucleotide sequences of the Cytochrome C Oxidase Subunit I (COI) gene and tRNA-Leucine gene of the tasting fly were analyzed by MEGA 7.0.25 and primers were designed using primer 3 Web 0.4.0 program. Nucleotide sequence of each species is obtained from the National Center for Biotechnology Information (NCBI) GenBank or by analyzing the nucleotide sequence of the amplified product amplified using a primer, the prepared primers are shown in Table 1 below.

Primer set SEQ ID NO: Sequence (5'-3 ') Amplification Product Size (bp) One One Forward direction AACTGATAGCCTTCAAAGC 706 2 Reverse GAATAACTCCTGATCGAATACC 2 3 Forward direction GCAGGAACAGGATGAACAG 926 4 Reverse TAACCTTTTTTCCTCAACACTT 3 5 Forward direction ATGATTAGCAACACTTCATGG 660 6 Reverse TATATTTCAATTTGCTATTTCTAA

Experimental Example 1. Isolation of DNA

The following six species of locusts found in the carcasses were used: Dermestes coarctatus , Dermestes frischi , Dermestes haemorrhoidalis , Dermestes maculatus , and Black horned tesselato And Dermests vorax . DNA was isolated from the worm according to the method of close sample type provided by Geneall Tissue SV Mini Kit (Geneall, Seoul, Korea), and DNA concentration was measured using NanoDrop 2000c Spectrophotometer (Thermo Fisher Scientific, Wilmington, Delaware, USA). It was. DNA solution was diluted to experimental concentration (10 ng / uL) with tertiary distilled water and stored at −20 ° C. until use.

Experimental Example 2. Polymerase Chain Reaction

For 6 kinds of DNA of Experimental Example 1, DNA 1 uL, 2X TOPsimple? Polymerization chain reaction using 10 uL of PreMIX-HOT (Enzynomics, Korea), 0.8 uL of primer set (first to third primer sets) (0.4 uL of forward primer, 0.4 uL of reverse primer) and distilled water (8.2 uL) (PCR) was performed. Specifically, after one cycle of the initial denaturation process at 95 ° C. for 10 minutes, at 30 ° C. for 30 seconds; 30 seconds annealing at 45 ° C .; And 40 cycles of the 60 second extension process at 72 ° C. and finally reacted at 72 ° C. for 15 minutes. Amplified product (amplicon) was subjected to 2% gel electrophoresis.

As can be seen in Figures 1 to 3, in the first primer set to the third primer set Dwarf (Dco), young dark squirrel (Dfr), dark brown squirrel (Dha), dark squirrel (Dma), black squirrel (Dte) ) And Hongshui (Dvo) were both amplified at the expected size.

Experimental Example 3. Sanger sequencing

The amplified nucleotide sequence of the amplified product of Experimental Example 2 was analyzed using Sanger sequencing method.

As can be seen in Figures 4A to 4F, the base sequence of 6 COI gene 1545 base pairs of six species of aquatic species was assembled by assembling the base sequences of the amplification products into a total of three sets obtained by the analysis.

Sintered

When performing the polymerase chain reaction and Sanger sequencing according to the above embodiments, it was confirmed that it is possible to efficiently identify a particular species of tadpoles.

<110> Korea University Research and Business Foundation <120> Primer sets for identifying species of necrophagous dermestidae <130> PN180308 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer 1F <400> 1 aactgatagc cttcaaagc 19 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer 1R <400> 2 gaataactcc tgatcgaata cc 22 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer 2F <400> 3 gcaggaacag gatgaacag 19 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer 2R <400> 4 taaccttttt tcctcaacac tt 22 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer 3F <400> 5 atgattagca acacttcatg g 21 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer 3R <400> 6 tatatttcaa tttgctattt ctaa 24

Claims (5)

A composition for identifying a swarming swarm including a primer set for a polymerase chain reaction for amplifying a COI DNA barcoding region of a swarmable swarm,
The primer set for the polymerase chain reaction,
A first primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 1 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 2;
A second primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 3 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 4; And
Comprising a third primer set consisting of a forward primer consisting of a nucleotide sequence of SEQ ID NO: 5 and a reverse primer consisting of a nucleotide sequence of SEQ ID NO: 6, a composition for identification of worms. The method according to claim 1, wherein the tasting dung beetle ( Dermestes coarctatus ), the young dwarf ( Dermestes frischi ), the dark brown dung ( Dermestes haemorrhoidalis ), the black dwarf ( Dermestes maculatus ), the black snails ( Dermestes tehlius tessel ) The composition is selected from the group consisting of ( Dermests vorax ). A kit for identifying tasting dungs comprising the composition of claim 1. A method of identifying the food stinger, comprising the following steps:
An amplifying step of obtaining a polymerase chain reaction (PCR) amplification product from a sample using the kit of claim 3; And
Assay step to analyze PCR amplification products. The method according to claim 4, wherein the tasting dung beetle ( Dermestes coarctatus ), the young dwarf ( Dermestes frischi ), the dark brown dung ( Dermestes haemorrhoidalis ), the dark dwarf ( Dermestes maculatus ), the black snails ( Dermestes tehlius tessel ) ( Dermests vorax ).

Images