KR102026016B1 - Mutant Porphyra yezoensis 500GEAA comprising higher essential amino acids content, method of preparing thereof and method of preparing glutamate using the same - Google Patents

Mutant Porphyra yezoensis 500GEAA comprising higher essential amino acids content, method of preparing thereof and method of preparing glutamate using the same Download PDF

Info

Publication number
KR102026016B1
KR102026016B1 KR1020180019795A KR20180019795A KR102026016B1 KR 102026016 B1 KR102026016 B1 KR 102026016B1 KR 1020180019795 A KR1020180019795 A KR 1020180019795A KR 20180019795 A KR20180019795 A KR 20180019795A KR 102026016 B1 KR102026016 B1 KR 102026016B1
Authority
KR
South Korea
Prior art keywords
essential amino
amino acid
mutant
laver
500geaa
Prior art date
Application number
KR1020180019795A
Other languages
Korean (ko)
Other versions
KR20190099835A (en
Inventor
최종일
Original Assignee
전남대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 전남대학교산학협력단 filed Critical 전남대학교산학협력단
Priority to KR1020180019795A priority Critical patent/KR102026016B1/en
Publication of KR20190099835A publication Critical patent/KR20190099835A/en
Application granted granted Critical
Publication of KR102026016B1 publication Critical patent/KR102026016B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/12Unicellular algae; Culture media therefor
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01GHORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
    • A01G33/00Cultivation of seaweed or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/01Preparation of mutants without inserting foreign genetic material therein; Screening processes therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12R1/89
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/89Algae ; Processes using algae
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/80Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Environmental Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 필수아미노산 함량이 증가한 돌연변이 방사무늬김 500GEAA, 이의 제조방법 및 이를 이용한 필수아미노산 제조방법에 관한 것으로서, 상기 에틸 메탄설포네이트 처리에 의해 필수아미노산의 함량이 증가한 돌연변이 방사무늬김을 제조할 수 있으므로, 이를 효과적으로 필수아미노산 제조방법에 이용할 수 있다.The present invention relates to a mutant radiation pattern laver 500GEAA having an increased essential amino acid content, a method for preparing the same, and a method for producing an essential amino acid using the same. Therefore, it can be effectively used for the essential amino acid production method.

Description

필수아미노산 함량이 증가한 돌연변이 방사무늬김 500GEAA, 이의 제조방법 및 이를 이용한 필수아미노산 제조방법{Mutant Porphyra yezoensis 500GEAA comprising higher essential amino acids content, method of preparing thereof and method of preparing glutamate using the same}Mutant Porphyra yezoensis 500GEAA comprising higher essential amino acids content, method of preparing etc and method of preparing glutamate using the same

본 발명은 필수아미노산 함량이 증가한 돌연변이 방사무늬김 500GEAA, 이의 제조방법 및 이를 이용한 필수아미노산 제조방법에 관한 것으로서, 더욱 상세하게는 에틸 메탄설포네이트 처리에 의해 필수아미노산의 함량이 증가한 돌연변이 방사무늬김 및 이의 제조방법, 그리고 상기 돌연변이 방사무늬김을 이용하는 필수아미노산의 제조방법에 관한 것이다.The present invention relates to a mutant radiation pattern laver 500GEAA having an increased essential amino acid content, a method for preparing the same, and a method for producing an essential amino acid using the same. It relates to a preparation method thereof and a method for preparing an essential amino acid using the mutant radiation pattern laver.

김(Porphyra)은 홍조류에 속하는 해조류의 일종으로서 홍조식물(Rhodophyta), 홍조강(Rho-dophyceae), 원시홍조아강(Bangiophyci-dae), 김목(Bangiales), 김과(Bangiaceae)의 포르피아(Porphyra)속에 속하는 식용 해조류이다. Porphyra is a species of algae belonging to the red algae. It is an edible seaweed belonging to the genus.

김은 한국, 일본, 중국에서 주로 양식하고 식품으로 사용하는 홍조류로서 자연산은 바다의 암석에 붙어서 자라며, 양식하는 종류는 주로 방사무늬김(Porphyra yezoensis)과 참김(Porphyra tenera)이 있고, 전 세계에 50종 정도가 자라며 우리나라에는 둥근돌김(Porphyra suborbiculata), 긴잎돌김(Porphyra pseudolinearis), 모무늬돌김(Porphyra seriata) 등 10여 종이 분포한다.Seaweed is a red algae mainly grown and used as food in Korea, Japan, and China, and wild products are attached to the rocks of the sea, and the farmed species are mainly the seaweeds ( Porphyra yezoensis ) and sesame ( Porphyra tenera ). About 50 species grow, and in Korea, round squirrel ( Porphyra suborbiculata ) and long snail ( Porphyra) The ten paper distribution such pseudolinearis), base pattern Seaweed (Porphyra seriata).

2011년 김의 생산금액은 2천2백억원 규모로 전체 해조류 중 가장 높은 비율(전체 해조류 생산금액의 58%)을 차지하고 있다. 생산금액, 생산량 규모로 비추어 해조류 양식어가의 주요 생산품으로서 김은 대단히 중요한 위치를 차지하고 있다. 김 양식산업은 지역, 경제, 산업적으로 대단히 커다란 비중을 차지하고 있으나 김 종자 산업은 대단히 영세한 수준이다.In 2011, the amount of seaweed produced was 220 billion won, accounting for the highest percentage of seaweeds (58% of total seaweeds). In view of the amount of production and the scale of production, seaweed is a very important product of aquaculture fish farms. The seaweed industry accounts for a great deal of geography, economy and industry, but the seaweed industry is very small.

김 종묘 생산량은 2009년 전체 284만 상자, 70억원에서 2012년 367만 상자, 92억원으로 소폭 증가하는 등 해마다 등락폭은 있으나 전체적으로 증가하는 경향을 나타낸다. 전체 김 종묘 생산에서 일반김(참김, 방사무늬김)이 전체 약 40%를 차지하였으며, 잇바디돌김과 모무늬돌김이 각각 30%정도를 차지하고 있다.Kim's seedling production increased slightly from year to year at 2.84 million boxes in 2009, from 7 billion won to 3.67 million boxes in 2012, and 9.2 billion won. In the production of all seedlings, general laver (charm and radiant laver) accounted for about 40% of the total laver seedlings.

김 종묘 생산액은 전체 70 ~ 90억원 수준으로 전체 김 양식산업 (2,200억원)에서 차지하는 비중은 매우 적으나 김 종묘 생산이 직접적으로 김 양식산업에 영향을 미치기 때문에 산업적 위치에서는 대단히 중요한 위치를 차지한다.The total amount of seaweed seedling production amounted to W7 ~ 9bn, which is very small in the total seaweed farming industry (220 billion won), but it is very important in the industrial position because seaweed seedling production directly affects the seaweed farming industry.

최근 정부에서는 김을 10대 수출 전략품목으로 선정하여 세계 시장 선점을 위한 육성계획을 세우고, 김에 대한 국제표준규격을 2010년 아시아식품규격위원회에 제안했다. 또한 2011년 제34회 국제식품규격위원회(CODEX) 총회에서 전 세계 184개 회원국의 동의를 얻어 김의 표준규격을 제정하기로 결정되었다.Recently, the government selected Kim as one of the top ten export strategic items, formulated a plan to foster the preoccupation of the world market, and proposed the International Standard for Kim to the Asian Food Standards Committee in 2010. In addition, in 2011, the 34th CODEX General Assembly decided to establish Kim's standards with the consent of 184 member countries around the world.

이에 따라 우리나라는 향후 김의 국제규격 제정 과정에서 제안국으로서 주도적으로 참여할수 있으며, 김의 국제규격이 국내 기준과 최대한 동일하게 마련되도록 유도함으로써 김의 세계 수출시장 유지 및 개척에 큰 도움을 줄 것으로 예상된다.Accordingly, Korea can take the lead in the process of enacting Kim's international standards in the future, and will help Kim maintain the international export market by encouraging Kim's international standards to be the same as domestic standards. It is expected.

현재 전체 김 종묘 생산량 중 약 25 ~ 40%에 해당하는 종자는 외국 종자(일본산이 섞인 잡종)로, 로열티 지급 등의 문제가 발생할 수 있다. 이를 해결하기위한 수입대체 신종자 개발은 영세한 김 종묘 생산업체에서 수행하기에는 무리가 따르며 국가적인 차원에서 우수한 수입대체 종자의 개발이 절실히 요구되는 시점이다.Currently, about 25 to 40% of the total seedling production of ginseng is a foreign seed (hybrid mixed with Japanese), which may cause payment problems. In order to solve this problem, the development of new seed varieties is difficult to be carried out by small Kim Jongmyo producers, and it is a time for the development of excellent substitute seeds at the national level.

하지만, 김 종자의 육종에 관한 연구는 극히 미미한 실정이다. 우리나라에서 김 품종개량에 관한 연구로는 큰참김, 큰방사무늬김을 대상으로 한 유아기의 양식특성, 해역별 적품종 도출을 위한 적응시험, 방사무늬김의 조직배양에 의한 내저염성 품종개량 등이 있으나 실용화 또는 산업화로 연결되지는 못하였다.However, the research on the breeding of Kim seeds is very insignificant. Studies on the improvement of seaweed varieties in Korea include aquaculture characteristics of large young seaweed, large radiation pattern seaweed, adaptation test for derivation of new species by sea area, and low salt resistant varietal improvement by tissue culture of radioactive seaweed. There is, however, did not lead to commercialization or industrialization.

남해수산연구소 목포분소에서는 1994년부터 남해서부 해역에서 오래 전부터 양식하여 왔던 참김 및 방사무늬김과 우리나라 연안에 자생하고 있는 돌김류를 대상으로 품종개량을 수행하였으며, 모무늬돌김과 잇바디돌김의 교잡종을 개발하였다(남해수산연구소, 2004, 남해안 지역특성 해조류 양식품종 및 기술개발, 2003년 사업보고서, pp 571-600).The Mokpo branch of Namhae Fisheries Research Institute conducted varieties for the seaweeds and radiant seaweeds, which have been farmed in the South Sea area since 1994, and the seaweeds native to Korea's coast. (Namhae Fisheries Research Institute, 2004, Regional Coastal Seaweed Breeding and Technology Development in the South Coast, 2003 Business Report, pp 571-600).

일본에서는 1960년대부터 김 품종개량을 위한 육종 연구가 이루어져 왔으며, 특히 양식업자들에 의해 1962년에는 큰참김이, 1967년에는 큰방사무늬김이 속성장 계통주로 개발되었다(Miura, A., P.F. Fuand J.A. Shin, 1992. lnterspecific cross experiments between Porphyra yezoensis Ueda and P. tene Kjellman (Bangiales, Rhodophyta) by using pigmentation variants. J. Tokyo Univ. Fish., 79, 103-120.). 이 외에도 새로운 품종 개발을 위하여 원형질체 세포융합 연구가 진행되었으나 실용품종으로 육성되지는 못하였다.In Japan, breeding research for the improvement of laver varieties has been undertaken since the 1960s, especially large seaweed laver in 1962 and large radish laver in 1967 by farmers (Miura, A., PF). Fuand JA Shin, 1992. lnterspecific cross experiments between Porphyra yezoensis Ueda and P. tene Kjellman (Bangiales, Rhodophyta) by using pigmentation variants. J. Tokyo Univ. Fish., 79, 103-120.). In addition, protoplast cell fusion research was conducted to develop new varieties, but it was not grown as a practical breed.

우리가 음식에서 느끼는 감칠맛의 근원인 필수아미노산은 원래 다시마 등에서 추출하여 사용되었다. 필수아미노산은 동물의 체내에서 신경 전달 기능을 하는 것으로 알려져 있으며, 조미료용 염인 모노소듐 글루탐산의 주성분일 뿐 만 아니라 엽산의 생성에도 반드시 필요하다.Essential amino acid, the source of the rich taste we feel in food, was originally extracted from kelp and the like. Essential amino acids are known to have a neurotransmitter function in the body of animals, and are not only the main component of monosodium glutamic acid, a salt for seasoning, but also essential for the production of folic acid.

이에 방사무늬김(P. yezoensis)의 배양과 품종 개량을 통해 필수아미노산 함량이 높은 돌연변이 방사무늬김을 얻고 이러한 돌연변이 방사무늬김의 제조방법 및 용도를 제공한다면 다른 품종에 비하여 부가가치가 높기 때문에 양식어민들이 선호할 것으로 기대된다.Therefore, if cultivated P. yezoensis and cultivated varieties to obtain mutant radiation pattern with high essential amino acid content and provide the method and use of such mutant radiation pattern seaweed, the added value is higher than other varieties. Are expected to prefer.

이에 본 발명자들은 에틸 메탄설포네이트를 처리한 방사무늬김의 필수아미노산 함량이 에틸 메탄설포네이트를 처리하지 않은 방사무늬김에 대비하여 월등히 우수한 것을 확인하였다.Accordingly, the present inventors confirmed that the essential amino acid content of the radial patterned laver treated with ethyl methanesulfonate was significantly superior to the radial patterned laver not treated with ethyl methanesulfonate.

이에, 본 발명의 목적은 에틸 메탄설포네이트 처리에 의해 필수아미노산 함량이 증가한 돌연변이 방사무늬김 500GEAA(Porphyra yezoensis 500GEAA)를 제공하는 것이다.Accordingly, an object of the present invention is a mutant radiation pattern seaweed 500GEAA ( Porphyra) having increased essential amino acid content by ethyl methanesulfonate treatment. yezoensis 500GEAA).

본 발명의 다른 목적은 필수아미노산 함량이 증가한 돌연변이 방사무늬김 500GEAA의 제조방법을 제공하는 것이다. It is another object of the present invention to provide a method for preparing a mutant radiation patterned seaweed 500GEAA having an increased essential amino acid content.

본 발명의 또 다른 목적은 돌연변이 방사무늬김 500GEAA를 이용한 필수아미노산의 제조방법에 관한 것이다.Still another object of the present invention relates to a method for preparing essential amino acids using mutant radiation patterned seaweed 500GEAA.

본 발명은 필수아미노산 함량이 증가한 돌연변이 방사무늬김 500GEAA(Porphyra yezoensis 500GEAA), 이의 제조방법 및 이를 이용한 필수아미노산 제조방법에 관한 것으로, 본 발명에 따른 돌연변이 방사무늬김 500GEAA는 필수아미노산의 함량이 증가되어 필수아미노산의 제조에 유용하게 활용될 수 있다.The present invention relates to a mutant radiation pattern laver 500GEAA ( Porphyra yezoensis 500GEAA) having increased essential amino acid content, a method for preparing the same, and a method for producing an essential amino acid using the same. It can be usefully used for the preparation of essential amino acids.

본 발명자들은 에틸 메탄설포네이트를 처리한 방사무늬김으로부터 방출된 포자를 얻고, 상기 포자를 배양하여 얻은 돌연변이 방사무늬김의 필수아미노산 함량을 측정한 결과, 에틸 메탄설포네이트를 처리하지 않은 방사무늬김에 대비하여 필수아미노산 함량이 월등히 우수한 것을 확인하였다.The present inventors obtained spores released from the radial patterned laver treated with ethyl methanesulfonate, and measured the essential amino acid content of the mutant radiant laver obtained by culturing the spores. In contrast, it was confirmed that the essential amino acid content is significantly superior.

이하 본 발명을 더욱 자세히 설명하고자 한다.Hereinafter, the present invention will be described in more detail.

본 발명의 일 양태는 필수아미노산 함량이 증가한 수탁번호 KCTC13428BP로 기탁된 돌연변이 방사무늬김 500GEAA이다.One aspect of the present invention is a mutant radiation pattern lame 500GEAA deposited with accession number KCTC13428BP with increased essential amino acid content.

필수아미노산의 종류는 트립토판(tryptophan), 라이신(lysine), 메티오닌(methionine), 발린(valine), 류신(leucine), 이소류신(isoleucine), 트레오닌(threonine), 페닐알라닌(phenylalanine)이 있다.Essential amino acids include tryptophan, lysine, methionine, valine, leucine, isoleucine, threonine, threonine, and phenylalanine.

트립토판은 천연 이완제로 정상적인 수면을 유도함으로써 불면증을 완화하도록 돕는다. 편두통의 치료 및 면역계 강화에 도움을 주고, 동맥과 심장의 경련 위험을 감소시키도록 돕는 기능을 한다. 또한 콜레스테롤 수준을 감소시키는데 라이신과 함께 작용한다.Tryptophan is a natural relaxant that helps insomnia by inducing normal sleep. It helps treat migraines, strengthen the immune system, and reduce the risk of spasms in the arteries and heart. It also works with lysine to reduce cholesterol levels.

라이신은 적절한 칼슘 섭취 및 연골과 결체조직을 구성하는 콜라겐(collagen)의 형성을 돕고 항체, 호르몬, 효소 생산에 기여한다. 결핍되면 피로감, 무력증, 흥분, 눈의 충혈, 성장지연, 탈모, 빈혈 등의 문제를 초래할 수 있다.Lysine aids in proper calcium intake and the formation of collagen, which makes up cartilage and connective tissue, and contributes to the production of antibodies, hormones and enzymes. Deficiency can lead to fatigue, weakness, excitement, eye redness, growth retardation, hair loss, and anemia.

메티오닌은 모발, 피부 및 손톱의 이상을 예방하는 황(sulfur)의 주요 공급원이다. 또한 간에서 레시틴(lecithin) 생산을 증가시킴으로써 콜레스테롤 수준을 낮추도록 돕는다. 간의 지방을 감소시키며 신장을 보호하는 기능을 하고, 중금속에 대한 천연 킬레이팅 제제(chelating agent)로 기능한다. 암모니아 형성을 조절함으로써 방광의 자극을 감소시키고, 모낭(hair follicles)에 영향을 주어 머리카락의 성장을 촉진시킨다.Methionine is a major source of sulfur that prevents abnormalities in hair, skin and nails. It also helps lower cholesterol levels by increasing lecithin production in the liver. It functions to reduce liver fat, protects the kidneys, and acts as a natural chelating agent for heavy metals. Regulating ammonia formation reduces irritation of the bladder and affects hair follicles to promote hair growth.

페닐알라닌은 뇌에서 노르에피네프린(norepinephrine)을 생산하도록 하는데, 이 노르에피네프린은 신경세포와 뇌 사이에서 신호를 전달하는 화학 물질이다. 공복 시 통증을 감소시키고, 항우울제(antidepressant)로 작용하며 기억력을 개선하도록 돕는다.Phenylalanine produces norepinephrine in the brain, which is a chemical that transmits signals between nerve cells and the brain. Reduces fasting pain, acts as an antidepressant and helps improve memory.

트레오닌은 콜라겐, 엘라스틴(Elastin) 및 에나멜(enamel) 단백질의 주요 구성요소이다. 간에 지방이 축적되는 것을 막도록 돕고, 소화관과 장관 기능이 보다 원활하게끔 조절하며 신진대사와 동화작용을 보조한다.Threonine is a major component of collagen, elastin and enamel proteins. It helps to prevent the liver from accumulating fat, regulates the digestive tract and intestinal function more smoothly, and assists metabolism and assimilation.

발린은 정신적 활력을 조절하고, 평온한 정신상태를 유지하도록 돕는다.Valine controls mental vitality and helps maintain a calm mental state.

류신 및 이소류신은 신체 내에서 다른 필수 생화학적 성분들의 제조를 위한 원료를 제공한다.Leucine and isoleucine provide raw materials for the manufacture of other essential biochemical components in the body.

상기 돌연변이 방사무늬김은, 에틸 메탄설포네이트가 처리된 방사무늬김(Porphyra yezoensis)으로부터 방출된 포자로서 얻어지는 것일 수 있다.The mutant radiation pattern laver may be one obtained as spores released from Porphyra yezoensis treated with ethyl methanesulfonate.

상기 에틸 메탄설포네이트는 1 내지 5 mM, 2 내지 5 mM 또는 3 내지 5 mM의 농도로 처리되는 것일 수 있고, 예를 들어, 4 내지 5 mM의 농도로 처리되는 것일 수 있으나, 이에 한정되는 것은 아니다. 상기 에틸 메탄설포네이트를 1 mM 이하의 농도로 처리할 경우 돌연변이의 발생 빈도가 충분하지 않을 수 있고, 5 mM를 초과하는 농도로 처리하는 경우 김의 생존율이 현저하게 감소할 수 있다.The ethyl methanesulfonate may be to be treated at a concentration of 1 to 5 mM, 2 to 5 mM or 3 to 5 mM, for example, to be treated at a concentration of 4 to 5 mM, but is not limited thereto. no. When the ethyl methanesulfonate is treated at a concentration of 1 mM or less, the frequency of occurrence of mutations may not be sufficient, and when treated at a concentration exceeding 5 mM, the survival rate of seaweed may be significantly reduced.

방사무늬김의 필수아미노산 함량은 11.00 내지 14.90 중량%인 것에 비하여, 돌연변이 방사무늬김의 필수아미노산 함량은 15.00 내지 20.00 중량%, 15.00 내지 18.00 중량%, 16.00 내지 25.00 중량%, 16.00 내지 20.00 중량% 또는 16.00 내지 18.00 중량%일 수 있고, 예를 들어, 17.00 내지 18.00 중량%일 수 있으나, 이에 한정되는 것은 아니다.The essential amino acid content of the mutated radioactive seaweed is 15.00 to 20.00 wt%, 15.00 to 18.00 wt%, 16.00 to 25.00 wt%, 16.00 to 20.00 wt%, or 16.00 to 18.00% by weight, for example, 17.00 to 18.00% by weight, but is not limited thereto.

상기 돌연변이 방사무늬김의 트레오닌 함량은 2.50 내지 4.00 중량%, 2.50 내지 3.80 중량%, 2.50 내지 3.60 중량%, 2.80 내지 4.00 중량% 또는 2.80 내지 3.80 중량%일 수 있고, 예를 들어, 3.00 내지 3.50 중량%일 수 있으나, 이에 한정되는 것은 아니다.The threonine content of the mutant radiation pattern laver may be 2.50 to 4.00 wt%, 2.50 to 3.80 wt%, 2.50 to 3.60 wt%, 2.80 to 4.00 wt% or 2.80 to 3.80 wt%, for example, 3.00 to 3.50 wt% It may be%, but is not limited thereto.

상기 돌연변이 방사무늬김의 발린 함량은 2.00 내지 3.50 중량%, 2.00 내지 3.20 중량%, 2.00 내지 3.00 중량%, 2.50 내지 3.50 중량% 또는 2.50 내지 3.20 중량%일 수 있고, 예를 들어, 2.50 내지 3.00 중량%일 수 있으나, 이에 한정되는 것은 아니다.The valine content of the mutant radiation pattern laver may be 2.00 to 3.50% by weight, 2.00 to 3.20% by weight, 2.00 to 3.00% by weight, 2.50 to 3.50% by weight or 2.50 to 3.20% by weight, for example, 2.50 to 3.00% by weight It may be%, but is not limited thereto.

상기 돌연변이 방사무늬김의 메티오닌 함량은 0.90 내지 2.00 중량%, 0.90 내지 1.80 중량%, 0.90 내지 1.50 중량%, 1.00 내지 2.00 중량% 또는 1.00 내지 1.80 중량%일 수 있고, 예를 들어, 1.00 내지 1.50 중량%일 수 있으나, 이에 한정되는 것은 아니다.The methionine content of the mutant radiation pattern laver may be 0.90 to 2.00% by weight, 0.90 to 1.80% by weight, 0.90 to 1.50% by weight, 1.00 to 2.00% by weight, or 1.00 to 1.80% by weight, for example, 1.00 to 1.50% by weight. It may be%, but is not limited thereto.

상기 돌연변이 방사무늬김의 이소류신 함량은 1.20 내지 2.00 중량%, 1.20 내지 1.80 중량%, 1.20 내지 1.50 중량%, 1.25 내지 2.00 중량% 또는 1.25 내지 1.80 중량%일 수 있고, 예를 들어, 1.25 내지 1.50 중량%일 수 있으나, 이에 한정되는 것은 아니다.The isoleucine content of the mutated radiation pattern laver may be 1.20 to 2.00 wt%, 1.20 to 1.80 wt%, 1.20 to 1.50 wt%, 1.25 to 2.00 wt% or 1.25 to 1.80 wt%, for example, 1.25 to 1.50 wt% It may be%, but is not limited thereto.

상기 돌연변이 방사무늬김의 류신 함량은 2.50 내지 4.00 중량%, 2.50 내지 3.80 중량%, 2.50 내지 3.50 중량%, 3.00 내지 4.00 중량% 또는 3.00 내지 3.80 중량%일 수 있고, 예를 들어, 3.00 내지 3.50 중량%일 수 있으나, 이에 한정되는 것은 아니다.The leucine content of the mutant radiation pattern laver may be 2.50 to 4.00 wt%, 2.50 to 3.80 wt%, 2.50 to 3.50 wt%, 3.00 to 4.00 wt% or 3.00 to 3.80 wt%, for example, 3.00 to 3.50 wt% It may be%, but is not limited thereto.

상기 돌연변이 방사무늬김의 페닐알라닌 함량은 1.90 내지 3.00 중량%, 1.90 내지 2.80 중량%, 1.90 내지 2.50 중량%, 2.00 내지 3.00 중량% 또는 2.00 내지 2.80 중량%일 수 있고, 예를 들어, 2.00 내지 2.50 중량%일 수 있으나, 이에 한정되는 것은 아니다.The phenylalanine content of the mutant radiation pattern laver may be 1.90 to 3.00 wt%, 1.90 to 2.80 wt%, 1.90 to 2.50 wt%, 2.00 to 3.00 wt% or 2.00 to 2.80 wt%, for example, 2.00 to 2.50 wt% It may be%, but is not limited thereto.

상기 돌연변이 방사무늬김의 라이신 함량은 2.50 내지 4.00 중량%, 2.50 내지 3.80 중량%, 2.50 내지 3.50 중량%, 3.00 내지 4.00 중량% 또는 3.00 내지 3.80 중량%일 수 있고, 예를 들어, 3.00 내지 3.50 중량%일 수 있으나, 이에 한정되는 것은 아니다.The lysine content of the mutant radiation pattern laver may be 2.50 to 4.00 wt%, 2.50 to 3.80 wt%, 2.50 to 3.50 wt%, 3.00 to 4.00 wt% or 3.00 to 3.80 wt%, for example, 3.00 to 3.50 wt% It may be%, but is not limited thereto.

본 발명의 다른 양태는 다음의 단계를 포함하는 필수아미노산 함량이 증가한 수탁번호 KCTC13428BP로 기탁된 돌연변이 방사무늬김 500GEAA의 제조방법이다:Another embodiment of the present invention is a method for preparing a mutant radiation patterned seaweed 500GEAA deposited with accession number KCTC13428BP with an increased essential amino acid content, comprising the following steps:

방사무늬김에 에틸 메탄설포네이트를 처리하여 배양하는 배양 단계; 및A culture step of treating ethyl methanesulfonate by radiation pattern laver; And

필수아미노산 함량이 높은 방사무늬김을 선별하는 선별 단계.A screening step of screening radiant laver with high essential amino acid content.

상기 에틸 메탄설포네이트는 1 내지 5 mM, 2 내지 5 mM 또는 3 내지 5 mM의 농도로 처리되는 것일 수 있고, 예를 들어, 4 내지 5 mM의 농도로 처리되는 것일 수 있으나, 이에 한정되는 것은 아니다. 상기 에틸 메탄설포네이트를 1 mM 이하의 농도로 처리할 경우 돌연변이의 발생 빈도가 충분하지 않을 수 있고, 5 mM를 초과하는 농도로 처리하는 경우 김의 생존율이 현저하게 감소할 수 있다.The ethyl methanesulfonate may be to be treated at a concentration of 1 to 5 mM, 2 to 5 mM or 3 to 5 mM, for example, to be treated at a concentration of 4 to 5 mM, but is not limited thereto. no. When the ethyl methanesulfonate is treated at a concentration of 1 mM or less, the frequency of occurrence of mutations may not be sufficient, and when treated at a concentration exceeding 5 mM, the survival rate of seaweed may be significantly reduced.

상기 배양 단계는 MGM(Modified Grund Media) 배지 조건하에서 수행되는 것일 수 있다.The culturing step may be performed under MGM (Modified Grund Media) medium conditions.

상기 MGM 배지는 C10H14O6N2Na2·2H2O(Na2EDTA), FeSO4·7H2O, Na2HPO4·12H2O, NaNO3, MnCl2·7H2O 및 시아노코발라민(Cyanocobalamin)을 포함하는 것일 수 있다.The MGM medium is C 10 H 14 O 6 N 2 Na 2 · 2H 2 O (Na 2 EDTA), FeSO 4 · 7H 2 O, Na 2 HPO 4 · 12H 2 O, NaNO 3 , MnCl 2 · 7H 2 O and It may be one containing cyanocobalamin (Cyanocobalamin).

본 발명의 일 구현예에서, 상기 MGM 배지는 멸균된 해수 1리터에 C10H14O6N2Na2·2H2O(Na2EDTA) 3.72 g, FeSO4·7H2O 0.28 g, Na2HPO4·12H2O 10.74 g, NaNO3 42.5 g, MnCl2·7H2O 0.019197 g, 시아노코발라민(Cyanocobalamin; Vitamin B12) 1 mg를 포함한 것으로서 사용될 수 있다.In one embodiment of the present invention, the MGM medium is a sterilized seawater 1 liter C 10 H 14 O 6 N 2 Na 2 · 2H 2 O (Na 2 EDTA) 3.72 g, FeSO 4 · 7H 2 O 0.28 g, Na 2 HPO 4 .12H 2 O 10.74 g, NaNO 3 42.5 g, MnCl 2 · 7H 2 O 0.019197 g, cyanocobalamin (Cyanocobalamin; Vitamin B 12 ) can be used as one containing.

상기 배양 단계는 10 내지 50 umol/m2s, 10 내지 40 umol/m2s, 10 내지 30 umol/m2s, 10 내지 20 umol/m2s, 20 내지 50 umol/m2s, 20 내지 40 umol/m2s 또는 20 내지 30 umol/m2s의 광도에서 수행되는 것일 수 있고, 예를 들어, 20 umol/m2s의 광도에서 수행되는 것일 수 있으나, 이에 한정되는 것은 아니다. 20 umol/m2s의 광도 조건하에서 김을 배양하였을 때 가장 성장 상태가 우수하게 나타났다.The culturing step is 10 to 50 umol / m 2 s, 10 to 40 umol / m 2 s, 10 to 30 umol / m 2 s, 10 to 20 umol / m 2 s, 20 to 50 umol / m 2 s, 20 It may be carried out at a brightness of from 40 umol / m 2 s or 20 to 30 umol / m 2 s, for example, may be performed at a brightness of 20 umol / m 2 s, but is not limited thereto. The best growth was observed when the laver was cultured under luminous conditions of 20 umol / m 2 s.

상기 배양 단계는 12h:12h의 명:암 사이클로 수행되는 것일 수 있으나, 이에 한정되는 것은 아니다.The culturing step may be performed in a light: dark cycle of 12h: 12h, but is not limited thereto.

상기 배양 단계는 10 내지 25℃, 10 내지 20℃ 또는 15 내지 25℃, 예를 들어, 15 내지 20℃의 온도에서 수행되는 것일 수 있으나, 이에 한정되는 것은 아니다.The culturing step may be performed at a temperature of 10 to 25 ℃, 10 to 20 ℃ or 15 to 25 ℃, for example, 15 to 20 ℃, but is not limited thereto.

방사무늬김의 필수아미노산 함량은 11.00 내지 14.90 중량%인 것에 비하여, 돌연변이 방사무늬김의 필수아미노산 함량은 15.00 내지 20.00 중량%, 15.00 내지 18.00 중량%, 16.00 내지 25.00 중량%, 16.00 내지 20.00 중량% 또는 16.00 내지 18.00 중량%일 수 있고, 예를 들어, 17.00 내지 18.00 중량%일 수 있으나, 이에 한정되는 것은 아니다.The essential amino acid content of the mutated radioactive seaweed is 15.00 to 20.00 wt%, 15.00 to 18.00 wt%, 16.00 to 25.00 wt%, 16.00 to 20.00 wt%, or 16.00 to 18.00% by weight, for example, 17.00 to 18.00% by weight, but is not limited thereto.

상기 돌연변이 방사무늬김의 트레오닌 함량은 2.50 내지 4.00 중량%, 2.50 내지 3.80 중량%, 2.50 내지 3.60 중량%, 2.80 내지 4.00 중량% 또는 2.80 내지 3.80 중량%일 수 있고, 예를 들어, 3.00 내지 3.50 중량%일 수 있으나, 이에 한정되는 것은 아니다.The threonine content of the mutant radiation pattern laver may be 2.50 to 4.00 wt%, 2.50 to 3.80 wt%, 2.50 to 3.60 wt%, 2.80 to 4.00 wt% or 2.80 to 3.80 wt%, for example, 3.00 to 3.50 wt% It may be%, but is not limited thereto.

상기 돌연변이 방사무늬김의 발린 함량은 2.00 내지 3.50 중량%, 2.00 내지 3.20 중량%, 2.00 내지 3.00 중량%, 2.50 내지 3.50 중량% 또는 2.50 내지 3.20 중량%일 수 있고, 예를 들어, 2.50 내지 3.00 중량%일 수 있으나, 이에 한정되는 것은 아니다.The valine content of the mutant radiation pattern laver may be 2.00 to 3.50% by weight, 2.00 to 3.20% by weight, 2.00 to 3.00% by weight, 2.50 to 3.50% by weight or 2.50 to 3.20% by weight, for example, 2.50 to 3.00% by weight It may be%, but is not limited thereto.

상기 돌연변이 방사무늬김의 메티오닌 함량은 0.90 내지 2.00 중량%, 0.90 내지 1.80 중량%, 0.90 내지 1.50 중량%, 1.00 내지 2.00 중량% 또는 1.00 내지 1.80 중량%일 수 있고, 예를 들어, 1.00 내지 1.50 중량%일 수 있으나, 이에 한정되는 것은 아니다.The methionine content of the mutant radiation pattern laver may be 0.90 to 2.00% by weight, 0.90 to 1.80% by weight, 0.90 to 1.50% by weight, 1.00 to 2.00% by weight, or 1.00 to 1.80% by weight, for example, 1.00 to 1.50% by weight. It may be%, but is not limited thereto.

상기 돌연변이 방사무늬김의 이소류신 함량은 1.20 내지 2.00 중량%, 1.20 내지 1.80 중량%, 1.20 내지 1.50 중량%, 1.25 내지 2.00 중량% 또는 1.25 내지 1.80 중량%일 수 있고, 예를 들어, 1.25 내지 1.50 중량%일 수 있으나, 이에 한정되는 것은 아니다.The isoleucine content of the mutated radiation pattern laver may be 1.20 to 2.00 wt%, 1.20 to 1.80 wt%, 1.20 to 1.50 wt%, 1.25 to 2.00 wt% or 1.25 to 1.80 wt%, for example, 1.25 to 1.50 wt% It may be%, but is not limited thereto.

상기 돌연변이 방사무늬김의 류신 함량은 2.50 내지 4.00 중량%, 2.50 내지 3.80 중량%, 2.50 내지 3.50 중량%, 3.00 내지 4.00 중량% 또는 3.00 내지 3.80 중량%일 수 있고, 예를 들어, 3.00 내지 3.50 중량%일 수 있으나, 이에 한정되는 것은 아니다.The leucine content of the mutant radiation pattern laver may be 2.50 to 4.00 wt%, 2.50 to 3.80 wt%, 2.50 to 3.50 wt%, 3.00 to 4.00 wt% or 3.00 to 3.80 wt%, for example, 3.00 to 3.50 wt% It may be%, but is not limited thereto.

상기 돌연변이 방사무늬김의 페닐알라닌 함량은 1.90 내지 3.00 중량%, 1.90 내지 2.80 중량%, 1.90 내지 2.50 중량%, 2.00 내지 3.00 중량% 또는 2.00 내지 2.80 중량%일 수 있고, 예를 들어, 2.00 내지 2.50 중량%일 수 있으나, 이에 한정되는 것은 아니다.The phenylalanine content of the mutant radiation pattern laver may be 1.90 to 3.00 wt%, 1.90 to 2.80 wt%, 1.90 to 2.50 wt%, 2.00 to 3.00 wt% or 2.00 to 2.80 wt%, for example, 2.00 to 2.50 wt% It may be%, but is not limited thereto.

상기 돌연변이 방사무늬김의 라이신 함량은 2.50 내지 4.00 중량%, 2.50 내지 3.80 중량%, 2.50 내지 3.50 중량%, 3.00 내지 4.00 중량% 또는 3.00 내지 3.80 중량%일 수 있고, 예를 들어, 3.00 내지 3.50 중량%일 수 있으나, 이에 한정되는 것은 아니다.The lysine content of the mutant radiation pattern laver may be 2.50 to 4.00 wt%, 2.50 to 3.80 wt%, 2.50 to 3.50 wt%, 3.00 to 4.00 wt% or 3.00 to 3.80 wt%, for example, 3.00 to 3.50 wt% It may be%, but is not limited thereto.

상기 배양 단계는 다음의 단계를 포함하는 것인, 돌연변이 방사무늬김의 제조방법일 수 있다:The culturing step may be a method for preparing a mutant radiation pattern laver, comprising the following steps:

에틸 메탄설포네이트를 처리한 방사무늬김을 배양하는 제1 배양 단계;A first culture step of culturing the radial patterned laver treated with ethyl methanesulfonate;

제1 배양 단계에서 생존한 방사무늬김을 선별하여 배양하는 제2 배양 단계; 및A second culture step of selecting and culturing the radiation pattern laver surviving in the first culture step; And

제2 배양 단계에서 방사무늬김이 방출한 포자를 배양하는 제3 배양 단계.The third culture step of culturing the spores released by the radiation pattern laver in the second culture step.

상기 에틸 메탄설포네이트는 1 내지 5 mM, 2 내지 5 mM 또는 3 내지 5 mM의 농도로 처리되는 것일 수 있고, 예를 들어, 4 내지 5 mM의 농도로 처리되는 것일 수 있으나, 이에 한정되는 것은 아니다. 상기 에틸 메탄설포네이트를 1 mM 이하의 농도로 처리할 경우 돌연변이의 발생 빈도가 충분하지 않을 수 있고, 5 mM를 초과하는 농도로 처리하는 경우 김의 생존율이 현저하게 감소할 수 있다.The ethyl methanesulfonate may be to be treated at a concentration of 1 to 5 mM, 2 to 5 mM or 3 to 5 mM, for example, to be treated at a concentration of 4 to 5 mM, but is not limited thereto. no. When the ethyl methanesulfonate is treated at a concentration of 1 mM or less, the frequency of occurrence of mutations may not be sufficient, and when treated at a concentration exceeding 5 mM, the survival rate of seaweed may be significantly reduced.

본 발명의 일 구현예에서, 제1 배양 단계는 15℃에서 12주 동안 수행되는 것일 수 있으나, 이에 한정되는 것은 아니다.In one embodiment of the present invention, the first culturing step may be performed at 15 ° C. for 12 weeks, but is not limited thereto.

본 발명의 일 구현예에서, 제2 배양 단계는 10 내지 15℃에서 12주 동안 수행되는 것일 수 있고, 예를 들어, 15℃에서 12주 동안 수행되는 것일 수 있으나, 이에 한정되는 것은 아니다.In one embodiment of the present invention, the second culture step may be performed at 10 to 15 ℃ for 12 weeks, for example, may be performed at 15 ℃ for 12 weeks, but is not limited thereto.

본 발명의 일 구현예에서, 제3 배양 단계는 10 내지 15℃에서 12주 동안 수행되는 것일 수 있고, 예를 들어, 15℃에서 12주 동안 수행되는 것일 수 있으나, 이에 한정되는 것은 아니다.In one embodiment of the present invention, the third culture step may be performed at 10 to 15 ℃ for 12 weeks, for example, may be performed at 15 ℃ for 12 weeks, but is not limited thereto.

상기 포자의 방출은 방사무늬김의 배양 온도를 18 내지 20℃로 상승시켜 유도되는 것일 수 있고, 예를 들어, 배양 온도를 20℃로 상승시킬 수 있으나, 이에 한정되는 것은 아니다. 상기 온도에서는 엽체의 성장보다는 포자의 방출이 실시될 수 있다.Release of the spores may be induced by raising the culture temperature of the radiation pattern laver to 18 to 20 ℃, for example, may be raised to 20 ℃ ℃, but is not limited thereto. At this temperature, the release of spores may be carried out rather than the growth of the leaves.

본 발명의 다른 양태는 다음 단계를 포함하는 필수아미노산의 제조방법이다:Another aspect of the invention is a process for preparing an essential amino acid comprising the following steps:

수탁번호 KCTC13428BP로 기탁된 돌연변이 방사무늬김 500GEAA를 배양하는 배양 단계; 및A culture step of culturing the mutant radiation pattern laver 500GEAA deposited with accession number KCTC13428BP; And

상기 방사무늬김 500GEAA로부터 필수아미노산을 추출하는 추출 단계.Extraction step of extracting the essential amino acid from the radiation patterned seaweed 500GEAA.

상기 배양 단계는 MGM 배지 조건하에서 수행되는 것일 수 있다.The culturing step may be performed under MGM medium conditions.

상기 배지는 C10H14O6N2Na2·2H2O(Na2EDTA), FeSO4·7H2O, Na2HPO4·12H2O, NaNO3, MnCl2·7H2O 및 시아노코발라민(Cyanocobalamin)을 포함하는 것일 수 있다.The medium is C 10 H 14 O 6 N 2 Na 2 · 2H 2 O (Na 2 EDTA), FeSO 4 · 7H 2 O, Na 2 HPO 4 · 12H 2 O, NaNO 3 , MnCl 2 · 7H 2 O and cya It may include nocobalamin (Cyanocobalamin).

본 발명의 일 구현예에서, 상기 MGM 배지는 멸균된 해수 1리터에 C10H14O6N2Na2·2H2O(Na2EDTA) 3.72 g, FeSO4·7H2O 0.28 g, Na2HPO4·12H2O 10.74 g, NaNO3 42.5 g, MnCl2·7H2O 0.019197 g, 시아노코발라민(Cyanocobalamin; Vitamin B12) 1 mg를 포함한 것으로서 사용될 수 있다.In one embodiment of the present invention, the MGM medium is a sterilized seawater 1 liter C 10 H 14 O 6 N 2 Na 2 · 2H 2 O (Na 2 EDTA) 3.72 g, FeSO 4 · 7H 2 O 0.28 g, Na 2 HPO 4 .12H 2 O 10.74 g, NaNO 3 42.5 g, MnCl 2 · 7H 2 O 0.019197 g, cyanocobalamin (Cyanocobalamin; Vitamin B 12 ) can be used as one containing.

상기 배양 단계는 10 내지 50 umol/m2s, 10 내지 40 umol/m2s, 10 내지 30 umol/m2s, 10 내지 20 umol/m2s, 20 내지 50 umol/m2s, 20 내지 40 umol/m2s 또는 20 내지 30 umol/m2s의 광도에서 수행되는 것일 수 있고, 예를 들어, 20 umol/m2s의 광도에서 수행되는 것일 수 있으나, 이에 한정되는 것은 아니다. 20 umol/m2s의 광도 조건하에서 김을 배양하였을 때 가장 성장 상태가 우수하게 나타났다.The culturing step is 10 to 50 umol / m 2 s, 10 to 40 umol / m 2 s, 10 to 30 umol / m 2 s, 10 to 20 umol / m 2 s, 20 to 50 umol / m 2 s, 20 It may be carried out at a brightness of from 40 umol / m 2 s or 20 to 30 umol / m 2 s, for example, may be performed at a brightness of 20 umol / m 2 s, but is not limited thereto. The best growth was observed when the laver was cultured under luminous conditions of 20 umol / m 2 s.

상기 배양 단계는 12h:12h의 명:암 사이클로 수행되는 것일 수 있으나, 이에 한정되는 것은 아니다.The culturing step may be performed in a light: dark cycle of 12h: 12h, but is not limited thereto.

상기 배양 단계는 10 내지 25℃, 10 내지 20℃ 또는 15 내지 25℃, 예를 들어, 15 내지 20℃의 온도에서 수행되는 것일 수 있으나, 이에 한정되는 것은 아니다.The culturing step may be performed at a temperature of 10 to 25 ℃, 10 to 20 ℃ or 15 to 25 ℃, for example, 15 to 20 ℃, but is not limited thereto.

방사무늬김의 필수아미노산 함량은 11.00 내지 14.90 중량%인 것에 비하여, 돌연변이 방사무늬김의 필수아미노산 함량은 15.00 내지 20.00 중량%, 15.00 내지 18.00 중량%, 16.00 내지 25.00 중량%, 16.00 내지 20.00 중량% 또는 16.00 내지 18.00 중량%일 수 있고, 예를 들어, 17.00 내지 18.00 중량%일 수 있으나, 이에 한정되는 것은 아니다.The essential amino acid content of the mutated radioactive seaweed is 15.00 to 20.00 wt%, 15.00 to 18.00 wt%, 16.00 to 25.00 wt%, 16.00 to 20.00 wt%, or 16.00 to 18.00% by weight, for example, 17.00 to 18.00% by weight, but is not limited thereto.

상기 돌연변이 방사무늬김의 트레오닌 함량은 2.50 내지 4.00 중량%, 2.50 내지 3.80 중량%, 2.50 내지 3.60 중량%, 2.80 내지 4.00 중량% 또는 2.80 내지 3.80 중량%일 수 있고, 예를 들어, 3.00 내지 3.50 중량%일 수 있으나, 이에 한정되는 것은 아니다.The threonine content of the mutant radiation pattern laver may be 2.50 to 4.00 wt%, 2.50 to 3.80 wt%, 2.50 to 3.60 wt%, 2.80 to 4.00 wt% or 2.80 to 3.80 wt%, for example, 3.00 to 3.50 wt% It may be%, but is not limited thereto.

상기 돌연변이 방사무늬김의 발린 함량은 2.00 내지 3.50 중량%, 2.00 내지 3.20 중량%, 2.00 내지 3.00 중량%, 2.50 내지 3.50 중량% 또는 2.50 내지 3.20 중량%일 수 있고, 예를 들어, 2.50 내지 3.00 중량%일 수 있으나, 이에 한정되는 것은 아니다.The valine content of the mutant radiation pattern laver may be 2.00 to 3.50% by weight, 2.00 to 3.20% by weight, 2.00 to 3.00% by weight, 2.50 to 3.50% by weight or 2.50 to 3.20% by weight, for example, 2.50 to 3.00% by weight It may be%, but is not limited thereto.

상기 돌연변이 방사무늬김의 메티오닌 함량은 0.90 내지 2.00 중량%, 0.90 내지 1.80 중량%, 0.90 내지 1.50 중량%, 1.00 내지 2.00 중량% 또는 1.00 내지 1.80 중량%일 수 있고, 예를 들어, 1.00 내지 1.50 중량%일 수 있으나, 이에 한정되는 것은 아니다.The methionine content of the mutant radiation pattern laver may be 0.90 to 2.00% by weight, 0.90 to 1.80% by weight, 0.90 to 1.50% by weight, 1.00 to 2.00% by weight, or 1.00 to 1.80% by weight, for example, 1.00 to 1.50% by weight. It may be%, but is not limited thereto.

상기 돌연변이 방사무늬김의 이소류신 함량은 1.20 내지 2.00 중량%, 1.20 내지 1.80 중량%, 1.20 내지 1.50 중량%, 1.25 내지 2.00 중량% 또는 1.25 내지 1.80 중량%일 수 있고, 예를 들어, 1.25 내지 1.50 중량%일 수 있으나, 이에 한정되는 것은 아니다.The isoleucine content of the mutated radiation pattern laver may be 1.20 to 2.00 wt%, 1.20 to 1.80 wt%, 1.20 to 1.50 wt%, 1.25 to 2.00 wt% or 1.25 to 1.80 wt%, for example, 1.25 to 1.50 wt% It may be%, but is not limited thereto.

상기 돌연변이 방사무늬김의 류신 함량은 2.50 내지 4.00 중량%, 2.50 내지 3.80 중량%, 2.50 내지 3.50 중량%, 3.00 내지 4.00 중량% 또는 3.00 내지 3.80 중량%일 수 있고, 예를 들어, 3.00 내지 3.50 중량%일 수 있으나, 이에 한정되는 것은 아니다.The leucine content of the mutant radiation pattern laver may be 2.50 to 4.00 wt%, 2.50 to 3.80 wt%, 2.50 to 3.50 wt%, 3.00 to 4.00 wt% or 3.00 to 3.80 wt%, for example, 3.00 to 3.50 wt% It may be%, but is not limited thereto.

상기 돌연변이 방사무늬김의 페닐알라닌 함량은 1.90 내지 3.00 중량%, 1.90 내지 2.80 중량%, 1.90 내지 2.50 중량%, 2.00 내지 3.00 중량% 또는 2.00 내지 2.80 중량%일 수 있고, 예를 들어, 2.00 내지 2.50 중량%일 수 있으나, 이에 한정되는 것은 아니다.The phenylalanine content of the mutant radiation pattern laver may be 1.90 to 3.00 wt%, 1.90 to 2.80 wt%, 1.90 to 2.50 wt%, 2.00 to 3.00 wt% or 2.00 to 2.80 wt%, for example, 2.00 to 2.50 wt% It may be%, but is not limited thereto.

상기 돌연변이 방사무늬김의 라이신 함량은 2.50 내지 4.00 중량%, 2.50 내지 3.80 중량%, 2.50 내지 3.50 중량%, 3.00 내지 4.00 중량% 또는 3.00 내지 3.80 중량%일 수 있고, 예를 들어, 3.00 내지 3.50 중량%일 수 있으나, 이에 한정되는 것은 아니다.The lysine content of the mutant radiation pattern laver may be 2.50 to 4.00 wt%, 2.50 to 3.80 wt%, 2.50 to 3.50 wt%, 3.00 to 4.00 wt% or 3.00 to 3.80 wt%, for example, 3.00 to 3.50 wt% It may be%, but is not limited thereto.

본 발명은 필수아미노산 함량이 증가한 돌연변이 방사무늬김 500GEAA, 이의 제조방법 및 이를 이용한 필수아미노산 제조방법에 관한 것으로서, 상기 에틸 메탄설포네이트 처리에 의해 필수아미노산의 함량이 증가한 돌연변이 방사무늬김을 제조할 수 있으므로, 이를 효과적으로 필수아미노산 제조방법에 이용할 수 있다.The present invention relates to a mutant radiation pattern laver 500GEAA having an increased essential amino acid content, a method for preparing the same, and a method for producing an essential amino acid using the same. Therefore, it can be effectively used for the essential amino acid production method.

도 1은 본 발명의 실시예에 따른 돌연변이 방사무늬김의 필수아미노산 함량을 보여주는 그래프이다.
도 2은 본 발명의 실시예에 따른 돌연변이 방사무늬김 500GEAA(P. yezoensis 500GEAA)에서 에틸 메탄설포네이트를 처리하지 않은 방사무늬김 대비 염기서열 변이를 확인한 사진이다.
1 is a graph showing the essential amino acid content of mutant radiation pattern laver according to an embodiment of the present invention.
Figure 2 is a mutant radiation patterned seaweed 500GEAA according to an embodiment of the present invention ( P. yezoensis 500GEAA) is a photograph confirming the sequence variation compared to the radiation pattern laver not treated with ethyl methanesulfonate.

이하, 본 발명을 하기의 실시예에 의하여 더욱 상세히 설명한다. 그러나 이들 실시예는 본 발명을 예시하기 위한 것일 뿐이며, 본 발명의 범위가 이들 실시예에 의하여 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

실시예 1: 돌연변이 방사무늬김 500GEAA(Example 1 Mutant Radiation Stripe 500GEAA ( P. yezoensis P. yezoensis 500GEAA)의 제조Manufacturing of 500GEAA)

방사무늬김(P. yezoensis)은 국립수산과학원 해조류연구센터로부터 분양 받아 사용하였다. MGM(Modified Grund Media) 배지는 멸균된 해수 1리터에 C10H14O6N2Na2·2H2O(Na2EDTA) 3.72 g, FeSO4·7H2O 0.28 g, Na2HPO4·12H2O 10.74 g, NaNO3 42.5 g, MnCl2·7H2O 0.019197 g, 시아노코발라민(Cyanocobalamin; Vitamin B12) 1 mg를 포함한 것을 사용하였다.Radial laver ( P. yezoensis ) was used from the Seaweed Research Center of the National Fisheries Research and Development Institute. Modified Grund Media (MGM) medium is 1.72 g of C 10 H 14 O 6 N 2 Na 2 · 2H 2 O (Na 2 EDTA), 0.28 g of FeSO 4 · 7H 2 O, Na 2 HPO 4 in 1 liter of sterile seawater. 10.74 g of 12H 2 O, 42.5 g of NaNO 3 , 0.019197 g of MnCl 2 · 7H 2 O, and 1 mg of cyanocobalamin (Cyanocobalamin; Vitamin B 12 ) were used.

방사무늬김을 MGM(Modified Grund Media) 배지에 넣은 다음 식물 배양 디쉬(Plant culturedish, 100×40 mm)에 방사무늬김 포함 MGM 배지를 100 mL의 부피로 넣고 20 umol/m2s 이상의 광도에서, 12h:12h의 명:암 사이클로, 온도 15℃를 유지하여 12주 동안 배양하였다.Radiated laver is placed in Modified Grund Media (MGM) medium, and then 100 ml of MGM medium with radiant laver is placed in a plant cultured dish (100 x 40 mm) at a volume of 20 umol / m 2 s. In a 12:12 h light: dark cycle, the temperature was maintained at 15 ° C. for 12 weeks.

MGM 배지에서 배양 중인 방사무늬김에 에틸 메탄설포네이트를 각각 1, 2, 3, 4 및 5 mM의 농도가 되도록 1시간 동안 처리 한 후, 처리된 각각의 방사무늬김 시료를 세척 후 다시 MGM 배지에 옮겨 20 umol/m2s 이상의 광도에서, 12h:12h의 명:암 사이클로, 온도 15℃를 유지하여 12주 동안 배양 후 현미경을 이용한 세포 계수(cell counting)를 통하여 김의 생존율을 분석하였다.Ethyl methanesulfonate was treated for 1 hour to 1, 2, 3, 4, and 5 mM concentrations of the radiation patterned laver in culture in MGM medium, and then, each washed sample was washed again in MGM medium. The luminous viability was analyzed by cell counting under a microscope after 12 weeks of incubation for 12 weeks at a light: dark cycle of 12h: 12h at a light intensity of 20 umol / m 2 s or more.

에틸 메탄설포네이트 처리 후 생존한 방사무늬김은 다시 MGM 배지에 옮기고 20 umol/m2s 이상의 광도에서, 12h:12h의 명:암 사이클로, 온도 15℃를 유지하여 12주 동안 배양하였으며, 포자의 방출은 김의 배양 온도를 20℃로 상승시켜 유도하였으며, 얻어진 포자는 새로운 MGM 배지로 옮겨 20 umol/m2s 이상의 광도에서, 12h:12h의 명:암 사이클로, 온도 15℃를 유지하여 12주 동안 배양하였다. 대조군 방사무늬김은 상기 과정과 동일하게 준비하되, 에틸 메탄설포네이트 처리는 수행하지 않았다.Radiation strips surviving after treatment with ethyl methanesulfonate were transferred to MGM medium and incubated for 12 weeks at a light: dark cycle of 12h: 12h at a brightness of 20 umol / m 2 s and maintaining a temperature of 15 ° C. The release was induced by raising the incubation temperature of the seaweed to 20 ° C., and the resulting spores were transferred to fresh MGM medium at a light: dark cycle of 12 h: 12 h at a light intensity of 20 umol / m 2 s or more, maintaining the temperature at 15 ° C. for 12 weeks. Incubated for The control spine laver was prepared in the same manner as the above, but the ethyl methanesulfonate treatment was not performed.

상기에서 에틸 메탄설포네이트 처리 후 생존한 방사무늬김을 MGM 배지에 배양하여 얻은 방사무늬김 중에서, 에틸 메탄설포네이트를 처리하지 않은 방사무늬김보다 필수아미노산 함량이 높은 방사무늬김을 선별하여 돌연변이 방사무늬김 500GEAA(P. yezoensis 500GEAA)로 명명하였다.Among the radiation pattern seams obtained by culturing the radiation pattern seams surviving after the ethyl methanesulfonate treatment in MGM medium, the radiation pattern seaweeds having higher essential amino acid content than the radiation pattern seams not treated with ethyl methanesulfonate were selected and mutated. Patterned laver 500GEAA ( P. yezoensis 500GEAA) was named.

시험예 1: 돌연변이 방사무늬김의 염기서열 변이 확인Test Example 1: Confirmation of sequence variation of mutant radiation pattern laver

임의증폭 DNA 다형성(Rrandomly Amplified Polymorphic DNAs; RAPDs) 방법을 이용하여 염기서열 변이 여부를 비교하였다.Sequence variation was compared using randomly amplified polymorphic DNAs (RAPDs).

상기 실시예 1에서 얻은 각 게놈 DNA 1 uL 을 넣고 AccuPowerPCR PreMix(Eurofins Genomics), 하기 표 1에 표시된 20개의 프라이머(10 pmol/ul) 1 uL과 완충액(DEPC-water) 7 uL을 첨가하여 PCR을 수행하였다. 반응조건은 95℃에서 5분 동안 변성(denaturation)반응시키고, 95℃에서 30초, 60℃에서 30초, 72℃에서 30초로 35 사이클(cycle) 동안 증폭시킨 후 75℃에서 7분 조건으로 반응시켰다.Example 1 into the respective genomic DNA 1 uL obtained in AccuPower ⓡ PCR PreMix (Eurofins Genomics) , by the addition of 20 primers (10 pmol / ul) 1 uL with Buffer (DEPC-water) 7 uL shown in Table 1 PCR was performed. The reaction conditions were denatured at 95 ° C. for 5 minutes, amplified for 35 cycles at 95 ° C. for 30 seconds, at 60 ° C. for 30 seconds, and at 72 ° C. for 30 seconds, and then at 75 ° C. for 7 minutes. I was.

이를 통해 에틸 메탄설포네이트를 처리하지 않은 방사무늬김과 필수아미노산 함량이 높은 방사무늬김을 선별하여 돌연변이 방사무늬김 500GEAA의 유전형질 변이를 확인할 수 있다.Through this, the genetic pattern of the mutant radiation pattern 500 500AAAA can be identified by screening the radiation patterned laver which is not treated with ethyl methanesulfonate and the radiation patterned laver with high essential amino acid content.

서열번호SEQ ID NO: 명칭designation 서열(5'->3')Sequence (5 '-> 3') 1One 프라이머 OPA-01Primer OPA-01 CAGGCCCTTCCAGGCCCTTC 22 프라이머 OPA-02Primer OPA-02 TGCCGAGCTGTGCCGAGCTG 33 프라이머 OPA-03Primer OPA-03 AGTCAGCCACAGTCAGCCAC 44 프라이머 OPA-04Primer OPA-04 AATCGGGCTGAATCGGGCTG 55 프라이머 OPA-05Primer OPA-05 AGGGGTCTTGAGGGGTCTTG 66 프라이머 OPA-06Primer OPA-06 GGTCCCTGACGGTCCCTGAC 77 프라이머 OPA-07Primer OPA-07 GAAACGGGTGGAAACGGGTG 88 프라이머 OPA-08Primer OPA-08 GTGACGTAGGGTGACGTAGG 99 프라이머 OPA-09Primer OPA-09 GGGTAACGCCGGGTAACGCC 1010 프라이머 OPA-10Primer OPA-10 GTGATCGCAGGTGATCGCAG 1111 프라이머 OPA-11Primer OPA-11 CAATCGCCGTCAATCGCCGT 1212 프라이머 OPA-12Primer OPA-12 TCGGCGATAGTCGGCGATAG 1313 프라이머 OPA-13Primer OPA-13 CAGCACCCACCAGCACCCAC 1414 프라이머 OPA-14Primer OPA-14 TCTGTGCTGGTCTGTGCTGG 1515 프라이머 OPA-15Primer OPA-15 TTCCGAACCCTTCCGAACCC 1616 프라이머 OPA-16Primer OPA-16 AGCCAGCGAAAGCCAGCGAA 1717 프라이머 OPA-17Primer OPA-17 GACCGCTTGTGACCGCTTGT 1818 프라이머 OPA-18Primer OPA-18 AGGTGACCGTAGGTGACCGT 1919 프라이머 OPA-19Primer OPA-19 CAAACGTCGGCAAACGTCGG 2020 프라이머 OPA-20Primer OPA-20 GTTGCGATCCGTTGCGATCC

도 2에서 확인할 수 있듯이, 상기 방법으로 필수아미노산 함량이 높은 방사무늬김을 선별한 돌연변이 방사무늬김 500GEAA의 유전자 증폭 특성을 에틸 메탄설포네이트를 처리하지 않은 방사무늬김과 비교하였을 때, 서열번호 10, 11, 13으로 표시되는 프라이머를 사용한 경우에 대해서는 에틸 메탄설포네이트를 처리하지 않은 방사무늬김과 돌연변이 방사무늬김 500GEAA의 DNA 사이에 염기서열 상의 차이점이 발생하였음을 알 수 있었다. 특히 상기 프라이머는 에틸 메탄설포네이트를 처리하지 않은 방사무늬김과의 구분을 위해 사용될 수 있음을 새롭게 확인하였다.As can be seen in Figure 2, when comparing the gene amplification characteristics of the mutant radiation patterned seaweed 500GEAA that selected the radiation patterned seaweed with high essential amino acid content by the above method compared to the radiation patterned seaweed without treatment with ethyl methanesulfonate, SEQ ID NO: 10 In the case of using the primers 11, 13, it could be seen that there was a difference in the nucleotide sequence between the DNA of the mutated radiation patterned kimchi and 500GEAA which was not treated with ethyl methanesulfonate. In particular, it was newly confirmed that the primer can be used to distinguish it from the radiation pattern laver not treated with ethyl methanesulfonate.

시험예 2: 돌연변이 방사무늬김 500GEAA의 필수아미노산 함량 측정Test Example 2: Determination of the Essential Amino Acid Content of Mutant Radiation Strip Kim 500GEAA

필수아미노산 함량의 측정 방법은 다음과 같다. 건조된 방사무늬김 시료 10 g을 70% 에탄올 150 mL로 80℃에서 2시간 동안 3회 추출하였다. 지용성 성분을 제거하기 위하여 상기 에탄올의 2배 이상에 해당하는 부피의 헥산을 첨가하여 추출하고, 파이펫(pipet)을 이용하여 헥산 분획 층을 제거하였으며, 수층을 45℃에서 감압 농축하여 시료를 준비하였다.The measuring method of essential amino acid content is as follows. 10 g of dried radiant laver samples were extracted three times at 80 ° C. with 150 mL of 70% ethanol. In order to remove the fat-soluble component, the volume of hexane corresponding to at least two times of the ethanol was added and extracted, and the hexane fractionation layer was removed by using a pipette, and the aqueous layer was concentrated under reduced pressure at 45 ° C. to prepare a sample. It was.

50 mL 메스플라스크에 유리프렙 시약(Uriprep, Waterbury, CT, USA) 250 mL 및 시료 10 mL를 투입하고 원심분리하여 0.2 um 시린지 필터(syringe filter)로 여과하였다. 이를 리튬 희석액(Lithium diluent, pH 2.36)으로 약 40배 희석한 후 10 uL를 HPLC 분석장비(Agilent 1100 Series, Agilent Technologies Inc., Santa Clara, CA, USA)에 주입하였다.250 mL of glass prep reagent (Uriprep, Waterbury, CT, USA) and 10 mL of sample were added to a 50 mL volumetric flask and centrifuged and filtered through a 0.2 um syringe filter. It was diluted about 40-fold with lithium diluent (Lithium diluent, pH 2.36) and 10 uL was injected into an HPLC analyzer (Agilent 1100 Series, Agilent Technologies Inc., Santa Clara, CA, USA).

아미노산 분석을 위해 양이온 교환 컬럼(cation exchange column, 3×250 mm, 8 um, Pickering Laboratories Inc.)과 PINNACLE PCX 반응기(Pickering Laboratories Inc.)를 사용하였으며 0.3 mL/min의 유속으로 분석하였다. 컬럼과 반응기 온도는 각각 40℃ 및 130℃로 유지하면서 분석하였다(Grunau JA, Swiader JM. 1992. Chromatography of 99 amino acids and other ninhydrin-reactive compounds in the Pickering lithium gradient system. J Chromatography A 594: 165-171.).For amino acid analysis, a cation exchange column (3 × 250 mm, 8 um, Pickering Laboratories Inc.) and a PINNACLE PCX reactor (Pickering Laboratories Inc.) were used and analyzed at a flow rate of 0.3 mL / min. Column and reactor temperatures were analyzed while maintaining at 40 ° C. and 130 ° C., respectively (Grunau JA, Swiader JM. 1992. Chromatography of 99 amino acids and other ninhydrin-reactive compounds in the Pickering lithium gradient system.J Chromatography A 594: 165- 171.).

상기 아미노산 분석 결과 중 필수아미노산에 해당하는 피크(peak)를 확인하여 필수아미노산의 함량 값을 도출하여 하기 표 2와 같이 나타내었다.The peak corresponding to the essential amino acid in the amino acid analysis result was confirmed to derive the content value of the essential amino acid, and is shown in Table 2 below.

필수아미노산
함량
Essential amino acid
content
비처리 방사무늬김
(g/100g)
Untreated radial pattern
(g / 100g)
방사무늬김 500GEAA
(g/100g)
Radiation seaweed 500GEAA
(g / 100g)
트레오닌Threonine 2.38282.3828 3.39413.3941 발린Valine 1.99431.9943 2.67532.6753 메티오닌Methionine 0.82880.8288 1.03821.0382 이소류신Isoleucine 1.03601.0360 1.31771.3177 류신Leucine 2.77132.7713 3.47393.4739 페닐알라닌Phenylalanine 1.89071.8907 2.23612.2361 라이신Lysine 2.33102.3310 3.07463.0746 총합total 13.234913.2349 17.209817.2098

도 1에서 확인할 수 있듯이, 돌연변이 방사무늬김 500GEAA의 필수아미노산 함량은 17.21(g 필수아미노산/100 g 김 시료)이었으며, 대조군 방사무늬김으로부터 얻은 필수아미노산 함량은 방사무늬김 시료 100 g 대비 13.24 g으로, 돌연변이 방사무늬김의 필수아미노산 함량은 대조군 방사무늬김에 비해 29.98% 높은 값을 나타냈다.As can be seen in Figure 1, the essential amino acid content of the mutant radiation patterned seaweed 500GEAA was 17.21 (g essential amino acid / 100 g seaweed sample), the essential amino acid content obtained from the control radiation patterned seaweed is 13.24 g compared to 100 g of the radiation patterned seaweed. The essential amino acid content of the mutant radiation patterned seaweed showed 29.98% higher value than the control radiation patterned seaweed.

한국생명공학연구원Korea Research Institute of Bioscience and Biotechnology KCTC13428BPKCTC13428BP 2017121420171214

<110> Industry-University Cooperation Foundation Chonnam University <120> Mutant Porphyra yezoensis 500GEAA comprising higher essential amino acids content, method of preparing thereof and method of preparing glutamate using the same <130> PN170294 <160> 20 <170> KopatentIn 2.0 <210> 1 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 1 caggcccttc 10 <210> 2 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 2 tgccgagctg 10 <210> 3 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 3 agtcagccac 10 <210> 4 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 4 aatcgggctg 10 <210> 5 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 5 aggggtcttg 10 <210> 6 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 6 ggtccctgac 10 <210> 7 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 7 gaaacgggtg 10 <210> 8 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 8 gtgacgtagg 10 <210> 9 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 9 gggtaacgcc 10 <210> 10 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 10 gtgatcgcag 10 <210> 11 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 11 caatcgccgt 10 <210> 12 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 12 tcggcgatag 10 <210> 13 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 13 cagcacccac 10 <210> 14 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 14 tctgtgctgg 10 <210> 15 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 15 ttccgaaccc 10 <210> 16 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 16 agccagcgaa 10 <210> 17 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 17 gaccgcttgt 10 <210> 18 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 18 aggtgaccgt 10 <210> 19 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 19 caaacgtcgg 10 <210> 20 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 20 gttgcgatcc 10 <110> Industry-University Cooperation Foundation Chonnam University <120> Mutant Porphyra yezoensis 500 GEAA comprising higher essential          amino acids content, method of preparing background and method of          preparing glutamate using the same <130> PN170294 <160> 20 <170> KopatentIn 2.0 <210> 1 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 1 caggcccttc 10 <210> 2 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 2 tgccgagctg 10 <210> 3 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 3 agtcagccac 10 <210> 4 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 4 aatcgggctg 10 <210> 5 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 5 aggggtcttg 10 <210> 6 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 6 ggtccctgac 10 <210> 7 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 7 gaaacgggtg 10 <210> 8 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 8 gtgacgtagg 10 <210> 9 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 9 gggtaacgcc 10 <210> 10 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 10 gtgatcgcag 10 <210> 11 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 11 caatcgccgt 10 <210> 12 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 12 tcggcgatag 10 <210> 13 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 13 cagcacccac 10 <210> 14 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 14 tctgtgctgg 10 <210> 15 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 15 ttccgaaccc 10 <210> 16 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 16 agccagcgaa 10 <210> 17 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 17 gaccgcttgt 10 <210> 18 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 18 aggtgaccgt 10 <210> 19 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 19 caaacgtcgg 10 <210> 20 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 20 gttgcgatcc 10

Claims (16)

필수아미노산 함량이 증가한 수탁번호 KCTC13428BP로 기탁된 돌연변이 방사무늬김 500GEAA(Porphyra yezoensis 500GEAA).Mutant radiation patterned seaweed 500GEAA ( Porphyra yezoensis 500GEAA) deposited with accession number KCTC13428BP with increased essential amino acid content. 제1항에 있어서, 상기 돌연변이 방사무늬김은, 에틸 메탄설포네이트가 처리된 방사무늬김(Porphyra yezoensis)으로부터 방출된 포자로서 얻어지는 것인, 돌연변이 방사무늬김.The mutant radiation patterned seaweed of claim 1, wherein the mutant radiation patterned seaweed is obtained as spores released from Porphyra yezoensis treated with ethyl methanesulfonate. 제1항에 있어서, 상기 돌연변이 방사무늬김의 필수아미노산 함량은 15.00 내지 25.00 중량%인 것인, 돌연변이 방사무늬김.The mutant radiation patterned seaweed of claim 1, wherein the essential amino acid content of the mutant radiation patterned seaweed is 15.00 to 25.00 wt%. 다음의 단계를 포함하는 필수아미노산 함량이 증가한 수탁번호 KCTC13428BP로 기탁된 돌연변이 방사무늬김 500GEAA(Porphyra yezoensis 500GEAA)의 제조방법:
방사무늬김(Porphyra yezoensis)에 에틸 메탄설포네이트를 처리하여 배양하는 배양 단계; 및
상기 배양된 방사무늬김 중에서 에틸 메탄설포네이트를 처리하지 않은 방사무늬김보다 필수아미노산 함량이 높은 방사무늬김을 선별하는 선별 단계.
Method for the preparation of mutant radiation patterned seaweed 500GEAA (porphyra yezoensis 500GEAA) deposited with accession number KCTC13428BP with an increased essential amino acid content, including the following steps:
A culture step of culturing the treated with ethyl methanesulfonate to the radiation pattern laver ( Porphyra yezoensis ); And
A screening step of selecting a radiation patterned seaweed with higher essential amino acid content than the radiation patterned seaweed treated with ethyl methanesulfonate from the cultured radiation patterned seaweed.
제4항에 있어서, 상기 배양 단계는 MGM(Modified Grund Media) 배지 조건하에서 수행되는 것인, 돌연변이 방사무늬김의 제조방법.The method of claim 4, wherein the culturing step is performed under Modified Grund Media (MGM) medium conditions. 제5항에 있어서, 상기 MGM 배지는 C10H14O6N2Na2·2H2O(Na2EDTA), FeSO4·7H2O, Na2HPO4·12H2O, NaNO3, MnCl2·7H2O 및 시아노코발라민(Cyanocobalamin)을 포함하는 것인, 돌연변이 방사무늬김의 제조방법.The method of claim 5, wherein the MGM medium is C 10 H 14 O 6 N 2 Na 2 · 2H 2 O (Na 2 EDTA), FeSO 4 · 7H 2 O, Na 2 HPO 4 · 12H 2 O, NaNO 3 , MnCl 2 · 7H 2 O and cyanocobalamin (Cyanocobalamin) comprising a method for producing a mutant radiation pattern laver. 제4항에 있어서, 상기 배양 단계는 10 내지 50 umol/m2s의 광도에서 수행되는 것인, 돌연변이 방사무늬김의 제조방법.The method of claim 4, wherein the culturing step is performed at a luminous intensity of 10 to 50 umol / m 2 s. 제4항에 있어서, 상기 배양 단계는 12h:12h의 명:암 사이클로 수행되는 것인, 돌연변이 방사무늬김의 제조방법.The method of claim 4, wherein the culturing step is performed in a light: dark cycle of 12h: 12h. 제4항에 있어서, 상기 배양 단계는 10 내지 25℃의 온도에서 수행되는 것인, 돌연변이 방사무늬김의 제조방법.The method of claim 4, wherein the culturing step is performed at a temperature of 10 to 25 ° C. 6. 제4항에 있어서, 상기 돌연변이 방사무늬김의 필수아미노산 함량은 15.00 내지 25.00 중량%인 것인, 돌연변이 방사무늬김의 제조방법.The method of claim 4, wherein the essential amino acid content of the mutant radiation patterned laver is 15.00 to 25.00 wt%. 제4항에 있어서, 상기 배양 단계는 다음의 단계를 포함하는 것인, 돌연변이 방사무늬김의 제조방법:
에틸 메탄설포네이트를 처리한 방사무늬김을 배양하는 제1 배양 단계;
제1 배양 단계에서 생존한 방사무늬김을 선별하여 배양하는 제2 배양 단계; 및
제2 배양 단계에서 방사무늬김이 방출한 포자를 배양하는 제3 배양 단계.
The method of claim 4, wherein the culturing step comprises the following steps:
A first culture step of culturing the radial patterned laver treated with ethyl methanesulfonate;
A second culture step of selecting and culturing the radiation pattern laver surviving in the first culture step; And
The third culture step of culturing the spores released by the radiation pattern laver in the second culture step.
다음 단계를 포함하는 필수아미노산의 제조방법:
수탁번호 KCTC13428BP로 기탁된 돌연변이 방사무늬김 500GEAA(Porphyra yezoensis 500GEAA)를 배양하는 배양 단계; 및
상기 방사무늬김 500GEAA로부터 필수아미노산을 추출하는 추출 단계.
Preparation method of essential amino acid comprising the following steps:
A culture step of culturing the mutant radiation pattern laver 500GEAA ( Porphyra yezoensis 500GEAA) deposited with accession number KCTC13428BP; And
Extraction step of extracting the essential amino acid from the radiation patterned seaweed 500GEAA.
제12항에 있어서, 상기 배양 단계는 MGM(Modified Grund Media) 배지 조건하에서 수행되는 것인, 필수아미노산의 제조방법.The method of claim 12, wherein the culturing step is performed under Modified Grund Media (MGM) medium. 제13항에 있어서, 상기 배지는 C10H14O6N2Na2·2H2O(Na2EDTA), FeSO4·7H2O, Na2HPO4·12H2O, NaNO3, MnCl2·7H2O 및 시아노코발라민(Cyanocobalamin)을 포함하는 것인, 필수아미노산의 제조방법.The method of claim 13, wherein the medium is C 10 H 14 O 6 N 2 Na 2 · 2H 2 O (Na 2 EDTA), FeSO 4 · 7H 2 O, Na 2 HPO 4 · 12H 2 O, NaNO 3 , MnCl 2 7H 2 O and cyanocobalamin (Cyanocobalamin) comprising a method for producing an essential amino acid. 제12항에 있어서, 상기 배양 단계는 10 내지 50 umol/m2s의 광도에서 수행되는 것인, 필수아미노산의 제조방법.The method of claim 12, wherein the culturing step is performed at a luminous intensity of 10 to 50 umol / m 2 s. 제12항에 있어서, 상기 돌연변이 방사무늬김의 필수아미노산 함량은 15.00 내지 25.00 중량%인 것인, 필수아미노산의 제조방법.The method according to claim 12, wherein the essential amino acid content of the mutant radiation pattern laver is 15.00 to 25.00% by weight.
KR1020180019795A 2018-02-20 2018-02-20 Mutant Porphyra yezoensis 500GEAA comprising higher essential amino acids content, method of preparing thereof and method of preparing glutamate using the same KR102026016B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020180019795A KR102026016B1 (en) 2018-02-20 2018-02-20 Mutant Porphyra yezoensis 500GEAA comprising higher essential amino acids content, method of preparing thereof and method of preparing glutamate using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020180019795A KR102026016B1 (en) 2018-02-20 2018-02-20 Mutant Porphyra yezoensis 500GEAA comprising higher essential amino acids content, method of preparing thereof and method of preparing glutamate using the same

Publications (2)

Publication Number Publication Date
KR20190099835A KR20190099835A (en) 2019-08-28
KR102026016B1 true KR102026016B1 (en) 2019-09-26

Family

ID=67774892

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020180019795A KR102026016B1 (en) 2018-02-20 2018-02-20 Mutant Porphyra yezoensis 500GEAA comprising higher essential amino acids content, method of preparing thereof and method of preparing glutamate using the same

Country Status (1)

Country Link
KR (1) KR102026016B1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102418317B1 (en) * 2020-01-20 2022-07-07 전남대학교산학협력단 Mutant Porphyra yezoensis 500PP with increased content of polysaccharide with antioxidant activity and preparing method thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101727478B1 (en) * 2015-07-16 2017-04-17 전남대학교산학협력단 A mutant Porphyra yezoensis Py501G expressing higher level of ascorbate peroxide and preparation method thereof
KR101707674B1 (en) * 2015-07-16 2017-02-20 전남대학교산학협력단 Porphyra yezoensis Py503G KCTC 12860BP with Improved Expression of Heat Shock Protein 70

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Aquaculture, Vol.282, pp.117-123 (2008)
Journal of Applied Phycology, Vol.15, pp.407-413 (2003)

Also Published As

Publication number Publication date
KR20190099835A (en) 2019-08-28

Similar Documents

Publication Publication Date Title
JP6852190B2 (en) New microalgae and their use
KR101950245B1 (en) Blue-Green Alga Spirulina Animal Cell Culture Solution, Method for Preparing the Same, and Method for Culturing Cells Using the Same
AU2011312987A1 (en) Heterotrophic microbial production of xanthophyll pigments
Abdelhay et al. The use of vermicompost in cultivation and production of Spirulina platensis
KR102026016B1 (en) Mutant Porphyra yezoensis 500GEAA comprising higher essential amino acids content, method of preparing thereof and method of preparing glutamate using the same
CN108522270B (en) Method for improving detoxification rate and hardening-seedling survival rate based on cucumber anther culture
JP2009072132A (en) Method for producing brown algae rich in health-functional ingredient
KR101427102B1 (en) A Productive method of Zygotic Embryo-derived Embryogenic Cell Suspension Cultures of Camellia sinensis
CN108849451B (en) Method for improving quality of hydroponic lettuce
CN103704023A (en) Method for cultivating functional cordyceps militaris
KR102026013B1 (en) Mutant Porphyra yezoensis 500GE comprising higher glutamate content, method of preparing thereof and method of preparing glutamate using the same
RU2473679C2 (en) METHOD OF PRODUCING SELENIUM-CONTAINING BIOMASS PREPARATION OF Laetiporus sulphureus MZ-22
KR20100111993A (en) A cultivating method of shiitake mushroom including green tea
KR101157461B1 (en) Highly-Expressed Glutathione from Saccharomyces cerevisiae 54-8 wild type and use thereof
KR102262309B1 (en) Production method for cultured root of leguminous plants comprising high-content of coumestrol
Koreti et al. Mineral fortification of Calocybe indica (P&C) and its impact on colony morphology and metabolites production
Kozera et al. Total and fractional contents of proteins in bean seeds under the conditions of varied fertilisation with microelements
KR101169358B1 (en) The method of preparing of high quality oyster mushroom cultured by culture medium using deep sea water
KR101934780B1 (en) Methods of cultivating plantlets in vitro derived from stem node of Moringa
KR20200121524A (en) Method for Increasing of Fucoxanthin as Sub-pigment in a Diatom
KR101677483B1 (en) Antibiotic marker-free transgenic rice with over-expressed of OsNAS3 gene from Oryza sativa enhancing content of seed inorganic compounds
KR102612026B1 (en) Disease-Resistant P. tenera Variants
KR100514919B1 (en) Culture Media Containing Lactoferrin and the Method for Cultivating Chlorella Using the Same
KR102667539B1 (en) Method for increasing carotenoid productivity according to salinity stress condition using microalgae MABIK LP119
KR101934781B1 (en) Medium for culturing plantlets in vitro of moringa plant

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right