KR102024581B1 - Method for preparing DNA library for LINE-1(L1HS) targeted-probe enrichment using HiSeq sequencer - Google Patents

Method for preparing DNA library for LINE-1(L1HS) targeted-probe enrichment using HiSeq sequencer Download PDF

Info

Publication number
KR102024581B1
KR102024581B1 KR1020180037207A KR20180037207A KR102024581B1 KR 102024581 B1 KR102024581 B1 KR 102024581B1 KR 1020180037207 A KR1020180037207 A KR 1020180037207A KR 20180037207 A KR20180037207 A KR 20180037207A KR 102024581 B1 KR102024581 B1 KR 102024581B1
Authority
KR
South Korea
Prior art keywords
l1hs
line
dna
sequence
targeted
Prior art date
Application number
KR1020180037207A
Other languages
Korean (ko)
Inventor
한규동
문세영
신원석
Original Assignee
단국대학교 천안캠퍼스 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 단국대학교 천안캠퍼스 산학협력단 filed Critical 단국대학교 천안캠퍼스 산학협력단
Priority to KR1020180037207A priority Critical patent/KR102024581B1/en
Application granted granted Critical
Publication of KR102024581B1 publication Critical patent/KR102024581B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10Modifications characterised by
    • C12Q2525/191Modifications characterised by incorporating an adaptor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2535/00Reactions characterised by the assay type for determining the identity of a nucleotide base or a sequence of oligonucleotides
    • C12Q2535/122Massive parallel sequencing
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06Biochemical methods, e.g. using enzymes or whole viable microorganisms

Abstract

The present invention relates to a method of preparing the DNA library for a transposable element LINE-1(L1HS)-targeted probe enrichment using HiSeq sequencer, and more specifically, has developed an L1HS-targeted sequencing method on the basis of clinical and academic significance of transposable elements, the development of next-generation sequencing technology, cost reduction, and the development of analysis system. The present invention may serve as a method for use in studies of genetic variations due to L1HS in individuals and the genetic influences according to the same. Furthermore, based on the present invention, it is possible to further develop a technique capable of targeting L1HS-containing active transposable elements alone which have the ability to mobilize in the human genome and create genetic mutations. The transposable element-targeted sequencing as well as the targeted analysis sequencing method, as they are becoming simplified and commonplace, can be expected to be useful in the development of diagnostic markers in clinical medicine.

Description

이동성 유전인자 LINE-1(L1HS) 선택적 발굴을 위한 HiSeq 시퀀서 기반의 DNA 라이브러리 제작 방법{Method for preparing DNA library for LINE-1(L1HS) targeted-probe enrichment using HiSeq sequencer}Method for preparing DNA library for LINE-1 (L1HS) targeted-probe enrichment using HiSeq sequencer}

본 발명은 이동성 유전인자 LINE-1(L1HS) 선택적 발굴을 위한 HiSeq 시퀀서 기반의 DNA 라이브러리 제작 방법에 대한 것으로, 상세하게는 차세대 염기서열 해독 장비인 HiSeq 시퀀서를 이용하여 인간 유전체에서 LINE-1(L1HS)들을 선택적으로 동정하기 위한 탐침자(Probe)의 제작, 실험법 및 생명정보학적 분석 파이프 라인 구축에 관한 것이다.The present invention relates to a method for preparing a HiSeq sequencer-based DNA library for the selective discovery of the mobile gene, LINE-1 (L1HS). The construction of the probe (Probe) for the selective identification of), and the construction of a bioinformatics analysis pipeline.

차세대 염기서열분석(Next-Generation Sequencing, NGS)은 다수 그리고 대량의 추출된 유전물질로부터 염기서열 해독을 동시에 진행할 수 있으며, 단기간에 비교적 적은 비용으로 높은 처리량의 유전체 데이터를 얻을 수 있는 기술이다. 차세대 염기서열분석 기술이 상용화된 2007년 이후 현재까지 지속적인 기술개량으로 발전하였으며 유전체, 전사체, 그리고 후성유전체 분석과 같은 다양한 의생명과학분야에 적용되고 있다.Next-Generation Sequencing (NGS) is a technology that can simultaneously perform sequencing of multiple and large amounts of extracted genetic material and obtain high throughput genomic data at relatively low cost in a short time. Next-generation sequencing technology has been developed since 2007, when it was commercialized, and has been applied to various medical life sciences such as genome, transcript, and epigenetic analysis.

2003년 약 30억 개의 인간 전체 유전체 해독 및 해석이 완료된 인간 유전체 프로젝트에서 미국을 주도로 선진 6개국의 18개 기관이 참여하였고, 13년의 시간과 약 30억 달러의 비용이 사용되었다. 반면, 현재 차세대 염기서열분석법을 활용하면 개인 인간 전체 유전체 해독 및 해석이 약 1주일이라는 매우 짧은 소요시간과 기하급수적으로 감소된 비용으로 가능하게 되었다. 이는 차세대 염기서열분석의 발전을 통해 의생명과학 전분야에 응용되어 다양한 지적재산권이 생산되고 관련된 산업이 성장하는 큰 분기점이 되었다. 속도와 정확도의 향상으로 새로운 응용기술(예, 진단마커)과 원천기술이 개발되고 있는 시점이다.In 2003, 18 institutions in six advanced countries, led by the United States, participated in the Human Genome Project, which completed the process of deciphering and interpreting about 3 billion human genomes, spending 13 years of time and about $ 3 billion. On the other hand, current next-generation sequencing has enabled the entire human genome to be interpreted and interpreted with a very short turnaround time of about a week and exponentially reduced cost. This is a major turning point in the development of next-generation sequencing, which is applied to all fields of biomedical sciences to produce various intellectual property rights and to grow related industries. This is the time when new application technologies (eg diagnostic markers) and source technologies are being developed due to improved speed and accuracy.

차세대 염기서열해독 장비 중 HiSeq 염기서열해독 장비는 미국 Illumina사의 플랫폼으로 다양한 데이터생성 장비 종류들 중 보편적으로 사용되는 장비이다. Illumina사의 플랫폼은 전 세계 유전체 데이터 생산량의 70% 이상을 차지하고 있고 높은 재연성과 정확도를 보이고 있다. HiSeq은 Illumina사의 핵심기술인 Sequencing By Synthesis (SBS)와 Cluster generation 기술을 이용한 장비로 Flow Cell이라는 Adaptor oligo가 부착된 유리 Chip에 라이브러리를 혼성화 및 증폭 후 하나씩 합성되는 핵산 종류에 따른 형광을 한 개씩 측정함으로써 염기서열을 해독하는 원리이다.HiSeq sequencing equipment among the next generation sequencing equipment is a platform commonly used among various data generation equipments as a platform of Illumina Corporation of USA. Illumina's platform accounts for more than 70% of the world's genome data production and is highly reproducible and accurate. HiSeq is a device using Illumina's core technology such as Sequencing By Synthesis (SBS) and Cluster generation technology. By hybridizing and amplifying the library on glass chips with Adaptor oligo attached to the flow cell, the fluorescence is measured one by one according to the type of nucleic acid synthesized one by one. The principle is to decode the sequence.

현재 정확하고 대량을 요구하는 임상 및 연구 분야에서 사용되고 있고 다양한 염기서열을 해독할 수 있는 응용기법들이 있다. 특히 인간을 포함하는 대형동물의 전체 유전체, 전사체, 후성유전체, 진유전체 그리고 목표서열 증폭법을 이용한 특정 부위에 대한 집단연구에 특화된 플랫폼이다. 차세대 염기서열해독 시스템의 발달은 전체 유전체 분석에 막대한 영향을 주었으며 라이브러리 구축 방법이 개발됨에 따라 연구자가 원하는 표적영역에 초점을 맞추어 집단 염기서열 분석이 가능하여 특정 집단(예, 환자군)에서 유전학적 차이를 설명할 수 있는 좋은 기반이 된다.It is currently used in clinical and research fields that require accurate and high volume, and there are applications that can decode various sequences. In particular, it is a platform specialized for population studies on whole genomes, transcripts, epigenetics, genomes, and specific regions using target sequence amplification of large animals including humans. The development of the next generation sequencing system has had a huge impact on the whole genome analysis, and as the library construction method is developed, genetic sequencing can be performed by focusing on the target area desired by the researcher, thereby allowing genetic differences in a specific population (eg, patient group). It is a good basis to explain.

하지만, 인간 유전체의 약 44%를 차지하고 있으며 유전자 발현, 유전자 구조 변형 등을 야기하여 유전적 변이와 암과 같은 질병을 유발하는 중요한 인자로 알려진 이동성 유전인자(Transposable Element, TE) 동정에 특화된 목표서열 염기 분석법에 대한 연구는 미흡한 실정이다. 이동성 유전자는 삽입 메커니즘에 따라 레트로트랜스포손(Retrotransposon, Class I)과 DNA 트랜스포손(DNA transposon, Class II) 두 클래스로 분류되고 있다. 이중 레트로트랜스포손은 스스로 리보헥산(Ribo nucleic acid, RNA)을 전사하여 이를 매개하여 삽입되는 기작을 통해 유전체의 새로운 영역에 삽입함으로써 다양한 유전적 변이 및 다양성에 관여하고 있다고 알려져 있다.However, it occupies about 44% of the human genome and targets sequence bases for the identification of transposable elements (TEs), which are known to be important factors that cause genetic mutations and disease, such as genetic variation and cancer. The research on the analysis method is insufficient. Mobility genes are classified into two classes, retrotransposon (Class I) and DNA transposon (Class II), depending on the insertion mechanism. The retrotransposon is known to be involved in a variety of genetic variations and diversity by inserting into the new region of the genome through a mechanism that transcribes ribohexane (Ribo nucleic acid, RNA) by itself and mediates it.

그 중 Long Interspersed Element-1(LINE-1; L1) 인자는 인간 유전체의 약 17% 이상을 차지하는 가장 활동적인 이동성 유전인자이다. L1은 유전서열 양 측면인 5'과 3' 말단에 비번역영역(Untranslated region, UTR), RNA 결합 단백질(RNA binding protein), 엔도뉴클레아제(Endonuclease, EN) 그리고 역전사효소(Reverse Transcriptase, RT)를 암호화하는 2개의 판독 프레임(Open reading frame, ORF1 및 ORF2)으로 구성된 약 6 Kb (염기서열 6,000 base-pair)의 이동성 유전인자이다. 대부분의 L1은 긴 영장류 진화 역사 동안 인자 이내에 유전적 구조적 변이와 단일염기 다형성(single nucleotide polymorphism)의 축적에 의해 L1의 유전적 이동성을 상실한 것으로 알려져 있다. 하지만 최근 인간 유전체에 특이적으로 삽입된 몇몇의 L1HS(Human-specific L1)는 여전히 유전적 이동성의 능력을 가지고 있으며, 이 L1HS들이 인간의 암과 질병에 관련된 유전자 조절 및 구조적 변화에 다양한 영향을 끼친다고 보고되었다. 따라서 참조 유전체에 보고가 되지 않으며 인간 유전체에 새롭게 삽입되어 있는 L1HS의 유전적 부위를 동정하고 L1HS 삽입에 의한 유전적 변이 연구가 필요하다. 보고되지 않은 L1HS의 삽입을 추적할 수 있는 기술을 통하여 특정 집단에서 공통변이 연구에 이용한다면 정확도 높은 진단마커가 개발될 수 있을 것이다.Among them, the Long Interspersed Element-1 (LINE-1; L1) factor is the most active mobile gene, which accounts for about 17% or more of the human genome. L1 has untranslated region (UTR), RNA binding protein, endonuclease (EN) and reverse transcriptase (RT) at both 5 'and 3' ends of the genetic sequence. ) Is a mobile gene of about 6 Kb (nucleotide base 6,000 base-pair) consisting of two open reading frames (ORF1 and ORF2). Most of L1 has been known to lose L1's genetic mobility due to genetic structural variation and single nucleotide polymorphism accumulation within factors during long primate evolutionary history. However, some human-specific L1s (L1HSs) that have recently been specifically inserted into the human genome still have the ability of genetic mobility, and these L1HSs have various effects on gene regulation and structural changes related to human cancers and diseases. Reported. Therefore, it is necessary to identify the genetic region of L1HS that is not reported in the reference genome and newly inserted into the human genome and to study the genetic variation caused by L1HS insertion. A technique that can track the insertion of unreported L1HS could lead to the development of highly accurate diagnostic markers if used in studies of common variability in a particular population.

한국공개특허 제10-2018-0014283호 (2018.02.08 공개)Korean Patent Publication No. 10-2018-0014283 (2018.02.08 publication)

본 발명의 목적은 이동성 유전인자 LINE-1(Long Interspersed Element-1)을 표적하는 탐침자(probe)를 유효성분으로 포함하는 LINE-1 표적용 DNA 라이브러리(library) 제작용 조성물 또는 이를 포함하는 LINE-1 표적용 DNA 라이브러리 제작용 키트를 제공하는데 있다.An object of the present invention is a composition for producing a DNA library for LINE-1 comprising a probe targeting a mobile genetic factor LINE-1 (Long Interspersed Element-1) as an active ingredient or a LINE comprising the same -1 provides a kit for preparing a DNA library for targeting.

또한, 본 발명의 다른 목적은 이동성 유전인자 LINE-1(Long Interspersed Element-1)을 표적하는 탐침자(probe)를 이용한 LINE-1 표적용 DNA 라이브러리 제작 방법을 제공하는데 있다. In addition, another object of the present invention is to provide a method for producing a DNA library for LINE-1 using a probe targeting a mobile genetic factor LINE-1 (Long Interspersed Element-1).

상기 목적을 달성하기 위하여, 본 발명은 서열번호 3으로 표시되는 이동성 유전인자 LINE-1(Long Interspersed Element-1)을 표적하는 탐침자(probe)를 유효성분으로 포함하는 LINE-1 표적용 DNA 라이브러리(library) 제작용 조성물을 제공한다.In order to achieve the above object, the present invention provides a DNA library for LINE-1 targeting comprising a probe targeting a mobile genetic factor LINE-1 (Long Interspersed Element-1) represented by SEQ ID NO: 3 as an active ingredient. (library) Provide the composition for manufacture.

또한, 본 발명은 조성물을 포함하는 LINE-1 표적용 DNA 라이브러리 제작용 키트를 제공한다.The present invention also provides a kit for preparing a DNA library for LINE-1 target comprising the composition.

또한, 본 발명은 게노믹(genomic) DNA를 절편화하는 단계; 상기 절편화된 DNA를 어댑터 접합시켜 양 말단을 평활화(end repair)시키는 단계; 상기 평활화된 DNA와, 서열번호 3으로 표시되는 이동성 유전인자 LINE-1을 표적하는 탐침자(probe)를 혼성화시키는 단계; 상기 혼성화된 DNA를 연장화시키는 단계; 및 상기 연장화된 DNA 단편 양 말단의 어댑터 서열을 이용하여 PCR 증폭시키는 단계를 포함하는 LINE-1 표적용 DNA 라이브러리 제작 방법을 제공한다.In addition, the present invention comprises the steps of fragmenting genomic DNA; Adapter conjugation of the fragmented DNA to end repair both ends; Hybridizing the smoothed DNA with a probe targeting a mobile genetic factor LINE-1 represented by SEQ ID NO: 3; Extending the hybridized DNA; And PCR amplification using an adapter sequence at both ends of the extended DNA fragment.

본 발명은 이동성 유전인자 LINE-1(L1HS) 선택적 발굴을 위한 HiSeq 시퀀서 기반의 DNA 라이브러리 제작 방법에 관한 것으로서, 이동성 유전인자의 임상 및 학술적 가치와 차세대 염기서열해독 기술의 발달 그리고 비용의 감소 및 분석 시스템 발전을 기반으로 인간의 특이적인 L1HS를 동정할 수 있는 L1HS 표적 염기서열 분석 방법을 개발함으로써 간단하고 빠르게 L1HS에 의한 개개인의 유전적 변이와 그에 따른 유전적 영향 연구에 한 방법이 될 수 있다. 또한, 본 발명을 바탕으로 L1HS를 포함한 인간 유전체 내 이동성을 보이고 유전적 변이를 일으킬 수 있는 활동적인 이동성 유전인자만 표적화하는 추가 기술 개발이 가능하다. 이동성 유전인자 표적화 염기서열 분석뿐만 아니라 표적화 서열 데이터 분석 방법이 단순화 보편화됨으로써 임상의학적 진단마커개발에 이용될 수 있을 것이라 기대할 수 있다.The present invention relates to a method for fabricating HiSeq sequencer-based DNA library for the selective discovery of the mobile gene, LINE-1 (L1HS). The clinical and academic value of mobile genes, the development of next-generation sequencing technology, and the reduction and analysis of cost By developing L1HS target sequencing method that can identify human specific L1HS based on system development, it can be a method for studying genetic variation of L1HS and individual genetic effects accordingly. In addition, it is possible to develop additional techniques based on the present invention that target only active mobile genes that show mobility in the human genome, including L1HS and can cause genetic mutations. As well as the mobilization gene targeting sequencing analysis as well as the targeting sequence data analysis method can be expected to be used in the development of clinical diagnostic markers.

도 1은 본 발명의 일 실시예에 따른 차세대 염기서열 해독 및 해석을 위한 유전물질 가공부터 L1HS 표적화 서열 데이터 분석 방법까지의 연구 절차를 나타낸다.
도 2는 본 발명의 일 실시예에 따른 차세대 염기서열분석을 위한 L1HS 표적 라이브러리 구축 과정을 나타낸다.
도 3은 본 발명의 일 실시예에 따른 차세대 염기서열해독 데이터의 교정/가공 및 생명정보학적 분석 과정을 나타낸다.
1 illustrates a research procedure from genetic material processing for analyzing next-generation sequencing and interpretation to L1HS targeting sequence data analysis method according to an embodiment of the present invention.
Figure 2 shows the construction of the L1HS target library for the next generation sequencing according to an embodiment of the present invention.
Figure 3 shows the calibration / processing and bioinformatics analysis of the next generation sequencing data according to an embodiment of the present invention.

본 발명은 서열번호 3으로 표시되는 이동성 유전인자 LINE-1(Long Interspersed Element-1)을 표적하는 탐침자(probe)를 유효성분으로 포함하는 LINE-1 표적용 DNA 라이브러리(library) 제작용 조성물을 제공한다. The present invention provides a composition for preparing a DNA library for LINE-1 targeting comprising a probe targeting a mobile genetic factor LINE-1 (Long Interspersed Element-1) represented by SEQ ID NO: 3 as an active ingredient. to provide.

바람직하게는, 상기 LINE-1은 L1HS(Homo sapiens-specific LINE-1)일 수 있다.Preferably, the LINE-1 may be Homo sapiens-specific LINE-1 (L1HS).

바람직하게는, 상기 DNA 라이브러리는 차세대 염기서열해독(Next generation sequencing, NGS) 분석을 위한 것이고, 보다 바람직하게는, 상기 NGS 분석은 일루미나(Illumina) 플랫폼 HiSeq 시퀀서를 이용하는 것일 수 있으나, 이에 제한되는 것은 아니다.Preferably, the DNA library is for the next generation sequencing (NGS) analysis, more preferably, the NGS analysis may be to use the Illumina platform HiSeq sequencer, but is not limited thereto. no.

또한, 본 발명은 상기 조성물을 포함하는 LINE-1 표적용 DNA 라이브러리 제작용 키트를 제공한다.The present invention also provides a kit for preparing a LINE-1 target DNA library comprising the composition.

한편, 상기 키트는 LINE-1 표적용 DNA 라이브러리 제작에 일반적으로 사용되는 다른 기구, 용액 등을 추가로 포함할 수 있으나, 이에 제한되지 않는다.On the other hand, the kit may further include, but is not limited to, other instruments, solutions, and the like, which are generally used to prepare a DNA library for LINE-1 targets.

또한, 본 발명은 게노믹(genomic) DNA를 절편화하는 단계; 상기 절편화된 DNA를 어댑터 접합시켜 양 말단을 평활화(end repair)시키는 단계; 상기 평활화된 DNA와, 서열번호 3으로 표시되는 이동성 유전인자 LINE-1을 표적하는 탐침자(probe)를 혼성화시키는 단계; 상기 혼성화된 DNA를 연장화시키는 단계; 및 상기 연장화된 DNA 단편 양 말단의 어댑터 서열을 이용하여 PCR 증폭시키는 단계를 포함하는 LINE-1 표적용 DNA 라이브러리 제작 방법을 제공한다.In addition, the present invention comprises the steps of fragmenting genomic DNA; Adapter conjugation of the fragmented DNA to end repair both ends; Hybridizing the smoothed DNA with a probe targeting a mobile genetic factor LINE-1 represented by SEQ ID NO: 3; Extending the hybridized DNA; And PCR amplification using an adapter sequence at both ends of the extended DNA fragment.

바람직하게는, 상기 LINE-1은 L1HS(Homo sapiens-specific LINE-1)일 수 있다.Preferably, the LINE-1 may be Homo sapiens-specific LINE-1 (L1HS).

바람직하게는, 상기 DNA 라이브러리는 차세대 염기서열해독(Next generation sequencing, NGS) 분석을 위한 것이고, 보다 바람직하게는, 상기 NGS 분석은 일루미나(Illumina) 플랫폼 HiSeq 시퀀서를 이용하는 것일 수 있으나, 이에 제한되는 것은 아니다.Preferably, the DNA library is for the next generation sequencing (NGS) analysis, more preferably, the NGS analysis may be to use the Illumina platform HiSeq sequencer, but is not limited thereto. no.

본 발명에서 사용한 서열번호 3으로 표시되는 이동성 유전인자 LINE-1을 표적하는 탐침자(probe)는 서열번호 1로 표시되는 Illumina HiSeq system-based NuGen adaptor sequence(P7 어댑터 서열)과, 서열번호 2로 표시되는 L1HS-표적 서열로 이루어져 있다.A probe targeting the mobile gene factor LINE-1 represented by SEQ ID NO: 3 used in the present invention is an Illumina HiSeq system-based NuGen adapter sequence (P7 adapter sequence) represented by SEQ ID NO: 1 and SEQ ID NO: 2 Consisting of the indicated L1HS-target sequences.

본 발명의 LINE-1 표적용 DNA 라이브러리는 일루미나(Illumina) 플랫폼 장비인 HiSeq 시퀀서에 적용될 수 있으며, HiSeq에 사용되는 어댑터 서열은 P5 어댑터 서열와 P7 어댑터 서열 두 가지로 나누어지는데, P5와 P7 어댑터 서열은 방향성에 따라서 나뉜다. 보통 P7 어댑터가 주형가닥으로 부착되었을 때 첫 번째 염기분석을 시작하는 위치의 어댑터이고 P5 어댑터는 주형가닥 전환을 통해 상보적인 반대편 서열을 읽기 시작할 수 있는 어댑터이다. 이 두 어댑터는 모두 HiSeq 장비에 사용되는 플로우셀(Flow Cell) 표면에 심어져 있는 염기서열과 상보적이므로 플로우셀 내에서 혼성화 하여 증폭함으로써 라이브러리가 플로우셀에 가득차게 된다. P5 어댑터 서열과 P7 어댑터 서열은 상업적으로 공개된 서열을 사용할 수 있다.The DNA library for LINE-1 targeting of the present invention can be applied to the HiSeq sequencer, which is an Illumina platform, and the adapter sequence used for the HiSeq is divided into two P5 adapter sequences and a P7 adapter sequence. It is divided according to directionality. Usually, when the P7 adapter is attached to the template strand, it is the adapter that starts the first nucleotide analysis and the P5 adapter is the adapter that can start reading complementary opposite sequences through template strand conversion. Both of these adapters are complementary to the nucleotide sequences planted on the surface of the flow cell used in the HiSeq equipment, so that the library is filled with the flow cell by hybridizing and amplifying in the flow cell. The P5 adapter sequence and the P7 adapter sequence can use commercially published sequences.

이하에서는, 본 발명을 한정하지 않는 실시예에 따라 본 발명을 상세히 설명한다. 본 발명의 하기 실시예는 본 발명을 구체화하기 위한 것일 뿐 본 발명의 권리범위를 제한하거나 한정하는 것이 아님은 물론이다. 따라서, 본 발명의 상세한 설명 및 실시예로부터 본 발명이 속하는 기술분야의 전문가가 용이하게 유추할 수 있는 것은 본 발명의 권리범위에 속하는 것으로 해석된다. Hereinafter, the present invention will be described in detail according to embodiments which do not limit the present invention. The following examples of the present invention are not intended to limit or limit the scope of the present invention only to embody the present invention. Therefore, what can be easily inferred by the expert in the technical field to which this invention belongs from the detailed description and the Example of this invention is interpreted as belonging to the scope of the present invention.

<< 실시예Example > >

본 발명은 인간 유전체에 특이적으로 존재한다고 알려진 L1HS를 표적하는 탐침자(Probe)를 제작하여 개인 유전체 내에 개별적으로 가지고 있는 이동성 유전인자 L1HS에 의한 구조적 변이를 동정하는 것이다. 이는 특정 집단연구를 통하여 정확도 높은 진단마커를 개발할 수 있다.The present invention is to construct a probe (Probe) that targets L1HS known to be specifically present in the human genome to identify structural variation by the mobile gene L1HS that has in the individual genome individually. This can develop accurate diagnostic markers through specific group studies.

- 단계 1 -Step 1

이동성 유전인자 L1HS의 염기서열을 인간 참조 유전체 데이터베이스인 UCSC genome 데이터베이스로부터 모두 검출한 뒤 다른 아종(Subfamily)의 L1들과 다중염기서열정렬법을 통하여 L1HS에 특이적으로 가지고 있는 염기 서열 부위를 확인하여 목표 서열 탐침자를 제작할 위치를 선정하였다.The nucleotide sequence of the mobile gene L1HS was detected from the UCSC genome database, which is a human reference genome database, and then the base sequence sites specific to L1HS were identified through multiple nucleotide sequence alignment with L1s of other subfamily. The location for constructing the sequence probe was selected.

L1HS 표적 탐침자는 L1HS 인자의 3' 비번역영역에 위치한 서열을 포함하며 HiSeq (Illumina사 플랫폼 장비) 차세대 염기서열해독 장비에 적용할 수 있는 해독 어댑터 서열, 본 2가지 서열로 구성하였다. The L1HS target probe comprises a sequence located in the 3 'untranslated region of the L1HS factor and consists of these two sequences, a translation adapter sequence that can be applied to HiSeq (Illumina platform equipment) next generation sequencing equipment.

본 발명의 실시예에 따른 이동성 유전인자인 L1HS 표적 염기서열을 축적하기 위해 제작된 탐침자(Probe)의 표적서열은 표 1에 나타냈다.The target sequence of the probe prepared for accumulating the L1HS target sequence, which is a mobile genetic factor according to an embodiment of the present invention, is shown in Table 1.

UsageUsage 염기서열 (5'-Sequence-3')Sequence (5'-Sequence-3 ') Illumina HiSeq system-based NuGen
adaptor sequence
Illumina HiSeq system-based NuGen
adapter sequence
5'-CAAGCAGAAGACGGCATACGAGATGGAGTTCAGACGTGTGCTCTTCCGATCT
GCAAGGATCGCTCTC-3' (서열번호 1)
5'-CAAGCAGAAGACGGCATACGAGATGGAGTTCAGACGTGTGCTCTTCCGATCT
GCAAGGATCGCTCTC-3 '(SEQ ID NO: 1)
L1HS-targeted sequenceL1HS-targeted sequence 5'-AGGGATAGCATTGGGAGATATACCTAATGCTAGATGACAC-3'
(서열번호 2)
5'-AGGGATAGCATTGGGAGATATACCTAATGCTAGATGACAC-3 '
(SEQ ID NO: 2)
제작된 L1HS 표적 탐침자 염기서열
(L1HS-targeted Probe)
Constructed L1HS Target Probe Sequence
(L1HS-targeted Probe)
5'-CAAGCAGAAGACGGCATACGAGATGGAGTTCAGACGTGTGCTCTTCCGATCT
GCAAGGATCGCTCTC
AGGGATAGCATTGGGAGATATACCTAATGCTAGATGACAC-3'
(서열번호 3)
5'-CAAGCAGAAGACGGCATACGAGATGGAGTTCAGACGTGTGCTCTTCCGATCT
GCAAGGATCGCTCTC
AGGGATAGCATTGGGAGATATACCTAATGCTAGATGACAC-3 '
(SEQ ID NO: 3)

- 단계 2 -Step 2

차세대 염기서열해독에 적합한 형태로 유전물질을 절편화 하기 위해 초음파 DNA Sonication 시스템을 사용하여 약 550 bp 크기로 절단한다. HiSeq 염기서열 해독장치에 사용할 수 있는 어댑터를 접합하기 위해 점착성 말단(Sticky end)형태의 단편화된 유전물질을 End Repair 과정을 통해 평활 말단(Blunt end) 형태로 복원해 준다(25℃ (30 분) 1 사이클 그리고 70℃ (10 분)). HiSeq에 사용되는 어댑터 서열은 P5 어댑터 서열와 P7 어댑터 서열 두 가지로 나누어지는데, P5와 P7 어댑터 서열은 방향성에 따라서 나뉜다. 보통 P7 어댑터가 주형가닥으로 부착되었을 때 첫 번째 염기분석을 시작하는 위치의 어댑터이고 P5 어댑터는 주형가닥 전환을 통해 상보적인 반대편 서열을 읽기 시작할 수 있는 어댑터이다. 이 두 어댑터는 모두 HiSeq 장비에 사용되는 플로우셀(Flow Cell) 표면에 심어져 있는 염기서열과 상보적이므로 플로우셀 내에서 혼성화 하여 증폭함으로써 라이브러리가 플로우셀에 가득차게 된다. 차세대 염기서열해독 장비인 HiSeq을 사용하기 위해 어댑터 서열을 절편화된 유전물질 양 말단에 접합한다(25℃ (30 분) 1 사이클 그리고 70℃ (10 분)).In order to fragment the genetic material into a form suitable for next-generation sequencing, it is cut to about 550 bp using an ultrasonic DNA sonication system. In order to bond the adapter which can be used for HiSeq sequencing device, the fragmented genetic material in the sticky end form is restored to the blunt end form through the end repair process (25 ° C (30 minutes)). 1 cycle and 70 ° C. (10 min)). The adapter sequence used for HiSeq is divided into P5 adapter sequence and P7 adapter sequence. P5 and P7 adapter sequences are divided according to orientation. Usually, when the P7 adapter is attached to the template strand, it is the adapter that starts the first nucleotide analysis and the P5 adapter is the adapter that can start reading complementary opposite sequences through template strand conversion. Both of these adapters are complementary to the nucleotide sequences planted on the surface of the flow cell used in the HiSeq equipment, so that the library is filled with the flow cell by hybridizing and amplifying in the flow cell. Adapter sequences are conjugated to both ends of the fragmented genetic material (25 ° C. (30 minutes) 1 cycle and 70 ° C. (10 minutes)) to use HiSeq, the next generation sequencing instrument.

- 단계 3 - Step 3

P5 어댑터 서열을 절편화된 유전물질 양 말단에 붙이는 과정 이후 L1HS 표적 탐침자 서열(Illumina P7 어댑터 서열과 함께 구성됨)을 사용해 유전물질 단편 안에 존재하는 L1HS 서열과 유전물질간 혼성화(DNA hybridization) 과정을 거쳐 두 서열을 붙여준다. 이 과정은 P5 어댑터가 접합된 유전물질 절편 500ng과 L1HS 표적 탐침자 100 pM을 사용하여 중합효소 연쇄반응(PCR, Polymerase chain reaction) 기기에서 95℃(5 분) 1사이클, 80℃(10 초, 매 사이클 -0.1℃ 차감) 200 사이클, 60℃(16 시간) 동안 유전물질간 혼성화 반응을 진행한다.After attaching the P5 adapter sequence to both ends of the fragmented genetic material, the L1HS target probe sequence (consisting with the Illumina P7 adapter sequence) is used to perform DNA hybridization between the L1HS sequence and the genetic material present in the genetic fragment. Paste the two sequences. This process was performed using 500 ng fragments of P5 adapter conjugated and 100 pM of L1HS target probe, 1 cycle of 95 ° C. (5 minutes) in a polymerase chain reaction (PCR) instrument, 80 ° C. (10 seconds, Every cycle -0.1 ℃ subtraction) The hybridization between dielectric materials is carried out for 200 cycles and 60 ℃ (16 hours).

- 단계 4 -Step 4

유전물질 혼성화 반응이 끝난 후 혼성화된 유전물질 단편들을 연장화 작업(72℃ (10분)) 이후 중합효소 연쇄반응(Polymerase Chain Reaction, PCR)을 통해 증폭한다. 이 과정에서 P5와 P7 어댑터에 상응하는 프라이머를 사용하여 중합효소 연쇄반응을 진행한다. 탐침자가 표적하는 L1HS를 포함하는 유전물질 절편서열이 접합되어있는 경우에만 선택적으로 증폭반응이 일어나게 된다(37℃ (10분), 95℃(3 분) 1 사이클, [95℃(30 초), 62℃(15 초), 72℃(20 초) 총 15 사이클], 72℃(3 분) 1 사이클, 그리고 4℃ (보관)). Illumina사 P5와 P7 프라이머를 이용하여 증폭된 유전물질 절편 시료를 라이브러리라고 하며, 이 라이브러리를 사용해 차세대 염기서열해독을 진행한다.After the hybridization of the genetic material, the hybridized fragments of the genetic material are amplified by a polymerase chain reaction (PCR) after the extension operation (72 ° C. (10 minutes)). In this process, polymerase chain reaction is performed using primers corresponding to P5 and P7 adapters. Selective amplification reactions occur only when the probe is conjugated to a genetic material sequence containing the targeted L1HS (37 ° C (10 minutes), 95 ° C (3 minutes), 1 cycle, [95 ° C (30 seconds), 15 cycles of 62 ° C. (15 seconds), 72 ° C. (20 seconds)], 1 cycle of 72 ° C. (3 minutes), and 4 ° C. (storage)). A sample of genetic material amplified using Illumina P5 and P7 primers is called a library, and the library is used to perform next-generation sequencing.

본 발명의 실시예에 따른 L1HS 표적 염기서열해독을 위한 라이브러리 구축을 위한 실험적 단계에 적용된 유전물질 절편화 준비 및 표적서열 증폭조건은 표 2에 나타냈다.Genetic material fragmentation preparation and target sequence amplification conditions applied to an experimental step for constructing a library for L1HS target sequencing according to an embodiment of the present invention are shown in Table 2.

DNA Fragmentation(Covaris S2 system (Covaris, Woburn, MA, USA))DNA Fragmentation (Covaris S2 system (Covaris, Woburn, MA, USA)) UltrasonicationUltrasonication Duty cycleDuty cycle 10%10% IntensityIntensity 22 Cycles per BurstCycles per burst 200200 Duration (seconds)Duration (seconds) 4545 Water bath temperatureWater bath temperature 4℃4 ℃ DNA end repair (PCR and End Repair Master Mix (NuGen, San Carlos, USA))DNA end repair (PCR and End Repair Master Mix (NuGen, San Carlos, USA)) End repairEnd repair 25℃25 ℃ 30 minutes30 minutes Enzyme deactivationEnzyme deactivation 70℃70 ℃ 10 minutes10 minutes Adaptor ligation (PCR and Ligation Master Mix (NuGen, San Carlos, USA))Adaptor ligation (PCR and Ligation Master Mix (NuGen, San Carlos, USA)) Adaptor ligationAdapter ligation 25℃25 ℃ 30 minutes30 minutes Enzyme deactivationEnzyme deactivation 70℃70 ℃ 10 minutes10 minutes L1HS-targeted probe hybridization (PCR)L1HS-targeted probe hybridization (PCR) DenaturationDenaturation 95℃95 5 minutes5 minutes Probe hybridizationProbe hybridization 80℃ (-0.1℃) 200 cycle80 ℃ (-0.1 ℃) 200 cycle 10 seconds in each cycle10 seconds in each cycle 60℃60 ℃ 16 hours16 hours Library amplification (PCR and Target Enrichment Mix (NuGen, San Carlos, USA))Library amplification (PCR and Target Enrichment Mix (NuGen, San Carlos, USA)) InitializationInitialization 37℃37 ℃ 10 minutes10 minutes Pre-denaturationPre-denaturation 95℃95 3 minutes3 minutes DenaturationDenaturation 95℃95 ℃ 30 seconds30 seconds 15 cycles15 cycles AnnealingAnnealing 62℃62 ℃ 15 seconds15 seconds ExtensionExtension 72℃72 ℃ 20 seconds20 seconds Final extensionFinal extension 72℃72 3 min3 min StorageStorage 4℃4 ℃ HoldHold

- 단계 5 -Step 5

L1HS 표적서열이 농축된 라이브러리를 플로우셀에서 증폭시키고 HiSeq 장비를 이용하여 염기서열해독을 진행한다. 시퀀싱 프라이머는 개시영역에 붙어서 표적서열의 반대쪽 말단부터 한 염기서열씩 합성해 나가간다. 이때, 각 A, T, G, C 염기서열은 고유의 파장을 갖는 올리고 뉴클레오타이드(Oligo Nucleotide)로 합성되어 Sequencing By Synthesis 방법으로 진행된다. 각 파장은 HiSeq 내부에 존재하는 검출카메라를 이용하여 파장을 측정하여 염기서열해독을 결정한다.L1HS target sequence enriched library is amplified in a flow cell and sequence analysis is performed using HiSeq equipment. The sequencing primer is attached to the starting region and synthesized by one base sequence from the opposite end of the target sequence. At this time, each A, T, G, C base sequence is synthesized by oligo nucleotides (Oligo Nucleotide) having a unique wavelength and proceeds by the Sequencing By Synthesis method. Each wavelength is determined by measuring the wavelength by using a detection camera inside the HiSeq to determine the sequence reading.

- 단계 6 -Step 6

차세대 염기서열해독이 종료된 후 염기서열을 결정해주고 bcl파일로 CASAVA라는 2차 분석 장비로 넘겨준다. 이때 Demultiplexing이라는 작업을 통해 각 샘플 별로 분류가 가능하며 fastq 파일을 생성해주며 Illumina에서 정의된 quality filters를 통해 Raw 데이터를 생성한다. Illumina 어댑터는 L1HS표적 서열이 아니기 때문에 cutadapt 1.1 version (https :// cutadapt . readthedocs .io/en/stable) 생명정보학 분석 도구를 이용하여 제거한다. L1HS 표적 탐침자 서열을 제거한 게놈서열(genomic sequence)을 Bowtie (http://bowtie-bio.sourceforge.net) aligner 프로그램을 이용하여 인간 참조 유전체 서열에 맵핑(Mapping)을 진행하여 유사한 유전체 서열 영역에 정렬하는 단계를 진행한다. 정렬된 유전체 서열 내에 유의한 맵핑 정도를 보이는 표적 영역을 표시하기 위해 개발된 HOMER와 MACS2 두 개의 서로 다른 프로그램을 이용하여 공통적으로 검출한 표적 영역을 L1HS 삽입영역으로 선별한다. After completion of next-generation sequencing, the nucleotide sequence is determined and transferred to a secondary analysis device called CASAVA as a bcl file. At this time, it can be classified by each sample through a task called Demultiplexing, it creates a fastq file, and creates raw data through quality filters defined in Illumina. It is removed using: (// cutadapt readthedocs .io / en / stable https.) Bioinformatics analysis tools Illumina adapter L1HS target because it is not a sequence cutadapt version 1.1. The genomic sequence from which the L1HS target probe sequence has been removed is mapped to a human reference genome sequence using a Bowtie (http://bowtie-bio.sourceforge.net) aligner program to a similar genomic sequence region. Proceed with the alignment. Commonly detected target regions were selected as L1HS insertion regions using two different programs, HOMER and MACS2, developed to indicate target regions with significant mapping within the aligned genomic sequence.

이 발명을 통해 개인 유전체 내 새롭게 삽입된 인간에 특이적인 L1HS 유전인자 영역을 쉽고 빠르게 스크리닝 가능하며, 저렴한 가격으로 개인 유전체 내 L1HS에 의한 유전학적 변이를 확인할 수 있다. 자동화 분석 방법을 이용해 임상의학 및 기초과학 연구자가 손쉽게 분석이 가능하며 L1HS 유전인자에 국한된 변이 분석이 아닌 다른 목적 인자를 위한 탐침자 제작에 다양하게 이용 가능하다.Through this invention, it is possible to easily and quickly screen the human-specific L1HS gene factor region newly inserted in the personal genome, and to identify genetic variation caused by L1HS in the personal genome at a low price. Automated analytical methods make it easy for clinicians and basic science researchers to analyze, and can be used to create probes for other target factors other than mutation analysis limited to the L1HS gene.

<110> Dankook University Cheonan Campus Industry Academic Cooperation Foundation <120> Method for preparing DNA library for LINE-1(L1HS) targeted-probe enrichment using HiSeq sequencer <130> ADP-2018-0075 <160> 3 <170> KopatentIn 2.0 <210> 1 <211> 67 <212> DNA <213> Artificial Sequence <220> <223> Illumina HiSeq system-based NuGen adaptor sequence <400> 1 caagcagaag acggcatacg agatggagtt cagacgtgtg ctcttccgat ctgcaaggat 60 cgctctc 67 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> L1HS-targeted sequence <400> 2 agggatagca ttgggagata tacctaatgc tagatgacac 40 <210> 3 <211> 107 <212> DNA <213> Artificial Sequence <220> <223> L1HS-targeted Probe <400> 3 caagcagaag acggcatacg agatggagtt cagacgtgtg ctcttccgat ctgcaaggat 60 cgctctcagg gatagcattg ggagatatac ctaatgctag atgacac 107 <110> Dankook University Cheonan Campus Industry Academic Cooperation Foundation <120> Method for preparing DNA library for LINE-1 (L1HS) targeted-probe          enrichment using HiSeq sequencer <130> ADP-2018-0075 <160> 3 <170> KopatentIn 2.0 <210> 1 <211> 67 <212> DNA <213> Artificial Sequence <220> <223> Illumina HiSeq system-based NuGen adapter sequence <400> 1 caagcagaag acggcatacg agatggagtt cagacgtgtg ctcttccgat ctgcaaggat 60 cgctctc 67 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> L1HS-targeted sequence <400> 2 agggatagca ttgggagata tacctaatgc tagatgacac 40 <210> 3 <211> 107 <212> DNA <213> Artificial Sequence <220> <223> L1HS-targeted Probe <400> 3 caagcagaag acggcatacg agatggagtt cagacgtgtg ctcttccgat ctgcaaggat 60 cgctctcagg gatagcattg ggagatatac ctaatgctag atgacac 107

Claims (9)

서열번호 3으로 표시되는 이동성 유전인자 LINE-1(Long Interspersed Element-1)을 표적하는 탐침자(probe)를 유효성분으로 포함하며, 일루미나(Illumina) 플랫폼 HiSeq 시퀀서를 이용하여 차세대 염기서열 해독(Next generation sequencing, NGS) 분석하기 위한, LINE-1 표적용 DNA 라이브러리(library) 제작용 조성물. It contains a probe targeting the mobile genetic factor LINE-1 (Long Interspersed Element-1) represented by SEQ ID NO: 3 as an active ingredient, and next-generation sequencing using an Illumina platform HiSeq sequencer (Next) Generation sequencing (NGS) composition for the production of a DNA library for LINE-1 targeting. 제1항에 있어서, 상기 LINE-1은 L1HS(Homo sapiens-specific LINE-1)인 것을 특징으로 하는 LINE-1 표적용 DNA 라이브러리 제작용 조성물. The composition of claim 1, wherein the LINE-1 is Homo sapiens-specific LINE-1 (L1HS). 삭제delete 삭제delete 제1항 또는 제2항의 조성물을 포함하는 LINE-1 표적용 DNA 라이브러리 제작용 키트. A kit for preparing a DNA library for LINE-1 target comprising the composition of claim 1. 게노믹(genomic) DNA를 절편화하는 단계;
상기 절편화된 DNA를 어댑터 접합시켜 양 말단을 평활화(end repair)시키는 단계;
상기 평활화된 DNA와, 서열번호 3으로 표시되는 이동성 유전인자 LINE-1을 표적하는 탐침자(probe)를 혼성화시키는 단계;
상기 혼성화된 DNA를 연장화시키는 단계; 및
상기 연장화된 DNA 단편 양 말단의 어댑터 서열을 이용하여 PCR 증폭시키는 단계를 포함하며, 일루미나(Illumina) 플랫폼 HiSeq 시퀀서를 이용하여 NGS 분석하기 위한, LINE-1 표적용 DNA 라이브러리 제작 방법.
Fragmenting genomic DNA;
Adapter conjugation of the fragmented DNA to end repair both ends;
Hybridizing the smoothed DNA with a probe targeting a mobile genetic factor LINE-1 represented by SEQ ID NO: 3;
Extending the hybridized DNA; And
PCR amplification using the adapter sequence at both ends of the extended DNA fragment, NGS analysis using an Illumina platform HiSeq sequencer, LINE-1 target DNA library manufacturing method.
제6항에 있어서, 상기 LINE-1은 L1HS(Homo sapiens-specific LINE-1)인 것을 특징으로 하는 LINE-1 표적용 DNA 라이브러리 제작 방법.7. The method of claim 6, wherein the LINE-1 is a Homo sapiens-specific LINE-1 (L1HS). 삭제delete 삭제delete
KR1020180037207A 2018-03-30 2018-03-30 Method for preparing DNA library for LINE-1(L1HS) targeted-probe enrichment using HiSeq sequencer KR102024581B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020180037207A KR102024581B1 (en) 2018-03-30 2018-03-30 Method for preparing DNA library for LINE-1(L1HS) targeted-probe enrichment using HiSeq sequencer

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020180037207A KR102024581B1 (en) 2018-03-30 2018-03-30 Method for preparing DNA library for LINE-1(L1HS) targeted-probe enrichment using HiSeq sequencer

Publications (1)

Publication Number Publication Date
KR102024581B1 true KR102024581B1 (en) 2019-09-24

Family

ID=68068880

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020180037207A KR102024581B1 (en) 2018-03-30 2018-03-30 Method for preparing DNA library for LINE-1(L1HS) targeted-probe enrichment using HiSeq sequencer

Country Status (1)

Country Link
KR (1) KR102024581B1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180014283A (en) 2016-07-28 2018-02-08 국립암센터 Method for detecting LINE-1 global DNA methylation in Rat

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180014283A (en) 2016-07-28 2018-02-08 국립암센터 Method for detecting LINE-1 global DNA methylation in Rat

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
eLife, Vol.5, e13926. p.1-30 Philippe et al. [DOI: 10.7554/eLife.13926] (2016)* *
석사학위 논문, 단국대학교 대학원, 나노바이오의과학과, 분자의과학 전공, 손현우(2018.02)* *

Similar Documents

Publication Publication Date Title
US11795501B2 (en) Methods for next generation genome walking and related compositions and kits
ES2688458T5 (en) Varietal nucleic acid count for genomic copy number information
US20220316010A1 (en) Methods for copy number determination
EP3192869B1 (en) Isolated oligonucleotide and use thereof in nucleic acid sequencing
Sun et al. Principles and innovative technologies for decrypting noncoding RNAs: from discovery and functional prediction to clinical application
Linnarsson Recent advances in DNA sequencing methods–general principles of sample preparation
ES2873850T3 (en) Next Generation Sequencing Libraries
CN113166797A (en) Nuclease-based RNA depletion
Zhang et al. Molecular analysis of DNA in blastocoele fluid using next-generation sequencing
TWI564393B (en) Methods for full-length amplification of double-stranded linear nucleic acids of unknown sequences
CN109576346A (en) The construction method of high-throughput sequencing library and its application
CN109536579A (en) The construction method of single-stranded sequencing library and its application
WO2020219759A1 (en) Methods and compositions for enrichment of target nucleic acids
JP2020512405A (en) How to quickly build an amplicon library in one step
KR101820440B1 (en) Method for detection of target nucleic acids
KR20130094498A (en) Method for detecting target genes or their mutations using ligase reaction and nicking amplification reaction
KR102024581B1 (en) Method for preparing DNA library for LINE-1(L1HS) targeted-probe enrichment using HiSeq sequencer
KR102102107B1 (en) Method for preparing DNA library for SINE targeted-probe enrichment using HiSeq sequencer
KR102027310B1 (en) Method for preparing DNA library for LINE-1(L1HS) targeted-probe enrichment using Ion PGM sequencer
Kaczor-Urbanowicz Salivary Diagnostics
Devesa-Peiró et al. Molecular biology approaches utilized in preimplantation genetics: real-time PCR, microarrays, next-generation sequencing, karyomapping, and others
Amr et al. Targeted hybrid capture for inherited disease panels
EP4060053A1 (en) Highly sensitive methods for accurate parallel quantification of nucleic acids
US20210115435A1 (en) Error-proof nucleic acid library construction method
JP6810559B2 (en) Cyclic single-stranded nucleic acid, and its preparation method and usage method

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant