KR101707674B1 - Porphyra yezoensis Py503G KCTC 12860BP with Improved Expression of Heat Shock Protein 70 - Google Patents

Abstract

The present invention provides radiopaque pyrazine Py503G (KCTC 12860BP) which is excellent in high temperature stress tolerance and a method for producing the same. According to the present invention, the radiolabelled Py503G (KCTC 12860BP) of the present invention exhibits tolerance to high temperature stress by increasing the expression of heat shock protein 70 (70) as compared with the wild type radiolabelled.

Description

Porphyra yezoensis Py503G KCTC 12860BP with Improved Expression of Heat Shock Protein 70 < RTI ID = 0.0 >

The present invention relates to radiolabelled Py503G (KCTC12860BP) with increased expression of heat shock protein 70.

Heat Shock Protein (HSP) is a general term for proteins expressed under high temperature and various environmental stresses (high temperature, low temperature, salinity, moisture, oxidation, heavy metals, etc.). Under the environmental stress, it performs the function of molecular chaperone. It restores its structure and function by nonspecifically binding with various proteins in cells modified under stress, and improves stress tolerance of life.

One of these defense mechanisms is to produce a heat shock protein called heat shock protein in order to prevent protein denaturation. Thermal shock proteins synthesized in eukaryotes including plants are classified into HSP100, HSP90, HSP70, HSP60 and small HSPs .

Higher plants are exposed to multiple environmental stresses. Cells do not retain their original function when stressed from the environment. In particular, temperature stress inhibits photosynthesis and growth, and these stresses are known to mainly denature proteins.

It is known that heat shock proteins are synthesized when exposed to high temperature to increase heat resistance by performing molecular chaperon function to prevent protein denaturation and protein aggregation.

In addition, even in the absence of stress, heat shock proteins function as molecular chaperones and play an important role in cells, so gene structures, regulatory mechanisms and intracellular functions are well preserved in various species and cells.

Several previous studies have shown that plants and crops with improved heat and cold tolerance can be obtained through transformation of heat shock proteins and these results are closely related to the temperature tolerance of plant cells.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have sought to produce steams overexpressing heat shock proteins that are associated with tolerance to environmental stresses such as high temperature, cold, and drying. As a result, the present inventors completed the present invention by producing a mutant radiation patterned kimchi overexposing a heat shock protein 70 (heat shock protein 70) by irradiating the radiation pattern.

Therefore, it is an object of the present invention to provide a radiolabelled Py503G (KCTC 12860BP).

It is another object of the present invention to provide a method of manufacturing radiative fog.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides radiolabelled Py503G (KCTC 12860BP) with increased expression of heat shock protein 70 (Heat Shock Protein 70).

The present inventors have sought to produce steams overexpressing heat shock proteins that are associated with tolerance to environmental stresses such as high temperature, cold, and drying. As a result, radiation pattern was irradiated to produce a mutant radiation patterned kimchi overexpressing heat shock protein 70 (Heat Shock Protein 70).

The radiolabel Py503G (KCTC 12860BP) of the present invention represents the expression of up-regulated heat shock protein 70.

According to one embodiment of the present invention, the radiation pattern Py503G (KCTC 12860BP) increases the expression of Heat shock protein 70 by 5 to 15 times.

It is known that prolonged exposure to high temperature stress increases the resistance to high temperature stress by performing molecular chaperone function to prevent thermal denaturation and protein aggregation by synthesizing heat shock protein.

The pyrazine Py503G (KCTC 12860BP) of the present invention is cultured under a culture condition of 20 μmol photon m ^-2 s ^-1 or higher, 12:12 light-dark cycle and 12-20 ° C.

The radiolabelled Py503G (KCTC 12860BP) of the present invention can be cultured in a kimchi culture medium known in the art.

According to one embodiment of the present invention, the radiation pattern Py503G (KCTC 12860BP) is cultured in MGM (Modified Grund Medium).

The MGM is _{Na2EDTA (C 10 H 14 O 6} N 2 Na 2 and H ₂ O) in a sterilized water 1 L 3.72 g, FeSO ₄ and _{7H 2 O 0.28 g, Na 2} HPO 4 and 12H ₂ O 10.74 g, NaNO ₃ , 0.019197 g of MnCl ₂ .7H ₂ O, and 1 mg of vitamin B ₁₂ (cyanocobalamine).

As used herein, the term 'up-regulation' means that the degree of 70 읠 expression of the heat shock protein in the mutant radiolabeled kimchi prepared by the above production method is higher than the expression amount of the heat shock protein 70 in wild type radish kimchi.

According to another aspect of the present invention, the present invention provides a method of producing radiant fried kimchi with increased expression of hot stress tolerance related heat shock protein 70 comprising the steps of:

(a) inoculating a culture medium with Porphyra yezoensis ;

(b) irradiating the inoculated radiant streaks at 10-50 μmol photon m ^-2 s ^-1 luminosity, 10-14 hour light cycle, 10-14 hour dark cycle, and 10-20 ° C. temperature for 1-15 weeks ≪ / RTI >

(c) irradiating the result of step (b) with radiation; And

(d) selecting the mutant radiolabeled up-regulated up-regulated heat shock protein 70 in the result of step (c).

According to another aspect of the present invention, the present invention provides a method for producing hot stress resistant radiation pattern steels, comprising the steps of:

(a) inoculating a culture medium with Porphyra yezoensis ;

(b) irradiating the inoculated radiant streaks at 10-50 μmol photon m ^-2 s ^-1 luminosity, 10-14 hour light cycle, 10-14 hour dark cycle, and 10-20 ° C. temperature for 1-15 weeks ≪ / RTI >

(c) irradiating the result of step (b) with radiation; And

(d) selecting the mutant radiolabeled up-regulated up-regulated heat shock protein 70 in the result of step (c).

The method of manufacturing the radiation patterned iris of the present invention irradiates the radiation pattern to random mutagenesis.

According to an embodiment of the present invention, the radiation of step (c) is radiation having an absorbed dose of 0.1-4.0 kGy. As used herein, the term " absorbed dose " refers to the amount of energy per unit mass that is absorbed by the radiation-exposed material. That is, the above-mentioned 0.1-4.0 kGy means that the energy of 0.1-4.0 kJ is absorbed per kilogram of the radiation pattern.

According to another embodiment of the invention, the radiation is 0.1-3.0 kGy, 0.1-2.0 kGy or 0.1-2.0 kGy of absorbed dose.

The method for producing radiant fimbriae and the method for producing high-temperature stress-tolerant radiant fimbriae in which the expression of the heat shock protein 70 of the present invention is increased further includes a step of culturing under the same culture conditions as in step (b) after the step (c) do.

The radiation pattern produced by the method of the present invention increases the expression of heat shock protein 70 due to radiation mutagenesis.

According to an embodiment of the present invention, the expression of the heat shock protein 70 in the step (d) is detected through a gene amplification reaction.

The term " amplification reaction " as used herein refers to a reaction to amplify a nucleic acid molecule. A variety of amplification reactions have been reported in the art, including polymerase chain reaction (PCR) (US Pat. Nos. 4,683,195, 4,683,202 and 4,800,159), reverse-transcription polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning. (LCR) (see, for example, A Laboratory Manual, 3rd Ed. Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al (EP 329,822) 17, 18), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA) 19 (WO 88/10315) (WO 90/06995), selective amplification of target polynucleotide sequences (U.S. Patent No. 6,410,276), consensus sequence priming polymerase < RTI ID = 0.0 > A consensus sequence primed polymerase chain reaction (CP-PCR) (U.S. Patent No. 4,437,975), a random (APPCR) (U.S. Patent Nos. 5,413,909 and 5,861,245), nucleic acid sequence based amplification (NASBA) (U.S. Patent Nos. 5,130,238, 5,409,818 5,554,517, and 6,063,603), strand displacement amplification (21,22), and loop-mediated isothermal amplification. (LAMP) 23, but is not limited thereto. Other amplification methods that may be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617 and U.S. Patent No. 09 / 854,317.

According to an embodiment of the present invention, the gene amplification reaction is performed using a forward primer consisting of the nucleotide sequence of the first sequence of the sequence listing and a reverse primer consisting of the nucleotide sequence of the second sequence of the sequence listing.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a radiolabelled Py503G (KCTC 12860BP) which is excellent in high temperature stress resistance and a method for producing the same.

(b) The radiolabelled Py503G (KCTC 12860BP) of the present invention exhibits resistance to high temperature stress by increasing the expression of Heat Shock Protein 70 in comparison with the wild type radiolabelled.

1 shows the results of confirming the expression of Heat Shock Protein 70 in the wild-type radiant stamen and pyrazine Py503G ( P. yezoensis Py503G) by reverse transcription PCR.
FIG. 2 shows the results of real-time PCR analysis of the heat shock protein 70 expression of the wild-type radiative fungus and the radiating fungus Py503G ( P. yezoensis Py503G).

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example 1: Radiant patterning Py503G ( Porphyra yezoensis  Py503G) production

P. yezoensis was distributed from the National Fisheries Research and Development Institute.

The radiant streaks were placed in a MGM (Modified Grund Medium) medium, and then added to a plant culture dish (100 × 40 mm) in a volume of 100 ml. The light intensity was 20 μmol photon m ^-2 s ^-1 or more, 12:12 light / And incubated for 1 - 10 weeks at a temperature of 12 ° C.

Irradiation was carried out using a cobalt-60 irradiator (AECL, IR-79, Nordion, Canada) at a dose of 0 kGy, 0.1 kGy, 0.2 kGy, 0.5 kGy and 1 kGy, respectively, . Radiation doses were analyzed with a Bruker EMS 104 EPR analyzer using an alanine dosimeter (Bruker Instruments, Rheinstetten, Germany).

Each irradiated specimen irradiated with radiation was transferred to MGM, and cultured for 1 to 10 weeks at a light / dark cycle of 12 μmol / m ² s ^-1 or more at a light intensity of 20 μmol photon m ^-2 s ^-1 or higher, The survival rate of Kim was analyzed by cell counting.

After irradiation, the surviving radial streaks were transferred to MGM and cultured for 1 to 10 weeks at a light / dark cycle of 12: 12 photon m ^-2 s ^-1 and a light intensity of 12 μmol and a temperature of 12 ° C. Release was induced by increasing the incubation temperature of the kimchi to 20 ℃. The resulting spores were incubated with new MGM at a light intensity of 20 μmol photon m ^-2 s ^-1 or higher, a light / dark cycle of 12:12 and a temperature of 12 ° C. for 10 weeks.

In the above, MGM was prepared by dissolving 3.72 g of Na ₂ EDTA (C ₁₀ H ₁₄ O ₆ N ₂ Na ₂ .H ₂ O), 0.28 g of FeSO ₄揃 7H ₂ O, 10.74 g of Na ₂ HPO ₄揃 12H ₂ O, 42.5 g of NaNO ₃ , ₂ · 7H ₂ O 0.019197 g and vitamin B ₁₂ (cyano Cove Ala min) it was used as a sterile 1 L water containing 1 ㎎.

In the above, the radiative stamina surviving after the irradiation of radiation was cultivated in MGM, and the radiative stamina having high heat shock protein 70 (HSP 70) ( Porphyra yezoensis Py503G), and deposited on June 23, 2015 with the deposit number KCTC 12860BP at the Microbiological Resource Center (KCTC) of the Korea Research Institute of Bioscience and Biotechnology.

On the other hand, in order to compare the expression of the heat shock protein 70 of the surviving radiolabeled Py503G after irradiation with the wild-type radiolabeled radiation, primers were prepared to a size of 300 bp or less using a primer 3 program.

The primers were prepared as shown in Table 1 and reverse transcription-polymerase chain reaction (RT-PCR) was performed to confirm the expression of heat shock protein 70.

gene Nucleotide sequence Heat shock protein 70 Py_PyHSP70 forward primer GTGGGAAGCCTACCGTCATA Sequence Listing 1st sequence Py_PyHSP70 Reverse primer CCTCCTGGCAATTTGTCCTA Sequence Listing Sequence

Experimental Example 1: RNA extraction and cDNA synthesis of radiolabeled Py503G

RNA extraction from radiolabeled Py503G

RNA was extracted from the radiolabelled Py503G obtained in the above example. 100 mg of each wild-type radish stalk and radish stalk Py503G was frozen in liquid nitrogen and milled into a sterilized mulberry bowl. The RNA purification kit used was a QIAGEN RNeasy mini kit. 100 ㎎ of the milled tissue was placed in a 1.5 ml microcentrifuge tube, 450 쨉 l RLT buffer was added, vortexed, transferred to a QIAshredder spin column, . ≪ / RTI > The separated buffer was mixed with 0.5 volume of ethanol and washed by centrifugation in 700 μl RW1 buffer for 15 seconds at 8000 g or more. The eluted buffer was removed and the column was centrifuged with 700 μl RW1 buffer for 15 seconds at 8000 g or more. The eluted buffer was centrifuged for 15 minutes with 500 μl RPE buffer and 8000 g for 2 minutes. . The column was transferred to a new 1.5-ml microcentrifuge tube, 30-50 μl of RNase-free water was added, and centrifugation was carried out for 1 min at 8000 g. Then, wild-type radiolabelled and radiolabelled Py503G .

Quantification of total RNA

Biodrop (Biochrom, Germany) was set at a wavelength range of 230 nm and 280 nm absorbance, and 2 쨉 l of ultrapure water was added to the spot to obtain a base. 2 μl of the RNA sample extracted in the above example was spotted, absorbance was measured at 260 nm wavelength, RNA quantification value was confirmed, and RNAs of wild-type and radiolabeled Py503G were quantified.

Synthetic cDNA Synthesis of Radiation Patterned Py503G and Radially Patterned Kim

CDNA was synthesized using a transcriptor Fiest Strand cDNA Synthesis Kit (Roche, Germany) with 2 ㎕ RNA samples of the radiolabeled Py503G and the wild-type radiolabel identified in the above Experimental Example. To each 2 μl RNA sample, 1 μl of oligo-dT and DEPC-water were added to a total of 13 μl and incubated at 65 ° C for 10 minutes. After the treatment, 4 μl of RT reaction (5 ×), 1 μl of reverse transcriptase, 0.5 μl of RNase inhibitor and 2 μl of dNTP were added and incubated at 50 ° C. for 60 minutes and 85 ° C. for 5 minutes to obtain radiolabelled Py503G and wild- The cDNA of Kim was synthesized.

Test Example 2: Evaluation of reverse transcription polymerization

Reverse transcription-polymerase chain reaction (RT-PCR) is a method for applying PCR to mRNA. It can not only detect gene expression, that is, express mRNA but also quantify mRNA.

1 μl of synthesized radiolabeled Py503G and wild-type radiolabelled cDNA was added and 1 μl of AccuPower PCR PreMix, gene-specific primer (10 pmol / μl) and 7 μl of DEPC-water were added to perform PCR. The reaction conditions were denatured at 95 ° C for 5 minutes, amplified for 35 cycles at 95 ° C for 30 seconds, 60 ° C for 30 seconds, and 72 ° C for 30 seconds, followed by reaction at 75 ° C for 7 minutes.

The pyrosequence polymerization reaction evaluation of the pyrazine Py503G was compared. As shown in FIG. 1, when the heat shock protein 70 expression was compared with that of the reverse transcription polymerase, Py503G was expressed at a higher temperature than that of the wild-type radiating Kim without irradiation at a temperature of 12 ° C. From the results shown in Fig. 1, it can be seen that the pyramidal pyrazolopyrimidine Py503G of the present invention has a higher expression of the heat shock protein 70 than that of the wild-type pyramidal pyrazin.

Test Example 3: Real-time chain polymerization evaluation

In the present invention, real-time PCR (real-time PCR) was used to confirm the expression pattern of the gene in real time. In a real-time chain-reaction, the amount of PCR product is measured for each cycle. In particular, since the reaction in the amplification section can be confirmed in real time, the initial amount of the gene to be confirmed can be confirmed accurately.

The differences in the expression of heat shock protein 70 in radiolabeled Py503G and wild-type radiolabel obtained in the above examples were compared.

The chain polymerization was performed in an EcoTM real-time chain reaction system using QIAGEN QunatiTect SYBR Green PCR kit. 1 μl of the synthesized radiolabelled Py503G and wild-type radiolabeled cDNA was added, and 10 μl of the SYBR Green PCR Kit master mix and 1 μl of the gene-specific primer (10 pmol / μl) and 7 μl of DEPC-water were added to perform PCR . Reaction conditions were denatured at 95 ° C for 10 minutes, and reacted at 95 ° C for 15 seconds, at 55 ° C for 15 seconds, and at 95 ° C for 15 seconds. The primers of the Py18s gene were used as internal control genes and the expression levels of the respective treatments were compared. In order to increase the reliability of the experiment, it was performed in duplicate. When the amplification process was completed, the Ct value of each sample was confirmed, and the value of Ct and the value of Ct were confirmed using the Ct value. The ΔCt value is obtained by subtracting the average Ct value of the internal control gene (Py18s) from the average Ct value of each sample. At this time, the control is calculated between the control and the treatments are calculated between the treatments to obtain the ΔCt values of the control and the treatments. The value of ΔΔCt is the value obtained by subtracting the value of the control ΔCt from the value of ΔCt of the treated sample of each sample. The relative expression level of the treatments was confirmed by 2 ^ - ΔΔCt values. When the expression level of the control was set to 1, the relative expression level of the treatments was confirmed.

As can be seen from FIG. 2, the expression of heat shock protein 70 was about 10 times higher than that of wild-type radiation pattern. This means that Py503G radiolabeled leaves maintain a higher level of thermal shock protein 70 expression compared to wild-type radiolabeled roots.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

Korea Biotechnology Research Institute KCTC12860BP 20150623

<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Porphyra yezoensis Py503G KCTC ----- BP with Improved Expression          of Heat Shock Protein 70 <130> PN150216 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Py-PyHSP70 forward primer <400> 1 gtgggaagcc taccgtcata 20 <210> 2 <211> 20 <212> DNA <213> Py_PyHSP70 reverse primer <400> 2 cctcctggca atttgtccta 20

Claims (8)

Radiation pattern Py503G (KCTC 12860BP) with increased expression of heat shock protein 70 (Heat shock protein 70) prepared by irradiating 0.1-4.0 kGy of radiation dose to Porphyra yezoensis .
The radiation pattern Py503G (KCTC 12860BP) according to claim 1, wherein the radiation pattern Py503G (KCTC 12860BP) has a 5-15 fold increase in expression of heat shock protein 70 (KCTC 12860BP).
delete delete delete delete delete delete

Images