KR102024581B1 - Method for preparing DNA library for LINE-1(L1HS) targeted-probe enrichment using HiSeq sequencer - Google Patents

Abstract

The present invention relates to a method of preparing the DNA library for a transposable element LINE-1(L1HS)-targeted probe enrichment using HiSeq sequencer, and more specifically, has developed an L1HS-targeted sequencing method on the basis of clinical and academic significance of transposable elements, the development of next-generation sequencing technology, cost reduction, and the development of analysis system. The present invention may serve as a method for use in studies of genetic variations due to L1HS in individuals and the genetic influences according to the same. Furthermore, based on the present invention, it is possible to further develop a technique capable of targeting L1HS-containing active transposable elements alone which have the ability to mobilize in the human genome and create genetic mutations. The transposable element-targeted sequencing as well as the targeted analysis sequencing method, as they are becoming simplified and commonplace, can be expected to be useful in the development of diagnostic markers in clinical medicine.

Description

Method for preparing DNA library for LINE-1 (L1HS) targeted-probe enrichment using HiSeq sequencer}

The present invention relates to a method for preparing a HiSeq sequencer-based DNA library for the selective discovery of the mobile gene, LINE-1 (L1HS). The construction of the probe (Probe) for the selective identification of), and the construction of a bioinformatics analysis pipeline.

Next-Generation Sequencing (NGS) is a technology that can simultaneously perform sequencing of multiple and large amounts of extracted genetic material and obtain high throughput genomic data at relatively low cost in a short time. Next-generation sequencing technology has been developed since 2007, when it was commercialized, and has been applied to various medical life sciences such as genome, transcript, and epigenetic analysis.

In 2003, 18 institutions in six advanced countries, led by the United States, participated in the Human Genome Project, which completed the process of deciphering and interpreting about 3 billion human genomes, spending 13 years of time and about $ 3 billion. On the other hand, current next-generation sequencing has enabled the entire human genome to be interpreted and interpreted with a very short turnaround time of about a week and exponentially reduced cost. This is a major turning point in the development of next-generation sequencing, which is applied to all fields of biomedical sciences to produce various intellectual property rights and to grow related industries. This is the time when new application technologies (eg diagnostic markers) and source technologies are being developed due to improved speed and accuracy.

HiSeq sequencing equipment among the next generation sequencing equipment is a platform commonly used among various data generation equipments as a platform of Illumina Corporation of USA. Illumina's platform accounts for more than 70% of the world's genome data production and is highly reproducible and accurate. HiSeq is a device using Illumina's core technology such as Sequencing By Synthesis (SBS) and Cluster generation technology. By hybridizing and amplifying the library on glass chips with Adaptor oligo attached to the flow cell, the fluorescence is measured one by one according to the type of nucleic acid synthesized one by one. The principle is to decode the sequence.

It is currently used in clinical and research fields that require accurate and high volume, and there are applications that can decode various sequences. In particular, it is a platform specialized for population studies on whole genomes, transcripts, epigenetics, genomes, and specific regions using target sequence amplification of large animals including humans. The development of the next generation sequencing system has had a huge impact on the whole genome analysis, and as the library construction method is developed, genetic sequencing can be performed by focusing on the target area desired by the researcher, thereby allowing genetic differences in a specific population (eg, patient group). It is a good basis to explain.

However, it occupies about 44% of the human genome and targets sequence bases for the identification of transposable elements (TEs), which are known to be important factors that cause genetic mutations and disease, such as genetic variation and cancer. The research on the analysis method is insufficient. Mobility genes are classified into two classes, retrotransposon (Class I) and DNA transposon (Class II), depending on the insertion mechanism. The retrotransposon is known to be involved in a variety of genetic variations and diversity by inserting into the new region of the genome through a mechanism that transcribes ribohexane (Ribo nucleic acid, RNA) by itself and mediates it.

Among them, the Long Interspersed Element-1 (LINE-1; L1) factor is the most active mobile gene, which accounts for about 17% or more of the human genome. L1 has untranslated region (UTR), RNA binding protein, endonuclease (EN) and reverse transcriptase (RT) at both 5 'and 3' ends of the genetic sequence. ) Is a mobile gene of about 6 Kb (nucleotide base 6,000 base-pair) consisting of two open reading frames (ORF1 and ORF2). Most of L1 has been known to lose L1's genetic mobility due to genetic structural variation and single nucleotide polymorphism accumulation within factors during long primate evolutionary history. However, some human-specific L1s (L1HSs) that have recently been specifically inserted into the human genome still have the ability of genetic mobility, and these L1HSs have various effects on gene regulation and structural changes related to human cancers and diseases. Reported. Therefore, it is necessary to identify the genetic region of L1HS that is not reported in the reference genome and newly inserted into the human genome and to study the genetic variation caused by L1HS insertion. A technique that can track the insertion of unreported L1HS could lead to the development of highly accurate diagnostic markers if used in studies of common variability in a particular population.

Korean Patent Publication No. 10-2018-0014283 (2018.02.08 publication)

An object of the present invention is a composition for producing a DNA library for LINE-1 comprising a probe targeting a mobile genetic factor LINE-1 (Long Interspersed Element-1) as an active ingredient or a LINE comprising the same -1 provides a kit for preparing a DNA library for targeting.

In addition, another object of the present invention is to provide a method for producing a DNA library for LINE-1 using a probe targeting a mobile genetic factor LINE-1 (Long Interspersed Element-1).

In order to achieve the above object, the present invention provides a DNA library for LINE-1 targeting comprising a probe targeting a mobile genetic factor LINE-1 (Long Interspersed Element-1) represented by SEQ ID NO: 3 as an active ingredient. (library) Provide the composition for manufacture.

The present invention also provides a kit for preparing a DNA library for LINE-1 target comprising the composition.

In addition, the present invention comprises the steps of fragmenting genomic DNA; Adapter conjugation of the fragmented DNA to end repair both ends; Hybridizing the smoothed DNA with a probe targeting a mobile genetic factor LINE-1 represented by SEQ ID NO: 3; Extending the hybridized DNA; And PCR amplification using an adapter sequence at both ends of the extended DNA fragment.

The present invention relates to a method for fabricating HiSeq sequencer-based DNA library for the selective discovery of the mobile gene, LINE-1 (L1HS). The clinical and academic value of mobile genes, the development of next-generation sequencing technology, and the reduction and analysis of cost By developing L1HS target sequencing method that can identify human specific L1HS based on system development, it can be a method for studying genetic variation of L1HS and individual genetic effects accordingly. In addition, it is possible to develop additional techniques based on the present invention that target only active mobile genes that show mobility in the human genome, including L1HS and can cause genetic mutations. As well as the mobilization gene targeting sequencing analysis as well as the targeting sequence data analysis method can be expected to be used in the development of clinical diagnostic markers.

1 illustrates a research procedure from genetic material processing for analyzing next-generation sequencing and interpretation to L1HS targeting sequence data analysis method according to an embodiment of the present invention.
Figure 2 shows the construction of the L1HS target library for the next generation sequencing according to an embodiment of the present invention.
Figure 3 shows the calibration / processing and bioinformatics analysis of the next generation sequencing data according to an embodiment of the present invention.

The present invention provides a composition for preparing a DNA library for LINE-1 targeting comprising a probe targeting a mobile genetic factor LINE-1 (Long Interspersed Element-1) represented by SEQ ID NO: 3 as an active ingredient. to provide.

Preferably, the LINE-1 may be Homo sapiens-specific LINE-1 (L1HS).

Preferably, the DNA library is for the next generation sequencing (NGS) analysis, more preferably, the NGS analysis may be to use the Illumina platform HiSeq sequencer, but is not limited thereto. no.

The present invention also provides a kit for preparing a LINE-1 target DNA library comprising the composition.

On the other hand, the kit may further include, but is not limited to, other instruments, solutions, and the like, which are generally used to prepare a DNA library for LINE-1 targets.

In addition, the present invention comprises the steps of fragmenting genomic DNA; Adapter conjugation of the fragmented DNA to end repair both ends; Hybridizing the smoothed DNA with a probe targeting a mobile genetic factor LINE-1 represented by SEQ ID NO: 3; Extending the hybridized DNA; And PCR amplification using an adapter sequence at both ends of the extended DNA fragment.

Preferably, the LINE-1 may be Homo sapiens-specific LINE-1 (L1HS).

Preferably, the DNA library is for the next generation sequencing (NGS) analysis, more preferably, the NGS analysis may be to use the Illumina platform HiSeq sequencer, but is not limited thereto. no.

A probe targeting the mobile gene factor LINE-1 represented by SEQ ID NO: 3 used in the present invention is an Illumina HiSeq system-based NuGen adapter sequence (P7 adapter sequence) represented by SEQ ID NO: 1 and SEQ ID NO: 2 Consisting of the indicated L1HS-target sequences.

The DNA library for LINE-1 targeting of the present invention can be applied to the HiSeq sequencer, which is an Illumina platform, and the adapter sequence used for the HiSeq is divided into two P5 adapter sequences and a P7 adapter sequence. It is divided according to directionality. Usually, when the P7 adapter is attached to the template strand, it is the adapter that starts the first nucleotide analysis and the P5 adapter is the adapter that can start reading complementary opposite sequences through template strand conversion. Both of these adapters are complementary to the nucleotide sequences planted on the surface of the flow cell used in the HiSeq equipment, so that the library is filled with the flow cell by hybridizing and amplifying in the flow cell. The P5 adapter sequence and the P7 adapter sequence can use commercially published sequences.

Hereinafter, the present invention will be described in detail according to embodiments which do not limit the present invention. The following examples of the present invention are not intended to limit or limit the scope of the present invention only to embody the present invention. Therefore, what can be easily inferred by the expert in the technical field to which this invention belongs from the detailed description and the Example of this invention is interpreted as belonging to the scope of the present invention.

< Example >

The present invention is to construct a probe (Probe) that targets L1HS known to be specifically present in the human genome to identify structural variation by the mobile gene L1HS that has in the individual genome individually. This can develop accurate diagnostic markers through specific group studies.

Step 1

The nucleotide sequence of the mobile gene L1HS was detected from the UCSC genome database, which is a human reference genome database, and then the base sequence sites specific to L1HS were identified through multiple nucleotide sequence alignment with L1s of other subfamily. The location for constructing the sequence probe was selected.

The L1HS target probe comprises a sequence located in the 3 'untranslated region of the L1HS factor and consists of these two sequences, a translation adapter sequence that can be applied to HiSeq (Illumina platform equipment) next generation sequencing equipment.

The target sequence of the probe prepared for accumulating the L1HS target sequence, which is a mobile genetic factor according to an embodiment of the present invention, is shown in Table 1.

Usage Sequence (5'-Sequence-3 ') Illumina HiSeq system-based NuGen
adapter sequence 5'-CAAGCAGAAGACGGCATACGAGATGGAGTTCAGACGTGTGCTCTTCCGATCT
GCAAGGATCGCTCTC-3 '(SEQ ID NO: 1) L1HS-targeted sequence 5'-AGGGATAGCATTGGGAGATATACCTAATGCTAGATGACAC-3 '
(SEQ ID NO: 2) Constructed L1HS Target Probe Sequence
(L1HS-targeted Probe) 5'-CAAGCAGAAGACGGCATACGAGATGGAGTTCAGACGTGTGCTCTTCCGATCT
GCAAGGATCGCTCTC
AGGGATAGCATTGGGAGATATACCTAATGCTAGATGACAC-3 '
(SEQ ID NO: 3)

Step 2

In order to fragment the genetic material into a form suitable for next-generation sequencing, it is cut to about 550 bp using an ultrasonic DNA sonication system. In order to bond the adapter which can be used for HiSeq sequencing device, the fragmented genetic material in the sticky end form is restored to the blunt end form through the end repair process (25 ° C (30 minutes)). 1 cycle and 70 ° C. (10 min)). The adapter sequence used for HiSeq is divided into P5 adapter sequence and P7 adapter sequence. P5 and P7 adapter sequences are divided according to orientation. Usually, when the P7 adapter is attached to the template strand, it is the adapter that starts the first nucleotide analysis and the P5 adapter is the adapter that can start reading complementary opposite sequences through template strand conversion. Both of these adapters are complementary to the nucleotide sequences planted on the surface of the flow cell used in the HiSeq equipment, so that the library is filled with the flow cell by hybridizing and amplifying in the flow cell. Adapter sequences are conjugated to both ends of the fragmented genetic material (25 ° C. (30 minutes) 1 cycle and 70 ° C. (10 minutes)) to use HiSeq, the next generation sequencing instrument.

Step 3

After attaching the P5 adapter sequence to both ends of the fragmented genetic material, the L1HS target probe sequence (consisting with the Illumina P7 adapter sequence) is used to perform DNA hybridization between the L1HS sequence and the genetic material present in the genetic fragment. Paste the two sequences. This process was performed using 500 ng fragments of P5 adapter conjugated and 100 pM of L1HS target probe, 1 cycle of 95 ° C. (5 minutes) in a polymerase chain reaction (PCR) instrument, 80 ° C. (10 seconds, Every cycle -0.1 ℃ subtraction) The hybridization between dielectric materials is carried out for 200 cycles and 60 ℃ (16 hours).

Step 4

After the hybridization of the genetic material, the hybridized fragments of the genetic material are amplified by a polymerase chain reaction (PCR) after the extension operation (72 ° C. (10 minutes)). In this process, polymerase chain reaction is performed using primers corresponding to P5 and P7 adapters. Selective amplification reactions occur only when the probe is conjugated to a genetic material sequence containing the targeted L1HS (37 ° C (10 minutes), 95 ° C (3 minutes), 1 cycle, [95 ° C (30 seconds), 15 cycles of 62 ° C. (15 seconds), 72 ° C. (20 seconds)], 1 cycle of 72 ° C. (3 minutes), and 4 ° C. (storage)). A sample of genetic material amplified using Illumina P5 and P7 primers is called a library, and the library is used to perform next-generation sequencing.

Genetic material fragmentation preparation and target sequence amplification conditions applied to an experimental step for constructing a library for L1HS target sequencing according to an embodiment of the present invention are shown in Table 2.

DNA Fragmentation (Covaris S2 system (Covaris, Woburn, MA, USA)) Ultrasonication Duty cycle 10% Intensity 2 Cycles per burst 200 Duration (seconds) 45 Water bath temperature 4 ℃ DNA end repair (PCR and End Repair Master Mix (NuGen, San Carlos, USA)) End repair 25 ℃ 30 minutes Enzyme deactivation 70 ℃ 10 minutes Adaptor ligation (PCR and Ligation Master Mix (NuGen, San Carlos, USA)) Adapter ligation 25 ℃ 30 minutes Enzyme deactivation 70 ℃ 10 minutes L1HS-targeted probe hybridization (PCR) Denaturation 95 ℃ 5 minutes Probe hybridization 80 ℃ (-0.1 ℃) 200 cycle 10 seconds in each cycle 60 ℃ 16 hours Library amplification (PCR and Target Enrichment Mix (NuGen, San Carlos, USA)) Initialization 37 ℃ 10 minutes Pre-denaturation 95 ℃ 3 minutes Denaturation 95 ℃ 30 seconds 15 cycles Annealing 62 ℃ 15 seconds Extension 72 ℃ 20 seconds Final extension 72 ℃ 3 min Storage 4 ℃ Hold

Step 5

L1HS target sequence enriched library is amplified in a flow cell and sequence analysis is performed using HiSeq equipment. The sequencing primer is attached to the starting region and synthesized by one base sequence from the opposite end of the target sequence. At this time, each A, T, G, C base sequence is synthesized by oligo nucleotides (Oligo Nucleotide) having a unique wavelength and proceeds by the Sequencing By Synthesis method. Each wavelength is determined by measuring the wavelength by using a detection camera inside the HiSeq to determine the sequence reading.

Step 6

After completion of next-generation sequencing, the nucleotide sequence is determined and transferred to a secondary analysis device called CASAVA as a bcl file. At this time, it can be classified by each sample through a task called Demultiplexing, it creates a fastq file, and creates raw data through quality filters defined in Illumina. It is removed using: (// cutadapt readthedocs .io / en / stable https.) Bioinformatics analysis tools Illumina adapter L1HS target because it is not a sequence cutadapt version 1.1. The genomic sequence from which the L1HS target probe sequence has been removed is mapped to a human reference genome sequence using a Bowtie (http://bowtie-bio.sourceforge.net) aligner program to a similar genomic sequence region. Proceed with the alignment. Commonly detected target regions were selected as L1HS insertion regions using two different programs, HOMER and MACS2, developed to indicate target regions with significant mapping within the aligned genomic sequence.

Through this invention, it is possible to easily and quickly screen the human-specific L1HS gene factor region newly inserted in the personal genome, and to identify genetic variation caused by L1HS in the personal genome at a low price. Automated analytical methods make it easy for clinicians and basic science researchers to analyze, and can be used to create probes for other target factors other than mutation analysis limited to the L1HS gene.

<110> Dankook University Cheonan Campus Industry Academic Cooperation Foundation <120> Method for preparing DNA library for LINE-1 (L1HS) targeted-probe          enrichment using HiSeq sequencer <130> ADP-2018-0075 <160> 3 <170> KopatentIn 2.0 <210> 1 <211> 67 <212> DNA <213> Artificial Sequence <220> <223> Illumina HiSeq system-based NuGen adapter sequence <400> 1 caagcagaag acggcatacg agatggagtt cagacgtgtg ctcttccgat ctgcaaggat 60 cgctctc 67 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> L1HS-targeted sequence <400> 2 agggatagca ttgggagata tacctaatgc tagatgacac 40 <210> 3 <211> 107 <212> DNA <213> Artificial Sequence <220> <223> L1HS-targeted Probe <400> 3 caagcagaag acggcatacg agatggagtt cagacgtgtg ctcttccgat ctgcaaggat 60 cgctctcagg gatagcattg ggagatatac ctaatgctag atgacac 107

Claims (9)

It contains a probe targeting the mobile genetic factor LINE-1 (Long Interspersed Element-1) represented by SEQ ID NO: 3 as an active ingredient, and next-generation sequencing using an Illumina platform HiSeq sequencer (Next) Generation sequencing (NGS) composition for the production of a DNA library for LINE-1 targeting. The composition of claim 1, wherein the LINE-1 is Homo sapiens-specific LINE-1 (L1HS). delete delete A kit for preparing a DNA library for LINE-1 target comprising the composition of claim 1. Fragmenting genomic DNA;
Adapter conjugation of the fragmented DNA to end repair both ends;
Hybridizing the smoothed DNA with a probe targeting a mobile genetic factor LINE-1 represented by SEQ ID NO: 3;
Extending the hybridized DNA; And
PCR amplification using the adapter sequence at both ends of the extended DNA fragment, NGS analysis using an Illumina platform HiSeq sequencer, LINE-1 target DNA library manufacturing method. 7. The method of claim 6, wherein the LINE-1 is a Homo sapiens-specific LINE-1 (L1HS). delete delete

Images