CN100380118C - Abalone species discriminating method - Google Patents
Abalone species discriminating method Download PDFInfo
- Publication number
- CN100380118C CN100380118C CNB2005100997726A CN200510099772A CN100380118C CN 100380118 C CN100380118 C CN 100380118C CN B2005100997726 A CNB2005100997726 A CN B2005100997726A CN 200510099772 A CN200510099772 A CN 200510099772A CN 100380118 C CN100380118 C CN 100380118C
- Authority
- CN
- China
- Prior art keywords
- bao
- abalone
- dna
- identifying
- specific primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The present invention provides a method for identifying abalone varieties, which relates to a method for identifying the biological materials of abalones, in particular to a method for identifying abalone varieties. The present invention provides a method for identifying abalone varieties, which is simple and convenient. The method of the present invention comprises the following steps: 10 to 25 mg of abalone tissue sample is taken, a protease K-phenol-chloroform method or a DNA extracting kit is used for extracting total DNA, and the sample is dissolved in distilled water or the TE solution; the extracted total DNA is taken, and then, specific primers are respectively used for carrying out PCR amplification under the common PCR reaction condition; the PCR reaction products are taken and are treated by agarose gel electrophoresis, ethidium bromide is added into the gel, the gel which is treated by electrophoresis is observed by an ultraviolet lamp, and each specific primer amplifies obvious strips from the total DNA of the corresponding abalone of each specific primer. The present invention is sensitive and accurate, can be used for identifying abalone larvae of different varieties, which are difficult to identify by people's eyes, and can be used for identifying the varieties of the larvae; the present invention can also be used for identifying the raw materials of the abalones of different varieties for processing abalone products.
Description
Technical field
The present invention relates to a kind of discrimination method of Bao class biomaterial, especially relate to a kind of abalone species discriminating method.
Background technology
Bao is commonly called as abalone, is the very high marine products economic animal of a class economic worth, and the edible and delicious flavour of its meat is the traditional famous precious marine product of China, and its shell can be used as medicine, and Chinese medicine is called the shell of seaear, and effect calming the liver, that clear liver and improve vision is arranged.In recent years, along with wild Bao a resource shrinkage and the market demand increase, the industry of propagating artificially of haliotis diversicolor Reeve (Haliotis diversicolor), dish Bao and haliotis discus hannai Ino obtained very big development, and sheep Bao, ear abalone culture also among test, estimate will be progressively developed also from now on.Its quality of different types of Bao (meat, local flavor, nutritive value) difference, price is also different.Fresh or crude Bao can be by its shell form etc. discerned, but then can't judge it is to process through product processed from form by which kind of Bao.External the appearance with cheap Bao is that raw material is made tinned food, and but pretending to claim is Bao at high price and example to sell at high price, domesticly this situation may occur equally from now on.Need a kind of sensitivity to differentiate the technology of raw material Bao kind reliably from processed goods for this reason.In addition, its larva of Bao not of the same race (the early stage young) stage homomorphosis or closely similar often is difficult to differentiate, this brings difficulty for researchs such as its young classification and ecology.The technology that for this reason also needs a kind of young of reliable sensitivity to differentiate and identify to the variety classes Bao.
Usually exist relatively more fixing difference between its gene order of biology not of the same race, therefore can carry out species according to the difference of gene (DNA) sequence and differentiate that this method is not subjected to the influence of the biological living environment and the state that grows, the accuracy of discriminating is very high.Wherein the most reliable method is to clone certain gene or dna fragmentation checks order, but the complicated operation of order-checking, and cost is also than higher.For fish the someone set up extracting mitochondrial DNA (mtDNA), with multiple restriction enzyme mtDNA is cut, according to the method for enzyme difference identification of cutting the result and the starting material fingerling of identifying the fish processed goods.This method needs many tissue samples to come extracting mtDNA, therefore can't be used for the discriminating of tiny the animal young such as abalone larva.Round pcr is a kind of very sensitive external DNA cloning technology, it has very high specificity simultaneously, primer and the suitable reaction conditions of control by appropriate design, utilize it can identify the small sequence difference of being examined on the DNA, be widely applied to the life science various fields, and to punishment levy, field such as legal medical expert's evaluation.
Summary of the invention
The objective of the invention is to cut result's difference identification and identify that the method for the starting material fingerling of fish processed goods can't be used for the problem of abalone larva and processed goods discriminating, provides a kind of easy abalone species discriminating method according to enzyme at existing.
The technical solution used in the present invention is the difference design specific PCR primer according to abalone mitochondria 16S rRNA gene order, by increasing to being subjected to the sample material to carry out PCR (PCR), adopt the agarose gel electrophoresis detection to have or not the amplified production of expection to occur, can carry out the evaluation of species exactly to examined material in view of the above.
The said abalone species discriminating method of the present invention the steps include:
1), the extraction of DNA: get Bao tissue sample 10～25mg, extract total DNA, with distilled water or the dissolving of TE solution with Proteinase K-benzene phenol-chloroform method or DNA extraction agent box;
2), pcr amplification: get total DNA of above-mentioned extracting, the PCR reaction conditions according to common carries out pcr amplification to it respectively with Auele Specific Primer;
3), get PCR reaction product 3～5 μ L, the agarose gel electrophoresis 10～20min with 1%～1.5% adds ethidium bromide (EB) in the gel, the addition of said ethidium bromide is 0.5～2 μ g/ml;
4), under UV-lamp, observe through the gel behind the electrophoresis, every species-specific primer all amplifies significant band from the total DNA of its corresponding Bao, other Bao kind dna amplification reaction result is not then had obvious amplified band produce.
In step 1), the said Bao tissue sample muscle of handy abdominal foot of getting.Said TE solution is 10mM PH 8.0Tris-HCl, 1mM EDTA.
In step 2) in, the sequence such as the table 1 of said Auele Specific Primer.
Table 1
| Bao kind name | Specific primer sequence |
| The Haliotis diversicolor haliotis diversicolor Reeve | F：5’TCTGAACATATCTTTATGTC3’ R：5’AGTACGTCCGTTGATGAATG3’ |
| Haliotis discus hannai Ino dish Bao | F：5’GCTCCTTGGTTGTGATAATATA3’ R：5’GAATAAATTTAAAATCCTCTATTC3’ |
| The ear Bao | F：5’GGTTTATATTTCCTAGTTG3’ R：5’CGGATCATTAGCTAGCAAG3’ |
| Changeable Bao | F：5’AAGCTGTGCTCCTGAAG3’ R：5’CCCAGTCAGAAAACCAAAAAT3’ |
| The sheep Bao | F：5’AATTTCTAGTTGTACTAG3’ R：5’ATCAGTCGGCAGACCAAATTC3’ |
Said pcr amplification reaction condition is:
Reaction system (10～20 μ L): dna profiling 10～100ng; 1X PCR damping fluid; DNTPs2mM; MgCl
21.5mM; Forward and reverse each 0.2mM of Auele Specific Primer; Taq enzyme 0.5～1.0U (commercially available);
PCR cycling condition: 94 ℃ of 2min; 94 ℃ of 30sec, 52 ℃ of 1min, 72 ℃ of 1min circulate 30 times; 72 ℃ are extended 5～10min.
The present invention is according to the difference design specific PCR primer of abalone mitochondria 16S rRNA gene order, by increasing to being subjected to the sample material to carry out PCR (PCR), adopt the agarose gel electrophoresis detection to have or not the amplified production of expection to occur, can carry out the evaluation of species exactly to examined material in view of the above.Be characterized in sensitive, accurate.This method can be used for differentiating the young of the not abalone of the same race that is difficult to differentiate with naked eyes, and the young is carried out the evaluation of institute's species; Can be used for also identifying that it is that raw material processes that the abalone processed goods is to use the abalone of what kind, in scientific researches such as commercial and ecology, using value is arranged all.Said abalone is mainly economic Bao kind, for example coils Bao, haliotis discus hannai Ino, Haliotis diversicolor or haliotis diversicolor Reeve, sheep Bao, ear Bao, changeable Bao etc.
Embodiment
Following examples will the present invention is further illustrated.
Embodiment 1
Get dish Bao and haliotis discus hannai Ino tissue sample 8～10mg, extract total DNA with Proteinase K-benzene phenol-chloroform method or DNA extraction agent box respectively, use dissolved in distilled water.Get total DNA of above-mentioned extracting,, carry out pcr amplification (totally 10 reactions) respectively according to following pcr amplification reaction condition: reaction system (10～20 μ L): dna profiling 10～100ng with the described 5 pairs of Auele Specific Primers of table 1; 1X PCR damping fluid; DNTPs2mM; MgCl
21.5mM; Forward and reverse each 0.2mM of Auele Specific Primer; Taq enzyme 0.5～1.0U (commercially available).PCR cycling condition: 94 ℃ of 2min; 94 ℃ of 30sec, 52 ℃ of 1min, 72 ℃ of 1min circulate 30 times; 72 ℃ are extended 5～10min.Get PCR reaction product 4 μ L, the agarose gel electrophoresis 12min with 1.1%, voltage 5～10v/cm adds 0.5～2 μ g/ml ethidium bromide in the gel.Observe under UV-lamp through the gel behind the electrophoresis, can see significant amplified band with 2 reactions of dish Bao and haliotis discus hannai Ino Auele Specific Primer, all the other 8 reactions then do not have amplified band.The used dish Bao and the sequence of haliotis discus hannai Ino Auele Specific Primer are F:5 ' GCTCCTTGGTTGTGATAATATA3 ' and R:5 ' GAATAAATTTAAAATCCTCTATTC3 '.
Embodiment 2
Get Haliotis diversicolor or haliotis diversicolor Reeve tissue sample 15mg,, and use condition identical and method to carry out PCR reaction and agarose electrophoresis detection reaction product with embodiment 1 according to the total DNA of method extracting of embodiment 1.Under UV-lamp, observe through the gel behind the electrophoresis, find to see significant amplified band, and all do not have amplified band with the reaction of other Bao special primer with 2 reactions of haliotis diversicolor Reeve (Haliotis diversicolor) Auele Specific Primer.The sequence of used haliotis diversicolor Reeve (Haliotis diversicolor) Auele Specific Primer is F:5 ' TCTGAACATATCTTTATGTC3 ' and R:5 ' AGTACGTCCGTTGATGAATG3 '.
Embodiment 3
Get ear Bao tissue sample 20mg, extract total DNA, with the dissolving of TE solution with Proteinase K-benzene phenol-chloroform method or DNA extraction agent box.Get total DNA of above-mentioned extracting, carry out pcr amplification: reaction system (10～20 μ L): dna profiling 10～100ng according to following pcr amplification reaction condition; 1X PCR damping fluid; DNTPs2mM; MgCl
21.5mM; Forward and reverse each 0.2mM of Auele Specific Primer; Taq enzyme 0.5～1.0U (commercially available).PCR cycling condition: 94 ℃ of 2min; 94 ℃ of 30sec, 52 ℃ of 1min, 72 ℃ of 1min circulate 30 times; 72 ℃ are extended 5～10min.Get PCR reaction product 4.5 μ L, the agarose gel electrophoresis 20min with 1.3% adds 0.5～2 μ g/ml ethidium bromide in the gel.Under UV-lamp, observe, find its significant amplified band through the gel behind the electrophoresis.The sequence of used Auele Specific Primer is F:5 ' GGTTTATATTTCCTAGTTG3 ' and R:5 ' CGGATCATTAGCTAGCAAG3 '.Carry out pcr amplification and agarose gel electrophoresis detection with other kind Bao Auele Specific Primer simultaneously, significant amplified band on gel, all do not occur.
Embodiment 4
Get changeable Bao tissue sample 25mg, extract total DNA, use dissolved in distilled water with Proteinase K-benzene phenol-chloroform method or DNA extraction agent box.Get total DNA of above-mentioned extracting, carry out pcr amplification: reaction system (10～20 μ L): dna profiling 10～100ng according to following pcr amplification reaction condition; 1X PCR damping fluid; DNTPs2mM; MgCl
21.5mM; Forward and reverse each 0.2mM of Auele Specific Primer; Taq enzyme 0.5～1.0U (commercially available).PCR cycling condition: 94 ℃ of 2min; 94 ℃ of 30sec, 52 ℃ of 1min, 72 ℃ of 1min circulate 30 times; 72 ℃ are extended 5～10min.Get PCR reaction product 3 μ L, the agarose gel electrophoresis 18min with 1.0% adds 0.5～2 μ g/ml ethidium bromide in the gel.Under UV-lamp, observe, find its significant amplified band through the gel behind the electrophoresis.The sequence of used Auele Specific Primer is F:5 ' AAGCTGTGCTCCTGAAG3 ' and R:5 ' CCCAGTCAGAAAACCAAAAAT3 '.Carry out pcr amplification and agarose gel electrophoresis detection with other kind Bao Auele Specific Primer simultaneously, significant amplified band on gel, all do not occur.
Embodiment 5
Get sheep Bao tissue sample 18mg, extract total DNA, use dissolved in distilled water with Proteinase K-benzene phenol-chloroform method or DNA extraction agent box.Get total DNA of above-mentioned extracting, carry out pcr amplification: reaction system (10～20 μ L): dna profiling 10～100ng according to following pcr amplification reaction condition; 1X PCR damping fluid; DNTPs2mM; Mgl
21.5mM; Forward and reverse each 0.2mM of Auele Specific Primer; Taq enzyme 0.5～1.0U (commercially available).PCR cycling condition: 94 ℃ of 2min; 94 ℃ of 30sec, 52 ℃ of 1min, 72 ℃ of 1min circulate 30 times; 72 ℃ are extended 5～10min.Get PCR reaction product 5 μ L, the agarose gel electrophoresis 10min with 1.4% adds 0.5～2 μ g/ml ethidium bromide in the gel.Under UV-lamp, observe, find its significant amplified band through the gel behind the electrophoresis.The sequence of used Auele Specific Primer is F:5 ' AATTTCTAGTTGTACTAG3 ' and R:5 ' ATCAGTCGGCAGACCAAATTC3 '.Carry out pcr amplification and agarose gel electrophoresis detection with other kind Bao Auele Specific Primer simultaneously, significant amplified band on gel, all do not occur.
Embodiment 6
The dish Bao muscle samples 15mg that learnt from else's experience and add water boil 30min with Proteinase K-total DNA of benzene phenol-chloroform method extracting, carries out PCR reaction and agarose electrophoresis detection according to embodiment 1 identical condition and method.Under UV-lamp, observe through the gel behind the electrophoresis, find to see the significant amplified band of expection, and all do not have amplified band with the reaction of other Bao special primer with the reaction of dish Bao and haliotis discus hannai Ino Auele Specific Primer.
Embodiment 7
Learning from else's experience adds haliotis diversicolor Reeve (Haliotis diversicolor) muscle samples 20mg more than the water boil 30min in pressure cooker, with Proteinase K-total DNA of benzene phenol-chloroform method extracting, carry out PCR reaction and agarose electrophoresis detection according to embodiment 1 identical condition and method.Under UV-lamp, observe through the gel behind the electrophoresis, find to see the significant amplified band of expection, and all do not have amplified band with the reaction of other Bao special primer with the reaction of dish Bao and haliotis discus hannai Ino Auele Specific Primer.
Embodiment 8
Get haliotis diversicolor Reeve (Haliotis diversicolor) trochophora several, with DNA extraction agent box (commercially available) extracting total DNA, use dissolved in distilled water.Get total DNA of above-mentioned extracting, carry out pcr amplification: reaction system (10～20 μ L): dna profiling 10～30ng according to following pcr amplification reaction condition; 1X PCR damping fluid; DNTPs2mM; MgCl
21.5mM; Forward and inverted plate Bao and each 0.2mM of haliotis discus hannai Ino Auele Specific Primer; Taq enzyme 0.5～1.0U (commercially available).PCR cycling condition: 94 ℃ of 2min; 94 ℃ of 30sec, 52 ℃ of 1min, 72 ℃ of 1min circulate 30 times; 72 ℃ are extended 5～10min.Get PCR reaction product 4 μ L, the agarose gel electrophoresis 12min with 1.1%, voltage 5～10v/cm adds 0.5～2 μ g/ml ethidium bromide in the gel.Under UV-lamp, observe through the gel behind the electrophoresis, find the amplified band that it is special in the position of expection.The sequence of used Auele Specific Primer is F:5 ' GCTCCTTGGTTGTGATAATATA3 ' and R:5 ' GAATAAATTTAAAATCCTCTATTC3 '.
Embodiment 9
It is clean with the distilled water rinsing to get haliotis diversicolor Reeve (Haliotis diversicolor) trochophora, gets single individuality then, directly carries out pcr amplification according to following pcr amplification reaction condition: reaction system (10～20 μ L): dna profiling 10～30ng; 1X PCR damping fluid; DNTPs2mM; MgCl
21.5mM; Forward and inverted plate Bao and each 0.2mM of haliotis discus hannai Ino Auele Specific Primer; Taq enzyme 0.5～1.0U (commercially available).PCR cycling condition: 95 ℃ of 3min; 94 ℃ of 30sec, 52 ℃ of 1min, 72 ℃ of 1min circulate 30 times; 72 ℃ are extended 5～10min.Get PCR reaction product 4 μ L, the agarose gel electrophoresis 12min with 1.1%, voltage 5～10v/cm adds 0.5～2 μ g/ml ethidium bromide in the gel.Under UV-lamp, observe through the gel behind the electrophoresis, find the amplified band that it is special in the position of expection.The sequence of used Auele Specific Primer is F:5 ' GCTCCTTGGTTGTGATAATATA3 ' and R:5 ' GAATAAATTTAAAATCCTCTATTC3 '.
Claims (4)
1. abalone species discriminating method is characterized in that the steps include:
1), the extraction of DNA: get Bao tissue sample 10～25mg, extract total DNA, with distilled water or the dissolving of TE solution with Proteinase K-benzene phenol-chloroform method or DNA extraction agent box;
2), pcr amplification: get total DNA of step 1 extracting, respectively it is carried out pcr amplification, the sequence of Auele Specific Primer such as following table with Auele Specific Primer:
The pcr amplification reaction condition is: reaction system 10～20 μ L:DNA templates 10～100ng; 1X PCR damping fluid; DNTPs2mM; MgCl
21.5mM; Forward and reverse each 0.2mM of Auele Specific Primer; Taq enzyme 0.5～1.0U; PCR cycling condition: 94 ℃ of 2min; 94 ℃ of 30sec, 52 ℃ of 1min, 72 ℃ of 1min circulate 30 times; 72 ℃ are extended 5～10min;
3), get PCR reaction product 3～5 μ L, the agarose gel electrophoresis 10～20min with 1%～1.5% adds ethidium bromide in the gel;
4), observation checks through the gel behind the electrophoresis whether Bao kind dna amplification reaction result has obvious amplified band to produce under UV-lamp.
2. abalone species discriminating method as claimed in claim 1 is characterized in that in step 1), the described muscle of getting the Bao tissue sample with abdominal foot.
3. abalone species discriminating method as claimed in claim 1 is characterized in that in step 1), and described TE solution is 10mM PH8.0 Tris-HCl, 1mM EDTA.
4. abalone species discriminating method as claimed in claim 1 is characterized in that in step 3), and the addition of described ethidium bromide is 0.5～2 μ g/ml.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100997726A CN100380118C (en) | 2005-09-07 | 2005-09-07 | Abalone species discriminating method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100997726A CN100380118C (en) | 2005-09-07 | 2005-09-07 | Abalone species discriminating method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1737565A CN1737565A (en) | 2006-02-22 |
| CN100380118C true CN100380118C (en) | 2008-04-09 |
Family
ID=36080432
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100997726A Expired - Fee Related CN100380118C (en) | 2005-09-07 | 2005-09-07 | Abalone species discriminating method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100380118C (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101353702B (en) * | 2008-09-08 | 2011-01-05 | 厦门大学 | DNA molecular identification method of Haliotis sieboldii and Haliotis discus Hannai hybrid |
| CN101381769B (en) * | 2008-10-24 | 2011-09-07 | 长沙学院 | Molecular identification method for siniperca kneri garman and siniperca scherzeri and kit |
| CN101956001B (en) * | 2010-08-06 | 2013-01-30 | 厦门大学 | Microsatellite identification method for various colonies of Haliotis diversicolor |
| CN104004855B (en) * | 2014-06-20 | 2016-01-20 | 厦门大学 | The two step PCR molecular assay method of green Bao and haliotis discus hannai Ino cross-fertilize seed |
| CN105525020A (en) * | 2016-02-01 | 2016-04-27 | 辽宁省海洋水产科学研究院 | Kit for rapidly identifying flathead fish and callionymus koreanus and identification method |
| CN109680077B (en) * | 2019-01-25 | 2022-03-22 | 福建出入境检验检疫局检验检疫技术中心 | Method for detecting and identifying Haliotis discus hannai by fluorescent quantitative PCR (polymerase chain reaction) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1340626A (en) * | 2000-09-01 | 2002-03-20 | 国家海洋局第三海洋研究所 | Actin gene promotor for Japanese prawn |
| WO2002085306A2 (en) * | 2001-04-24 | 2002-10-31 | The Johns Hopkins University | Use of follistatin to increase muscle mass |
-
2005
- 2005-09-07 CN CNB2005100997726A patent/CN100380118C/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1340626A (en) * | 2000-09-01 | 2002-03-20 | 国家海洋局第三海洋研究所 | Actin gene promotor for Japanese prawn |
| WO2002085306A2 (en) * | 2001-04-24 | 2002-10-31 | The Johns Hopkins University | Use of follistatin to increase muscle mass |
Non-Patent Citations (1)
| Title |
|---|
| 3种鲍基因组DNA多态性的RAPD分析. 邢荣莲等.大连水产学院学报，第18卷第3期. 2003 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1737565A (en) | 2006-02-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Meyer et al. | PCR-based DNA analysis for the identification and characterization of food components | |
| CN100380118C (en) | Abalone species discriminating method | |
| Anderson et al. | Morphological and molecular diversity of Colletotrichum spp. causing pepper spot and anthracnose of lychee (Litchi chinensis) in Australia | |
| Ahmad et al. | Detection of Aspergillus flavus and Aspergillus parasiticus from aflatoxin-contaminated peanuts and their differentiation using PCR-RFLP | |
| CN103215365A (en) | DNA (Deoxyribonucleic Acid) molecular identification method for Luchuan pigs and meat products thereof | |
| CN108950007A (en) | For identifying the HRM primer and method of river Puffer and other fish products | |
| Chong et al. | Identification of Escherichia spp. strains in street-vended beverages and associated preparation surfaces using 16S rRNA analysis | |
| CN110541035A (en) | Sinocyclocheilus sinensis DNA barcode sequence and application thereof | |
| Masoud et al. | RAPD and cytogenetic study of some pomegranate (Punica granatum L.) cultivars | |
| JP2020150900A (en) | Primer, and detection method of mango | |
| Marinho et al. | Rotavirus analyses by SYBR Green real-time PCR and microbiological contamination in bivalves cultivated in coastal water of Amazonian Brazil | |
| US6037128A (en) | Process for the preparation of semisynthetic amplicon useful for sex determination of the papaya plant | |
| Padungtod et al. | Identification of Campylobacter jejuni isolates from cloacal and carcass swabs of chickens in Thailand by a 5′ nuclease fluorogenic polymerase chain reaction assay | |
| Jandaghi et al. | Rapid quantitative detection of Listeria monocytogenes in chicken using direct and combined enrichment/qPCR method | |
| US20050014143A1 (en) | Method for determining the existence of animal or vegetable mixtures in organic substrates | |
| Rodrigues et al. | Comparison between morphophysiological and molecular methods for the identification of yeasts isolated from honey | |
| Carolyn | Phenotypic and molecular characterization of hard ticks (Acari: Ixodidae) sampled from wild herbivores from lake Nakuru and Tsavo national parks in Kenya | |
| KR101395938B1 (en) | Pcr diagnosis using specific primer for bacteria that cause diseases of allomyrina dichotoma | |
| KR101277800B1 (en) | Development of pcr primers for species identification of mollusks | |
| CN110117662B (en) | Fluorescent PCR detection method for salmon, primer and probe thereof | |
| KR20150049677A (en) | Primer for K3a Race Typing of Xanthomonas oryzae pv. oryzae and Method of K3a Race Typing of Xanthomonas oryzae pv. oryzae using the same | |
| KR101823301B1 (en) | Primer set for loop-mediated isothermal amplification reaction for detecting V. nashicola and uses thereof | |
| KR101166786B1 (en) | Genetic Marker for K3 or K5 Race Typing of Xanthomonas oryzae pv. Oryzae and Method of K3 or K5 Race Typing of Xanthomonas oryzae pv. Oryzae using the same | |
| KR20040039059A (en) | Detection method of DNA marker associated to average daily gain(ADG), backfat thickness(BFT) , and loin muscle area(LMA) in pig. | |
| CN112322745B (en) | Specific primer pair, kit and method for rapidly identifying pumpkin fruit fly |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20060222 Assignee: Ningde City Ocean Technology Development Company Assignor: Jimei University Contract record no.: 2010350000057 Denomination of invention: Abalone species discriminating method Granted publication date: 20080409 License type: Exclusive License Record date: 20100421 |
|
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080409 Termination date: 20120907 |