KR20180014283A - Method for detecting LINE-1 global DNA methylation in Rat - Google Patents
Method for detecting LINE-1 global DNA methylation in Rat Download PDFInfo
- Publication number
- KR20180014283A KR20180014283A KR1020160096050A KR20160096050A KR20180014283A KR 20180014283 A KR20180014283 A KR 20180014283A KR 1020160096050 A KR1020160096050 A KR 1020160096050A KR 20160096050 A KR20160096050 A KR 20160096050A KR 20180014283 A KR20180014283 A KR 20180014283A
- Authority
- KR
- South Korea
- Prior art keywords
- methylation
- seq
- primer
- line
- sequence
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/142—Toxicological screening, e.g. expression profiles which identify toxicity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
본 발명은 랫트의 LINE-1에서 특이적 글로벌 DNA 메틸화 여부 검출 방법에 관한 것으로, 더욱 상세하게는, 랫트 특이적 LINE-1 글로벌 DNA 메틸화 여부를 검출하기 위한 특이적 프라이머 및 이를 이용한 메틸화 여부 검출 방법에 관한 것이다.BACKGROUND OF THE
인체와 생태계에서 내분비 교란을 일으키는 물질로 알려진 잔류성 유기 오염물질(Persistent Organic Pollutants, POPs)은 생활속에 이미 많이 노출되어 있으며, 미국 일리노이드 주립대학교 발표자료에 따르면 미국 임산부의 90%에서 검사대상 화학물질 163종 가운데 62종이 검출되어 있을 정도이다. Persistent Organic Pollutants (POPs), known as substances causing endocrine disruption in the human body and ecosystems, are already exposed to life, and according to a report by the Illinois State University in the United States, 90% 62 out of 163 species are detected.
후성유전학은 DNA의 염기서열이 변화하지 않는 상태에서 DNA 메틸화 등을 통해 유전자와 환경과의 상호작용에 관여를 하고, POPs는 비만의 감수성과 증가에 관여하는 후성학적 메커니즘에 영향을 미칠 수 있다. 대표적인 POPs 물질 중 하나인 폴리브롬화 디페닐 에테르(Polybrominated diphenyl ethers, PBDEs)는 난연제로서 전자 제품, 가구, 플라스틱, 섬유 등의 각종 제품에 전세계적으로 사용되고 있다. 이러한 PBDEs는 해저 7000m의 바닷속 생물에서도 오염되어 있을 정도이며, 인체 내 갑상선 호르몬 교란물질로서 작용하고 유방암과 관련이 높다고 알려져 있다. 유방암 관련 환경 위험요인으로 작용한다는 연구결과가 있다.Epigenetics is involved in the interaction of genes with the environment through DNA methylation and the like, while DNA sequences are unchanged. POPs can affect the postmenopausal mechanisms involved in the susceptibility and increase of obesity. One of the representative POPs materials, polybrominated diphenyl ethers (PBDEs), is a flame retardant used worldwide in various products such as electronic products, furniture, plastics, and textiles. These PBDEs are contaminated by underwater creatures of 7000 m below sea level, and act as thyroid hormone disturbances in the human body and are known to be associated with breast cancer. Research has shown that breast cancer is an environmental risk factor.
현재 사회적으로 문제되고 있는 항균 필터의 경우도 가습기 살균제에 사용된 살균 보존제와 같은 계열의 유해성분인 OIT(Octylisothiazolinone, 옥타이리소씨아콜론)이 사용되었는데, 환경부에서는 공기 중에서 검출된 OIT는 극히 미량이지만 지속해서 사용할 시에는 인체에 유해할 것으로 추정하였으며, 이러한 유해성을 추정하기 위해서는 허용치 이하에서의 독성 평가가 매우 중요하다.In the case of the antimicrobial filter, which is currently a problem in society, OIT (octylisothiazolinone, octaerosia colon), which is a harmful component of the same kind as the sterilizing preservative used in the humidifier sterilizing agent, was used. It is presumed that it is harmful to the human body when used. To estimate this hazard, it is very important to evaluate the toxicity below the tolerance.
이러한 상황 속에서, 암 진단을 위하여 Line-1이 마커로써 사용될 수 있다는 선행기술 (비특허문헌 1)은 존재하나, 미량의 환경 독성 물질의 영향 평가, 발암성여부의 특정 부위 검출 또는 그를 위한 프라이머 개발은 미미한 실정이다. In this situation, there is a prior art (Non-Patent Document 1) that Line-1 can be used as a marker for the diagnosis of cancer, but the evaluation of the effect of a trace amount of environmental toxins, the detection of a specific site of carcinogenicity, Development is minimal.
환경 오염 물질의 허용치 이하 미량 노출에 따른 영향 평가를 위해 또는 그 외에 암 진단 등의 활용을 위하여, 랫트 특이적인 반복염기서열인 Line-1 (Long Interspersed Nucleotide Elements-1)의 글로벌 메틸화 여부 검출을 위한 특정 부위 증폭 및 이를 위한 프라이머를 얻고, 본 발명을 완성하였다.To detect the global methylation status of Line-1 (Long Interspersed Nucleotide Elements-1), a rat-specific repetitive nucleotide sequence, for the assessment of the effects of exposure to subtle amounts of environmental pollutants or for other applications such as cancer diagnosis Specific site amplification and a primer for the amplification, thereby completing the present invention.
따라서, 본 발명의 목적은 시료로부터 서열번호 1로 표시되는 Line-1(Long Interspersed nuclear element-1)의 CpG 부위의 메틸화 여부를 측정하기 위한 방법을 제공하는데 있다.Accordingly, an object of the present invention is to provide a method for measuring methylation of a CpG region of Line-1 (Long Interspersed Nuclear Element-1) represented by SEQ ID NO: 1 from a sample.
본 발명의 다른 목적은, 상기 메틸화 여부 측정을 위한 서열번호 2 및 서열번호 3의 프라이머 셋트를 제공하는데 있다. It is another object of the present invention to provide a primer set of SEQ ID NO: 2 and SEQ ID NO: 3 for measuring methylation status.
본 발명의 또 다른 목적은, 서열번호 1로 표시되는 랫트 Rattus norvegicus의 genomic DNA 내에 위치한 LINE 1 특히, non-LRT retrotransposable element의 5'UTR +86 bp 에서 +272 bp까지의 염기서열 전부 또는 일부, 예컨대, 111번째 내지 247번째 위치의 서열에서의 메틸화된 시토신을 포함하는 단편을 증폭하기 위한 프라이머셋트를 함유하는 LINE-1 메틸화 여부 측정을 위한 키트를 제공하는데 있다. It is still another object of the present invention to provide a method for the detection of all or part of the nucleotide sequence from
본 발명의 또 다른 목적은, 서열번호 2 및 서열번호 3의 프라이머 셋트(쌍)를 포함하는 LINE-1 메틸화 여부 측정을 위한 조성물을 제공하는데 있다.It is still another object of the present invention to provide a composition for measuring whether or not LINE-1 methylation is contained, comprising the primer set (pair) of SEQ ID NO: 2 and SEQ ID NO:
본 발명의 또 다른 목적은, 암 진단 또는 예후에 필요한 정보를 제공하기 위하여, 시료로부터 서열번호 1로 표시되는 LINE-1(Long Interspersed nuclear element-1)의 CpG 부위의 메틸화 여부를 측정하는 방법을 제공하는데 있다. It is still another object of the present invention to provide a method for measuring methylation of a CpG region of LINE-1 (Long Interspersed Nuclear Element-1) represented by SEQ ID NO: 1 from a sample to provide information necessary for cancer diagnosis or prognosis .
본 발명의 또 다른 목적은, 환경 독성 물질이 대상에 노출되어 영향을 미치는지 여부를 확인하기 위하여, 시료로부터 서열번호 1로 표시되는 LINE-1(Long Interspersed nuclear element-1)의 CpG 부위의 메틸화 여부를 측정하는 방법을 제공하는데 있다. It is another object of the present invention to provide a method for determining whether methylation of the CpG region of LINE-1 (Long Interspersed Nuclear Element-1) represented by SEQ ID NO: 1 from a sample And a method for measuring the temperature.
상기와 같은 목적을 달성하기 위해, 본 발명은 시료로부터 서열번호 1로 표시되는 LINE-1(Long Interspersed nuclear element-1)의 CpG 부위의 메틸화 여부를 측정하기 위한 방법을 제공한다. In order to achieve the above object, the present invention provides a method for measuring methylation of a CpG region of LINE-1 (Long Interspersed Nuclear Element-1) represented by SEQ ID NO: 1 from a sample.
본 발명에 있어서, 상기 메틸화 여부는 PCR, 메틸화 특이 PCR(methylation specific PCR), 실시간 메틸화 특이 PCR(real time methylation specific PCR), 메틸화 DNA 특이적 결합 단백질을 이용한 PCR, 메틸화 민감성 제한 효소를 사용한 메틸화 여부 측정, 정량 PCR, DNA 칩, 파이로시퀀싱, 메틸화 특이- 고해상도 융해곡선 분석 (Methylation-Sensitive High-Resolution Melting Analysis; MS-HRM) 및 바이설파이트 시퀀싱으로 구성된 군에서 선택되는 것으로 검출하는 것을 특징으로 할 수 있다. In the present invention, the presence or absence of methylation may be determined by PCR, methylation specific PCR, real time methylation specific PCR, PCR using methylated DNA specific binding protein, methylation using methylation sensitive restriction enzyme (MS-HRM) and bisulfite sequencing, characterized in that the oligonucleotide is selected from the group consisting of DNA sequencing, quantitative PCR, DNA chip, pyrosequencing, methylation-specific high-resolution melting analysis can do.
본 발명에 있어서, 서열번호 2 및 서열번호 3의 프라이머 셋트(쌍)를 이용하여 증폭함으로써 LINE-1 메틸화 여부를 측정할 수 있다. In the present invention, whether or not LINE-1 methylation can be measured by amplification using the primer set (pair) of SEQ ID NO: 2 and SEQ ID NO: 3.
본 발명의 또 다른 목적은, 서열번호 1로 표시되는 랫트 Rattus norvegicus의 genomic DNA 내에 위치한 LINE 1 특히, non-LRT retrotransposable element의 5'UTR +86 bp 에서 +272 bp까지의 염기서열 전부 또는 일부 서열에서의 메틸화된 시토신을 포함하는 단편을 증폭하기 위한 프라이머셋트를 함유하는 LINE-1 메틸화 여부 측정을 위한 키트를 제공하는데 있다. Another object of the present invention is to provide a method for producing a recombinant vector comprising the nucleotide sequence of
본 발명의 또 다른 목적은, 서열번호 2의 정방향 프라이머 및 서열번호 3의 역방향 프라이머로 이루어진 LINE-1 메틸화 여부를 측정하기 위한 프라이머 셋트를 제공하는데 있다. It is still another object of the present invention to provide a primer set for measuring whether LINE-1 methylation is made of the forward primer of SEQ ID NO: 2 and the reverse primer of SEQ ID NO: 3.
본 발명의 또 다른 목적은, 서열번호 2의 정방향 프라이머 서열과 80 내지 100%의 서열동일성을 가지는 프라이머, 그리고 서열번호 3의 역방향 프라이머 서열과 80 내지 100%의 서열동일성을 가지는 프라이머를 포함하는 LINE-1 메틸화 여부 측정을 위한 조성물 및 상기 프라이머들을 포함하는 LINE-1 메틸화 여부 측정을 위한 키트를 제공하는데 있다. It is still another object of the present invention to provide a primer having a sequence identity of 80 to 100% with a forward primer sequence of SEQ ID NO: 2, and a primer having a sequence identity of 80 to 100% with the reverse primer sequence of SEQ ID NO: -1 methylation, and a kit for determining whether or not LINE-1 methylation is included in the kit, which comprises the primers.
본 발명의 또 다른 목적은, 암 진단 또는 예후에 필요한 정보를 제공하기 위하여, 시료로부터 서열번호 1로 표시되는 LINE-1(Long Interspersed nuclear element-1)의 CpG 부위의 메틸화 여부를 측정하는 방법을 제공하는데 있다. It is still another object of the present invention to provide a method for measuring methylation of a CpG region of LINE-1 (Long Interspersed Nuclear Element-1) represented by SEQ ID NO: 1 from a sample to provide information necessary for cancer diagnosis or prognosis .
본 발명의 또 다른 목적은, 환경 독성 물질이 대상에 영향을 미치는지 여부를 확인하기 위하여, 시료로부터 서열번호 1로 표시되는 LINE-1(Long Interspersed nuclear element-1)의 CpG 부위의 메틸화 여부를 측정하는 방법을 제공하는데 있다. A further object of the present invention is to determine whether the methylation of the CpG region of LINE-1 (Long Interspersed Nuclear Element-1) as shown in SEQ ID NO: 1 is detected from the sample to check whether the environmental toxic substance affects the subject And to provide a method for performing the method.
본 발명에 따른 방법을 통해 랫트를 대상으로 글로벌 DNA 메틸화 분석시 LINE-1 CpG 부위를 특이적으로 증폭함으로써, LINE-1을 바이오마커로 하여 고분자 수준에서의 환경오염물질의 동물 평가 실험, 암과 같이 LINE-1 메틸화를 진단 표지로 할 수 있는 각종 질환의 진단 또는 치료 모니터링, 예후 진단 등에 활용될 수 있다.By performing amplification of the LINE-1 CpG site specifically in the global DNA methylation analysis of rats through the method according to the present invention, it is possible to carry out an animal evaluation test of environmental pollutants at a polymer level using LINE-1 as a biomarker, Similarly, it can be used for diagnosis or treatment monitoring of various diseases that can make LINE-1 methylation a diagnostic marker, and for diagnosis of prognosis.
도 1은 MethPrimer를 이용한 랫트 LINE-1의 5’UTR 내에 10개의 CpG 부위를 나타낸 결과이다 (Criteria used: Island size > 100, GC Percent > 50.0, Obs/Exp > 0.6). 파란색 영역은 LINE-1 내에 GpG 섬(island)을 나타낸 것이다.
도 2는 서로 다른 메틸화율을 나타내는 표준 융해 곡선을 나타낸 결과이다. 메틸화된 DNA를 determination을 하기 위한 대표적인 표준 융해 곡선을 나타낸 것이다. 표준 시료들은 위에서부터 아래로 100%, 75%, 50%, 25%, 10%, 5% 및 0% 메틸화된 것이다.
도 3은 MS-HRM 실험 결과를 나타낸 것이다. 표준 융해 곡선들에서, (A) 모든 시료들의 융해 곡선이고, (B)와 (C)는 노출된 새끼 (2 of total 4)의 PND 4에서의 융해 곡선이다. 화살표는 다른 융해 곡선들보다 더 많은 저메틸화된 (hypomethylated) (약 25% 내지 50%) 융해 곡선을 나타낸 것이다. 파란색 원은 PND 4에서의 노출된 새끼(2 of total 4)를 제외하고 모든 시료들의 융해 곡선을 의미한다.
도 4는 PND 4에서 새끼의 LINE-1의 바이설파이트 시퀀싱 결과를 나타낸 것이다. 바이설파이트 시퀀싱 후에, 모든 비메틸화된 C(사이토신들)(0% 표준)은 T(티민)으로 전환되고, 반면 모든 메틸화된 사이토신들 (100% 표준)은 전환되지 않은채로 남아있었다. 모든 노출된 새끼들 PND4 (2 of total 4)에서 감소된 DNA 메틸화들을 나타냈고, 비노출된 그룹은 LINE-1의 참고 서열과 비교하여 볼 때 글로벌 DNA 저메틸화 패턴을 나타내었다. FIG. 1 shows 10 CpG sites in 5'UTR of rat LINE-1 using MethPrimer (Criteria used: Island size> 100, GC Percent> 50.0, Obs / Exp> 0.6). The blue region represents the GpG island in LINE-1.
Figure 2 shows the results of a standard melting curve showing different methylation rates. Representative standard melting curves for determination of methylated DNA are shown. Standard samples are 100%, 75%, 50%, 25%, 10%, 5% and 0% methylated from top to bottom.
3 shows the results of the MS-HRM experiment. In standard melting curves, (A) is the melting curve of all samples, and (B) and (C) are the melting curves at
Figure 4 shows the bisulfite sequencing results of LINE-1 in young on
본 발명은 랫트 특이적인 LINE-1(Long Interspersed nuclear element-1)의 메틸화 여부 측정방법 및 이를 위한 특이적 프라이머에 관한 것이다. 이하 본 발명을 보다 상세히 설명한다.The present invention relates to a method for measuring methylation of a rat-specific Long Interspersed Nuclear Element-1 (LINE-1) and a specific primer for the method. Hereinafter, the present invention will be described in more detail.
일 관점에서, 본 발명은 생물학적 시료로부터 서열번호 1로 표시되는 LINE-1(Long Interspersed nuclear element-1)의 CpG 부위의 메틸화 여부를 측정하기 위한 방법에 관한 것이다. In one aspect, the present invention relates to a method for measuring methylation of a CpG region of LINE-1 (Long Interspersed nuclear element-1) represented by SEQ ID NO: 1 from a biological sample.
서열번호 1:SEQ ID NO: 1:
1 ttcctggttg ctccgctgca gagagccctg ggcagcaccc cacgagcgaa cctgagcctc 1 ttcctggttg ctccgctgca gagagccctg ggcagcaccc cacgagcgaa cctgagcctc
61 gggaccacag gtaagaccaa atttt ctgct gcaagaaagc tgcctggtga gcttgggaca61 gggaccacag gtaagaccaa atttt ctgct gcaagaaagc tgcctggtga gcttgggaca
121 cacggaagca gaatttctct agaaccgggc acgttctgtg tttaccggaa gtcccacacc 121 cacggaagca gaatttctct agaaccgggc acgttctgtg tttaccggaa gtcccacacc
181 cgcggatccc ggcccgcagc agctctctgc tcccagaccc ggtgagagag agacccaacc 181 cgcggatccc ggcccgcagc agctctctgc tcccagaccc ggtgagagag agacccaacc
241 gcctggt cag gtgggcactc ctgaggctgc ag agcggaag agaccaccaa cactgctcac241 gcctggt cag gtgggcactc ctgaggctgc ag agcggaag agaccaccaa cactgctcac
301 ccctgcccac atccctggcc caagaggaaa ctgtataagg cctctgggct cccgtggcga 301 ccctgcccac atccctggcc caagaggaaa ctgtataagg cctctgggct cccgtggcga
361 agggcccagg agcggcagga cccctgccgg agacaccgcc ggaccctgaa ggaaacagac 361 agggcccagg agcggcagga cccctgccgg agacaccgcc ggaccctgaa ggaaacagac
421 cggataaaca gttctctgca cccaaatccc gtgggaggga gagctaaacc ttcagagagg 421 cggataaaca gttctctgca cccaaatccc gtgggaggga gagctaaacc ttcagagagg
481 cagacaggcc tgggaaacca gaagagactg ctccctgcac acacatctcg gacgccagag 481 cagacaggcc tgggaaacca gaagagactg ctccctgcac acacatctcg gacgccagag
541 gaaaaagcca aagaccatct ggaaccctgg tgcactgaag ctcccggaag gggcggcaca 541 gaaaaagcca aagaccatct ggaaccctgg tgcactgaag ctcccggaag gggcggcaca
601 ggtcttcctg gttgctgcca ctgcagagag cccctggaca gcaccccacg agcaaacctg 601 ggtcttcctg gttgctgcca ctgcagagag cccctggaca gcaccccacg agcaaacctg
661 agcctcggga ccacaggtaa gaccaaattt tctgctgcaa gaaagctgcc tggtgaactc 661 agcctcggga ccacaggtaa gaccaaattt tctgctgcaa gaaagctgcc tggtgaactc
721 aagacacagg cccacaggaa cagctgaaga cctgtagaga ggaaaaacta cacgcccgaa 721 aagacacagg cccacaggaa cagctgaaga cctgtagaga ggaaaaacta cacgcccgaa
781 agcagaacac tctgtcccca taactgactg aaagagagga aaacaggtct acagcactcc 781 agcagaacac tctgtcccca taactgactg aaagagagga aaacaggtct acagcactcc
841 tgacacacag gcttatagga cagtctagcc actgtcagaa atagcagaac aaagtaacac 841 tgacacacag gcttatagga cagtctagcc actgtcagaa atagcagaac aaagtaacac
901 tagagataat ctgatggcga gaggcaagcg caggaaccca agcaacagaa accaagacta 901 tagagataat ctgatggcga gaggcaagcg caggaaccca agcaacagaa accaagacta
961 catggcatca tcggagccca attctcccac caaaacaaac atggaatatc caaacacacc 961 catggcatca tcggagccca attctcccac caaaacaaac atggaatatc caaacacacc
1021 agaaaagcaa gatctagttt caaaatcata tttgatcatg atgctggagg acttcaggaa1021 agaaaagcaa gatctagttt caaaatcata tttgatcatg atgctggagg acttcaggaa
1081 agacctgaac acacttaggg aagcacagga aaacattaat aaacaagtaa aagcctacag1081 agacctgaac acacttaggg aagcacagga aaacattaat aaacagtaa aagcctacag
1141 agaggaatcg caaaaatccc tgaaagaatt ccaggaaaac acaatcaaac ggttgaagga1141 agaggaatcg caaaaatccc tgaaagaatt ccaggaaaac acaatcaaac ggttgaagga
1201 attaaaaatg gaaatagaag caatcaagaa agaacacatg gaaacaaccc tggatataga1201 attaaaaatg gaaatagaag caatcaagaa agaacacatg gaaacaaccc tggatataga
1261 aaaccaaaag aagagacaag gagctgtaga tacaagcnnn nnnnnnnnnn nnnnnnnnnn1261 aaaccaaaag aagagacaag gagctgtaga tacaagcnnn nnnnnnnnnn nnnnnnnnnn
1321 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn1321 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
1381 nnnnnnnnnn nnnnnnncca tacatataca gccacccaat tagacaagat ggatgaagca1381 nnnnnnnnnn nnnnnnncca tacatacaca gccacccaat tagacaagat ggatgaagca
1441 aagaagtgca gaccgacagg agccggatgt agatcgctcc tgagagacac agccagaata1441 aagaagtgca gaccgacagg agccggatgt agatcgctcc tgagagacac agccagaata
1501 cagcaaatat agaggcgaat gccagcagca aaccactgaa ctgagaatag gtcccctatt1501 cagcaaatat agaggcgaat gccagcagca aaccactgaa ctgagaatag gtcccctatt
1561 gaaggaatca gagaaagaac tggaagagct tgaaggggct cgagacccca aaagtacaac 1561 gaaggaatca gagaaagaac tggaagagct tgaaggggct cgagacccca aaagtacaac
상기 서열에서 밑줄친 부분은 프라이머 부분이다.The underlined part of the sequence is the primer part.
본 발명에 있어서, 구체적으로, 서열번호 1로 표시되는 랫트 Rattus norvegicus의 genomic DNA 내에 위치한 LINE-1 특히, non-LRT retrotransposable element의 5'UTR +86 bp 에서 +272 bp까지의 염기서열 전부 또는 일부 서열에서의 메틸화된 시토신을 포함하는 단편을 증폭함으로써, DNA 메틸화 여부를 측정하는 방법이다. In the present invention, specifically, all or part of the nucleotide sequence from LINE-1, particularly the non-LRT retrotransposable element located within the genomic DNA of rat Rattus norvegicus, represented by SEQ ID NO: 1, at the 5'UTR +86 bp to +272 bp DNA methylation by amplifying a fragment containing methylated cytosine in the sequence.
본 발명에 있어서, “메틸화"는 DNA를 구성하는 염기에 메틸기가 부착되는 것을 말한다. 바람직하게, 본 발명에서 메틸화 여부는 LINE-1 element의 특정 CpG 부위의 사이토신에서 일어나는 메틸화 여부를 의미한다. 메틸화가 일어난 경우 그로 인하여 전사인자의 결합이 방해를 받게 되어 특정 유전자의 발현이 억제되며, 반대로, 비메틸화 또는 저메틸화(hypomethylation)가 일어나는 경우 특정 유전자의 발현이 증가하게 된다. 포유동물 세포의 게놈 DNA 에는 A, C, G 및 T 에 더하여, 사이토신 링의 다섯번째 탄소에 메틸 그룹이 부착된 5-메틸사이토신(5-methylcytosine, 5-mC)이라는 5번째 염기가 존재한다. 5-메틸사이토신의 메틸화는 CpG라고 불리는 CG 디뉴클레오티드(5'-mCG-3')의 C에서만 일어나고, CpG의 메틸화는 long interspersed elements, alu 또는 트랜스포존과 게놈의 반복서열이 발현되는 것을 억제한다. 또한, 상기 CpG의 5-mC가 자연적으로 탈아미노화하여 티민(T)이 되기 쉽기 때문에, CpG는 포유동물 세포에서 대부분의 후생유전학적 변화가 자주 일어나는 부위이다.In the present invention, " methylation "refers to the attachment of a methyl group to a base constituting DNA. Preferably, methylation in the present invention means methylation occurring in cytosine at a specific CpG site of LINE-1 element. When methylation occurs, the binding of transcription factors is hindered and the expression of a specific gene is inhibited. On the contrary, when methylation or hypomethylation occurs, expression of a specific gene is increased. DNA has a fifth base, 5-methylcytosine, 5-mC, with a methyl group attached to the fifth carbon of the cytosine ring in addition to A, C, G and T. 5-Methylcytosine The methylation of cytosine occurs only in C of a CG dinucleotide (5'-mCG-3 ') called CpG, and the methylation of CpG results in long interspersed elements, alu or transposons and repeats of the genome To inhibit the expression. In addition, because it is easy to 5-mC in the CpG is naturally de-aminated to the thymine (T), CpG is most benefits are genetic changes that occur frequently sites in mammalian cells.
본 발명에서, "메틸화 여부(수준) 측정"은 유전자의 CpG 부위의 메틸화 수준을 측정하는 것으로서, 메틸화 특이적인 PCR, 예를 들어 메틸화 특이적 PCR(methylation-specific polymerase chain reaction, MSP), 실시간 메틸화 특이적 PCR(real time methylation-specific polymerase chain reaction), 메틸화 DNA 특이적 결합 단백질을 이용한 PCR, 또는 정량 PCR 등을 통해 측정할 수 있다. 또는, 파이로시퀀싱, MS-HRM (Methylation-Sensitive High-Resolution Melting Analysis,메틸화 특이- 고해상도 융해곡선 분석) 과 메틸화 민감성 제한 효소를 사용한 메틸화 여부 측정, DNA 칩 및 바이설파이트 시퀀싱과 같은 자동염기분석 등의 방법으로 측정할 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the "methylation determination (level) measurement" measures the methylation level of the CpG region of a gene and includes methylation-specific PCR such as methylation-specific polymerase chain reaction (MSP) Specific PCR (real time methylation-specific polymerase chain reaction), PCR using methylated DNA-specific binding protein, or quantitative PCR. Alternatively, automated base analysis such as pyrosequencing, methylation-sensitive high-resolution melting analysis (MS-HRM), methylation determination using methylation-sensitive restriction enzymes, DNA chip and bisulfite sequencing , But the present invention is not limited thereto.
본 발명에 있어서, 예컨대, 유전자의 CpG 부위란, 상기 유전자의 DNA 상에 존재하는 CpG 부위를 말한다. 상기 유전자의 DNA 는, 상기 유전자가 발현하는데 필요하며 서로 작동가능하게 연결되어 있는 일련의 구성 단위를 모두 포함하는 개념으로, 예를 들어, 비해석부위 (untranslated region, UTR), 프로모터 영역, 단백질 코딩 영역(open reading frame, ORF) 및 터미네이터 영역을 포함한다. 따라서, 유전자의 CpG 부위는 비해석부위 (untranslated region, UTR), 해당 유전자의 프로모터 영역, 단백질 코딩 영역(open reading frame, ORF) 또는 터미네이터 영역 등에 존재할 수 있다.In the present invention, for example, a CpG region of a gene refers to a CpG region existing on the DNA of the gene. The DNA of the gene is a concept including all of a series of structural units necessary for expression of the gene and operatively linked to each other, and includes, for example, an untranslated region (UTR), a promoter region, An open reading frame (ORF), and a terminator region. Thus, the CpG region of a gene may be present in an untranslated region (UTR), a promoter region of the gene, an open reading frame (ORF), or a terminator region.
CpG island는 CpG dinucleotided의 밀도가 다른 곳보다 높은 곳을 의미하며, 정상세포에서 유전자 프로모터 및 5‘ 엑손에 위치한 CpG island loci는 DNA 메틸화를 겪지 않도록 보호받아, 대부분에서 메틸화가 없는 반면, 인간 유전체 DNA의 약 절반 가량을 차지하는 LINE-1과 같은 반복 서열에 위치한 CpG 들의 대부분은 과메틸화(hypermethylation) 되어있다. 일반적으로 암세포는 global genomic hypomethylation과 CpG island의 hypermethylation 특징을 나타낸다. 일반적으로 정상세포가 암세포 단계로 진행될수록 메틸화되어 있던 반복염기서열의 CpG dinucleotide 부위들은 탈메틸화되어 유전체 전반적으로 저메틸화(hypormethylation)를 초래하며, 메틸화로부터 보호받던 프로모터 CpG island는 과메틸화(hypermethylation)되는 경향을 나타낸다. 특히, 본 발명에서의 특이적 프라이머 서열은 스프라그 다울리(Sprague Dawley) 랫트를 이용하여 global methylation 실험시에 특이적으로 메틸화 부위를 증폭시킬 수 있다.The CpG island locus in the 5 'exon of the gene promoter and the CpG island loci in the normal cell are protected from DNA methylation, and in most cases, there is no methylation, whereas the human genome DNA Most of the CpGs located in the repeating sequence, such as LINE-1, which accounts for about half of the CpG, are hypermethylated. In general, cancer cells exhibit global genomic hypomethylation and hypermethylation characteristics of CpG island. In general, as the normal cells progress to the cancer cell stage, the methylated CpG dinucleotide regions of the methylated repetitive nucleotide sequence are demethylated to cause overall hypromethylation of the genome, while the promoter CpG island protected from methylation is hypermethylated Respectively. In particular, the specific primer sequence in the present invention can amplify the methylation site specifically in the global methylation experiment using Sprague Dawley rats.
본 발명에 있어서, 다양한 생물학적 시료를 이용하여 상기 메틸화 여부가 측정(검출)될 수 있으며, 유전자의 메틸화 수준이 차이 나는 조직, 세포, 전혈, 혈청, 혈장, 타액, 객담, 또는 뇨와 같은 시료 등을 포함하나, 이에 제한되지 않는다.In the present invention, the presence or absence of methylation can be measured (detected) using various biological samples, and samples such as tissues, cells, whole blood, serum, plasma, saliva, sputum or urine, But is not limited thereto.
본 발명에 있어서, 상기한 특정 증폭하기 위한 메틸화 부위는 상기 LINE-1의 CpG 다이뉴클레오타이드 모티브에서 검출되며, 비해석부위 (untranslated region, UTR)에서 검출되는 경우, 예를들면 5' UTR에서 약 1.5kbp 이내, 특히 913bp이내에서 검출될 수 있다. In the present invention, the above-mentioned methylation site for specific amplification is detected in the CpG dinucleotide motif of LINE-1, and when detected in the untranslated region (UTR), for example, about 1.5 kbp, in particular within 913 bp.
본 발명에 따른 메틸화는 LINE-1 element(요소)의 적어도 일부를 비-메틸화 사이토신 잔기를 선택적으로 변형시키거나, 또는 메틸화 사이토신 잔기를 선택적으로 변형시키는 화합물과 접촉하고, 상기 접촉에 의해 생성된 산물의 검출에 의한 방법으로 검출될 수 있다. 이러한 화합물은 당업계에 공지된 것으로 예를들면 하이드라진 또는 바이설파이트 이온이고, 상기 하이드라진과 접촉된 유전자의 적어도 일부를 피페리딘으로 절단하고, 상기 바이설파이트 이온과 접촉된 유전자의 적어도 일부를 알칼리로 처리될 수 있다.The methylation according to the present invention is characterized in that at least a portion of the LINE-1 element (element) is contacted with a compound that selectively modifies a non-methylated cytosine residue or selectively modifies a methylated cytosine residue, Or by detection of the resulting product. Such a compound is, for example, a hydrazine or a bisulfite ion as known in the art, and at least a part of the gene contacted with the hydrazine is cleaved with piperidine, and at least a part of the gene contacted with the bisulfite ion It can be treated with alkali.
본 발명에 있어서, 상기 방법은 서열번호 2의 정방향 프라이머 및 서열번호 3의 역방향 프라이머로 이루어진 프라이머 셋트를 이용하여 증폭함으로써, DNA 메틸와 여부를 검출할 수 있다.In the present invention, the method can detect DNA methylation by amplification using a primer set comprising a forward primer of SEQ ID NO: 2 and a reverse primer of SEQ ID NO: 3.
다른 구현예에서 본 발명에 따른 메틸화 부위의 검출은 용융, 교잡, 증폭, 서열분석, 전기영동, 크로마토그래피 및 질량분광분석기로 구성되는 군으로부터 선택되는 하나 이상의 방법에 의해 수행될 수 있다. In other embodiments, the detection of the methylation site in accordance with the present invention may be performed by one or more methods selected from the group consisting of fusion, hybridization, amplification, sequencing, electrophoresis, chromatography and mass spectrometry.
다른 관점에서, 본 발명은 서열번호 2의 정방향 프라이머 및 서열번호 3의 역방향 프라이머로 이루어진 LINE-1 메틸화 여부를 측정하기 위한 프라이머 셋트에 관한 것이다. In another aspect, the present invention relates to a primer set for measuring whether LINE-1 methylation is made of the forward primer of SEQ ID NO: 2 and the reverse primer of SEQ ID NO: 3.
정방향; 5′ - TTGTTGTAAGAAAGTTGTTTGGTGA- 3′ (서열번호 2)Forward direction; 5 '-TTGTTGTAAGAAAGTTGTTTGGTGA- 3' (SEQ ID NO: 2)
역방향: 5′ - CTACAACCTCAAAAATACCCACCTA - 3′ (서열번호 3)Reverse direction: 5 '- CTACAACCTCAAAAATACCCACCTA-3' (SEQ ID NO: 3)
본 발명에 있어서, 암 진단 또는 예후 진단에 필요한 정보를 제공하기 위해, 스프라그 다울리 랫트와 같은 대상의 유전자 LINE-1의 특정 CpG 부위에서의 메틸화 수준을 측정하는 대표적인 방법으로, 대상의 생물학적 시료에서 게놈 DNA를 수득하고, 수득한 DNA에 메틸화되지 않은 사이토신 염기를 변형시키는 화합물 또는 메틸화 민감성 제한효소를 처리한 후, 상기 처리된 DNA를 서열번호 2 와 3과 같은 특정 프라이머를 이용하여 PCR에 의해 증폭시키고 그 증폭된 결과물의 존부를 확인하는 것을 통해 측정할 수 있다.In the present invention, as a representative method for measuring the methylation level at a specific CpG site of gene LINE-1 such as Sprague Dawley rats in order to provide information necessary for cancer diagnosis or prognosis diagnosis, , And the obtained DNA is treated with a specific primer such as SEQ ID NOS: 2 and 3, followed by treatment with a compound for modifying cytosine bases which are not methylated in the obtained DNA or a methylation-sensitive restriction enzyme, And amplifying the amplified product and identifying the presence of the amplified product.
본 발명에 있어서, 상기 대상은 스프라그 다울리와 같은 랫트, 마우스 등의 설치류, 개, 토끼, 인간 등 다양한 생물종을 포함할 수 있다. In the present invention, the subject may include various species such as rodents such as Sprague Dawley, rodents such as rats and mice, dogs, rabbits, and humans.
본 발명에서 메틸화를 측정할 수 있는 제제로는 유전자의 메틸화된 대립형질 서열에 특이적인 프라이머 및 비메틸화된 대립형질 서열에 특이적인 프라이머를 포함할 수 있다. 본 발명에서, 용어 "프라이머"는 짧은 자유 3 말단 수산화기를 가지는 핵산 서열로 상보적인 템플레이트(template)와 염기쌍을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 중합효소 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성을 개시할 수 있다. 또한, 프라이머는, 7개 내지 50개의 뉴클레오타이드 서열을 가진 센스 및 안티센스 핵산으로서, DNA 합성의 개시점으로 작용하는 프라이머의 기본 성질을 변화시키지 않는 추가의 특징을 혼입할 수 있다.Agents capable of measuring methylation in the present invention may include primers specific for the methylated allele sequence of the gene and primers specific for the unmethylated allele sequence. In the present invention, the term "primer" means a short nucleic acid sequence capable of forming a base pair with a complementary template with a nucleic acid sequence having a short free 3-terminal hydroxyl group and serving as a starting point for template strand copying. The primer can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures. In addition, primers can incorporate additional features that do not alter the primer properties of primers that serve as a starting point for DNA synthesis, as sense and antisense nucleic acids with 7 to 50 nucleotide sequences.
본 발명의 프라이머는 메틸화 여부를 분석하는 대상이 되는 특정 CpG 부위의 서열에 따라 바람직하게 디자인될 수 있으며, 각각 메틸화되어 바이설파이트에 의해 변형되지 않았던 사이토신을 특이적으로 증폭할 수 있는 프라이머쌍, 및 메틸화되지 않아 바이설파이트에 의해 변형된 사이토신을 특이적으로 증폭할 수 있는 프라이머쌍일 수 있다. The primer of the present invention can be preferably designed according to the sequence of a specific CpG site to be subjected to methylation analysis and includes a pair of primers capable of specifically amplifying cytosine that has been methylated and not modified by bisulfite, And a primer pair that is not methylated and can specifically amplify cytosine modified by bisulfite.
다른 관점에서, 본 발명은 서열번호 2의 정방향 프라이머 서열과 80 내지 100%의 서열동일성을 가지는 프라이머, 그리고 서열번호 3의 역방향 프라이머 서열과 80 내지 100%의 서열동일성을 가지는 프라이머를 포함하는 LINE-1 메틸화 여부 측정을 위한 키트에 관한 것이다.In another aspect, the present invention provides a primer comprising a primer having 80-100% sequence identity to the forward primer sequence of SEQ ID NO: 2, and a primer having a sequence identity of 80-100% to the reverse primer sequence of SEQ ID NO: 1 < / RTI > methylation.
본 발명은 또한, 서열번호 2의 정방향 프라이머 서열과 80 내지 100%의 서열동일성을 가지는 프라이머, 그리고 서열번호 3의 역방향 프라이머 서열과 80 내지 100%의 서열동일성을 가지는 프라이머를 포함하는 LINE-1 메틸화 여부 측정을 위한 키트에 관한 것이다.The present invention also relates to a method for producing LINE-1 methylation comprising a primer having 80-100% sequence identity to the forward primer sequence of SEQ ID NO: 2 and a primer having 80-100% sequence identity to the reverse primer sequence of SEQ ID NO: And more particularly to a kit for measuring whether or not a subject is exposed.
상기 서열동일성은 바람직하게는, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% 일 수 있다. The sequence identity is preferably 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, Lt; / RTI >
상기 조성물 및 키트에는 상기 제제 이외에도, 중합효소 아가로스, 전기영동에 필요한 완충용액 등이 추가로 포함될 수 있다.In addition to the above preparation, the composition and kit may further contain a polymerase agarose, a buffer solution necessary for electrophoresis, and the like.
또 다른 관점에서, 본 발명은 환경 독성 물질이 대상에 영향을 미치는지 여부를 확인하기 위하여, LINE-1의 CpG 부위의 메틸화 수준/여부를 측정하는 방법에 관한 것이다. In yet another aspect, the present invention relates to a method for determining the level of methylation of a CpG region of LINE-1, in order to determine whether an environmental toxicant affects a subject.
이러한 영향은 환경 독성 물질인 잔류성 유기오염물질 (Persistent Organic Pollutants, POPs)이 대상에 노출된 경우, 후성학적 변화, 영향을 의미하는 것이다. These effects are the epigenetic changes and the effects of persistent organic pollutants (POPs), which are environmental toxicants, when exposed to the subject.
구체적으로, 본 발명은 대상의 생물학적 시료로부터 유전자의 CpG 부위의 메틸화 수준을 검출하는 단계; 및 상기 메틸화 수준을 대조군 시료의 해당 유전자의 메틸화 수준과 비교하는 단계를 포함하는 방법에 관한 것이다.Specifically, the present invention provides a method for detecting a methylation level of a CpG region of a gene from a biological sample of a subject; And comparing the methylation level to the methylation level of the corresponding gene of the control sample.
상기 유전자의 특정 CpG 부위의 메틸화 수준을 검출하는 단계는, 보다 상세하게는, (a) 수득된 시료 내 게놈 DNA를 비메틸화 사이토신 염기를 변형시키는 화합물 또는 메틸화 민감성 제한효소로 처리하는 단계; 및 (b) 상기 처리된 DNA를 해당 유전자의 특정 CpG 부위를 증폭할 수 있는 프라이머를 이용하여 PCR에 의해 증폭하는 단계를 포함할 수 있다.The step of detecting the methylation level of a specific CpG region of the gene comprises, more particularly, (a) treating the genomic DNA in the obtained sample with a compound that modifies the unmethylated cytosine base or a methylation-sensitive restriction enzyme; And (b) amplifying the treated DNA by PCR using a primer capable of amplifying a specific CpG region of the gene.
상기 (a) 단계에서 비메틸화 사이토신 염기를 변형시키는 화합물은 바이설파이트일 수 있으며, 바람직하게는 소듐 바이설파이트일 수 있다. 이러한 바이설파이트를 이용하여 비메틸화 사이토신 잔기를 변형시켜 유전자의 메틸화 여부를 검출하는 방법은 당 업계에 널리 공지되어 있다. The compound that modifies the unmethylated cytosine base in step (a) may be bisulfite, preferably sodium bisulfite. Methods for detecting methylation of a gene by modifying an unmethylated cytosine residue using such bisulfite are well known in the art.
또한, 상기 (a) 단계에서 메틸화 민감성 제한효소는 상기에서 설명한 바와 같이, 특정 CpG 부위의 메틸화를 특이적으로 검출할 수 있는 제한효소로서 제한효소의 인식부위로 CG를 함유하는 제한효소일 수 있으며, 예를 들면, SmaI, SacII, EagI, HpaII, MspI, BssHII, BstUI, NotI 등이 있으며, 이에 제한되지 않는다. In addition, as described above, the methylation-sensitive restriction enzyme in step (a) may be a restriction enzyme capable of specifically detecting methylation of a specific CpG site and may be a restriction enzyme containing CG as a recognition site of a restriction enzyme For example, SmaI, SacII, EagI, HpaII, MspI, BssHII, BstUI, NotI, and the like.
상기 (b) 단계에서 증폭은 통상적인 PCR 방법에 의해 수행될 수 있다. 이때 사용되는 프라이머는 상기에서 설명한 바와 같이, 메틸화 여부를 분석하는 대상이 되는 특정 CpG 부위의 서열에 따라 바람직하게 디자인될 수 있으며, 각각 메틸화되어 바이설파이트에 의해 변형되지 않았던 사이토신을 특이적으로 증폭할 수 있는 프라이머쌍 및 메틸화되지 않아 바이설파이트에 의해 변형된 사이토신을 특이적으로 증폭할 수 있는 프라이머 쌍일 수 있다.In the step (b), the amplification may be performed by a conventional PCR method. As described above, the primers used herein can be desirably designed according to the sequence of a specific CpG site to be subjected to methylation analysis, and can be specifically amplified by specifically amplifying cytosine which has been methylated and not modified by bisulfite And a primer pair capable of specifically amplifying cytosine modified by bisulfite without being methylated.
상기 유전자의 특정 CpG 부위의 메틸화 수준을 검출하는 단계는, (c) 상기 (b) 단계에서 증폭된 결과물의 존부를 확인하는 단계를 추가로 포함할 수 있다. 상기 (c) 단계에서 증폭된 결과물의 존부는 당 업계에 공지된 방법, 예를 들면 전기영동을 수행하여 원하는 위치의 밴드의 검출 여부에 따라서 수행될 수 있다. 예를 들면, 비메틸화 사이토신 잔기를 변형시키는 화합물을 사용한 경우 상기 (a) 단계에서 사용한 두 종류의 프라이머쌍, 즉 메틸화되어 바이설파이트에 의해 변형되지 않았던 사이토신을 특이적으로 증폭할 수 있는 프라이머셋트(쌍) 및 메틸화되지 않아 바이설파이트에 의해 변형된 사이토신을 특이적으로 증폭할 수 있는 프라이머쌍에 의해 각각 증폭된 PCR 결과물의 존부에 따라 메틸화 정도를 판단할 수 있다. 바람직하게, 샘플 게놈 DNA를 바이설파이트로 처리하고, 해당 유전자의 CpG 부위를 PCR로 증폭하고, 증폭된 부위의 염기서열을 분석하는 바이설파이트 게놈 시퀀싱 방법을 사용하여 메틸화 여부를 판단할 수 있다. The step of detecting the methylation level of the specific CpG region of the gene may further include the step of (c) confirming the presence or absence of the amplified product in the step (b). The presence or absence of the amplified product in the step (c) may be performed according to a method known in the art, for example, electrophoresis to detect a band at a desired position. For example, in the case of using a compound for modifying an unmethylated cytosine residue, two kinds of primer pairs used in the step (a), that is, a primer capable of specifically amplifying cytosine that has been methylated and not modified by bisulfite The degree of methylation can be determined according to the presence or absence of the set (pair) and the PCR result amplified by the primer pair that can specifically amplify the cytosine modified by the bisulfite without being methylated. Preferably, the methylation can be determined by treating the sample genomic DNA with bisulfite, amplifying the CpG region of the gene by PCR, and analyzing the base sequence of the amplified region using a bisulfite genomic sequencing method .
또한, 제한효소를 이용한 경우에도 당 업계에 공지된 방법, 예를 들어 mock DNA에서 PCR 결과물이 나타난 상태에서, 제한효소로 처리된 DNA에서 PCR 결과물이 있는 경우는 CpG가 메틸화된 것으로 판단하고, 제한효소로 처리된 DNA에서 PCR 결과물이 없는 경우는 CpG가 비메틸화 한 것으로 판단하는 것에 따라 그 메틸화 여부를 판단할 수 있으며, 이는 당업자에게 자명하다. 상기에서 mock DNA란 시료에서 분리되고 아무런 처리를 하지 않은 상태의 시료 DNA를 의미한다.In the case where restriction enzymes are used, it is judged that CpG is methylated when PCR products are present in the DNA treated with restriction enzymes in a state known in the art, for example, mock DNA, If there is no PCR result in the DNA treated with the enzyme, it can be judged whether CpG is methylated by judging that CpG is unmethylated, which is obvious to a person skilled in the art. In the above, mock DNA refers to a sample DNA that has been separated from the sample and has not undergone any treatment.
다른 구현예로, 본 발명은, 암 진단 또는 예후에 필요한 정보를 제공하기 위하여, 시료로부터 서열번호 1로 표시되는 LINE-1(Long Interspersed nuclear element-1)의 CpG 부위의 메틸화 여부를 측정하는 방법에 관한 것으로, 구체적으로는, 이러한 방법은 서열번호 2 및 서열번호 3의 프라이머 셋트를 이용하여 LINE-1 메틸화 여부 측정함으로써 수행될 수 있다. In another embodiment, the present invention provides a method for measuring methylation of a CpG region of LINE-1 (Long Interspersed nuclear element-1) represented by SEQ ID NO: 1 from a sample to provide information necessary for cancer diagnosis or prognosis Specifically, this method can be performed by measuring whether or not LINE-1 methylation is performed using the primer set of SEQ ID NO: 2 and SEQ ID NO: 3.
다른 구현예로, 잔류성 유기오염물질 (Persistent Organic Pollutants, POPs)이 대상에 영향을 미치는지 여부를 확인하기 위하여, 시료로부터 서열번호 1로 표시되는 LINE-1(Long Interspersed nuclear element-1)의 CpG 부위의 메틸화 여부를 측정하는 방법에 관한 것으로, 이러한 방법은 서열번호 2 및 서열번호 3의 프라이머 셋트를 이용하여 LINE-1 메틸화 여부 측정함으로써 수행될 수 있다. In another embodiment, in order to determine whether Persistent Organic Pollutants (POPs) affect the subject, the CpG site of LINE-1 (Long Interspersed nuclear element-1) shown in SEQ ID NO: 1 The method can be carried out by measuring the methylation of LINE-1 using the primer set of SEQ ID NO: 2 and SEQ ID NO: 3.
이와 같은 방법에 따라, 환자 시료 내 유전자의 CpG 부위가 저메틸화 상태로 검출되는 경우, 암과 같은 특정질환의 진단 또는 예측, PBDE와 같은 잔류성 유기오염 물질의 생체 내 노출시 부정적 영향을 진단할 수 있는 것이다.According to this method, when a CpG region of a gene in a patient sample is detected as a low-methylated state, the diagnosis or prediction of a specific disease such as cancer can be diagnosed and the adverse effect of in vivo exposure to persistent organic pollutants such as PBDE It is.
잔류성 유기오염물질 (Persistent Organic Pollutants, POPs)은 인체 축적이 쉽고, 잔류성, 독성 그리고 장거리 이동성 등의 특성을 나타낸다. 대표적인 종류로는 유기염소계농약류 (Organicchlorine pesticides, OCPs), 폴리염화비페닐 (Polychlorinated biphenyls, PCBs) 그리고 폴리브롬화디페닐에테르 (Polybrominated diphenyl ethers, PBDEs)등이 있다. PBDEs는 먹이사슬로 축적이 되고, 모체로부터 태반과 모유를 통하여 태아와 신생아로 전이된다. 그리고 동물 실험 등을 통하여 PBDEs는 갑상선 호르몬의 교란물질로 작용하여 신경세포의 정상적인 성장 발달에 영향을 미치어 신경전달물질 합성의 변화, 행동발달 장애, 인식장애, 기억장애 등 뇌기능 발달에 영향을 주는 것으로 알려져있다. Persistent Organic Pollutants (POPs) are easy to accumulate and exhibit persistent, toxic and long-range mobility. Representative classes include organic chlorine pesticides (OCPs), polychlorinated biphenyls (PCBs), and polybrominated diphenyl ethers (PBDEs). PBDEs accumulate in the food chain, transferring from the mother to the fetus and the newborn through placenta and breast milk. And animal experiments, PBDEs act as a disturbing substance of thyroid hormones, affecting the normal growth and development of neurons, affecting the development of brain functions such as changes in neurotransmitter synthesis, behavioral developmental disorders, cognitive disorders, and memory disorders It is known to give.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for illustrating the present invention and that the scope of the present invention is not construed as being limited by these embodiments.
1. 실험과정1. Experimental process
오리엔트 바이오(Orient Bio, 성남, 한국)로부터 16 마리의 임신한 스프라그 다울리 랫트들 (gestation day 0)을 구입하였다. 16마리의 임신한 스프라그 다울리 랫트들을 랜덤하게 3가지 다른 조건들로 표 1에서 나타난 바와 같이 노출, 비노출로 처리하였다.Sixteen pregnant sprague daughters (gestation day 0) were purchased from Orient Bio (Seongnam, Korea). Sixteen pregnant Sprague Dawley rats were randomly treated with three different conditions, exposed and unexposed as shown in Table 1.
[표 1][Table 1]
7일간의 적응기간 후 혼합물 (2.5 μmol/ml for BDE-209 (Decabromodiphenyl ether)& 6 nmol/ml for 13C-BDE-47(Radio-labelled 2,2′,4,4′-tetrabromodiphenyl ether ))을 매일 위관영양법으로 노출군 랫트에 공급하였다. 각각의 희생시점이 다른 3그룹의 랫트 노출군은 연속적으로 임신 8일째부터 출산 후 4일까지 18일 동안 BDE-209 (2.5 μmol/kg b.w) 와 13C-BDE-47 (6 nmol/kg b.w)의 혼합물을 위관영양법으로 처리하였다. 비노출군은 노출군과 같은 방식으로 옥수수 기름을 위관영양법으로 처리하고 노출군과 동일한 시점인 출산 후 4일에 희생시켰다. After a 7-day adaptation period, the mixture (2.5 μmol / ml for Decabromodiphenyl ether and 6 nmol / ml for 13 C-BDE-47 (Radio-labeled 2,2 ', 4,4'-tetrabromodiphenyl ether) Were fed daily to rats exposed to gavage. BDE-209 (2.5 μmol / kg bw) and 13 C-BDE-47 (6 nmol / kg bw) for 18 days from the eighth day of pregnancy to the fourth day after birth were consecutively exposed to three different groups of rats at different sacrifice time points ) Was treated with gavage. In the unexposed group, corn oil was treated with gustatory nutrition in the same manner as the exposed group and sacrificed on the fourth day after birth, which is the same point as the exposed group.
이러한 랫트들의 어미와 새끼는 80℃에서 다음의 표 2의 조건으로 분석수행이 될 때까지 저장하였다. 어미에서의 지노믹 DNA는 각각의 간과 뇌에서 추출하였고, 새끼의 지노믹 DNA 추출은 태아인 경우에는 몸체(n=1)의 일부에서 추출하였고. 신생아, 젖먹이는 꼬리에서 추출하였다. 스펙트로포토미터 (NanoDrop 1000, Thermo Scientific, Wilmington, DE, USA)를 이용하여 260nm에서 흡광도를 측정함으로써 DNA 농도를 측정하였다. 비메틸화된 사이토신은 바이설파이트를 처리시에 우라실로 전환되나, 메틸화된 사이토신은 보호된다. 지노믹 DNA의 바이설파이트 처리는 Bisulfite Conversion Kit (EZ DNA Methylation-Lightning Kit; Zymo Research, Orange, CA, USA)를 이용하여 수행하였다.The mother and the offspring of these rats were stored at 80 ° C until analysis was carried out under the conditions shown in Table 2 below. Genomic DNA in the mother was extracted from each liver and brain, and genomic DNA extraction from the fetus was extracted from a part of the body (n = 1). Newborns and infants were extracted from the tail. DNA concentration was measured by measuring the absorbance at 260 nm using a spectrophotometer (NanoDrop 1000, Thermo Scientific, Wilmington, DE, USA). Unmethylated cytosine is converted to uracil when bisulfite is treated, but methylated cytosine is protected. Biosulfite treatment of genomic DNA was performed using a bisulfite conversion kit (EZ DNA Methylation-Lightning Kit; Zymo Research, Orange, CA, USA).
[표 2][Table 2]
MS-HRM (Methylation-Sensitive High-Resolution Melting Analysis,메틸화 특이- 고해상도 융해곡선 분석)을 수행하였다. MS-HRM (Methylation-Sensitive High-Resolution Melting Analysis, methylation specific-high-resolution melting curve analysis).
실험은 96웰 플레이트 (LightCycler® 480, Roche Diagnostics, Indianapolis, IN, USA)에 혼합 반응 (LightCycler® 480 High Resolution Melting Master Mix, Roche Diagnostics, Indianapolis, IN, USA)을 이용하여 수행하고, 여기에는 DNA intercalating dye가 최종 부피 20uL에 포함되었다. Experiments were performed using a LightCycler® 480 High Resolution Melting Master Mix (Roche Diagnostics, Indianapolis, IN, USA) in a 96 well plate (LightCycler® 480, Roche Diagnostics, Indianapolis, IN, USA) The intercalating dye was included in the final volume of 20 uL.
다음의 표 3의 프라이머들이 MethPrimer(http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi) 에 의해 디자인되었다. The following primers in Table 3 were designed by MethPrimer (http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi).
[표 3][Table 3]
특히, LINE-1 (GenBank: AH005177.2)의 5‘비번역 영역(5’UTR)에서의 프라이머 서열들은 다음과 같았다.In particular, the primer sequences in the 5 'untranslated region (5'UTR) of LINE-1 (GenBank: AH005177.2) were as follows.
정방향; 5′ - TTGTTGTAAGAAAGTTGTTTGGTGA 3′ (서열번호 2)Forward direction; 5 '- TTGTTGTAAGAAAGTTGTTTGGTGA 3' (SEQ ID NO: 2)
역방향: 5′ - CTACAACCTCAAAAATACCCACCTA - 3′ (서열번호 3)Reverse direction: 5 '- CTACAACCTCAAAAATACCCACCTA-3' (SEQ ID NO: 3)
반응 혼합물에는 master mix (2x), 0.2uM의 프라이머 그리고 1uL의 바이설파이트-변형된 DNA, 3mM MgCl2를 포함하였다. 사이클링 조건은 다음과 같았다:The reaction mixture contained a master mix (2x), 0.2 uM of primer and 1 uL of bisulfite-modified DNA, 3 mM MgCl2. The cycling conditions were as follows:
95℃, 10분으로 1 사이클, 95℃ 10초, 60℃ 10초 및 72℃ 10초 과정을 40 사이클 증폭하였다. 다음으로, MS-HRM단계로, 95℃, 1분, 70℃ 1분, 다음으로 acquisition step (started ramping from 70 to 95 °C, rising by 0.2 °C/s with 25 acquisitions/°C)으로 수행하였다. 95 ° C for 10 minutes, 1 cycle, 95 ° C for 10 seconds, 60 ° C for 10 seconds, and 72 ° C for 10 seconds. Next, the MS-HRM step was performed at 95 ° C for 1 minute, at 70 ° C for 1 minute, and then at the acquisition step (starting ramping from 70 to 95 ° C, rising by 0.2 ° C / s with 25 acquisitions / ° C) Respectively.
상업적 표준으로 (Pre-mixed Calibration Standard, EpigenDx, Hopkinton, MA, USA) 0%, 5%, 10%, 25%, 50%, 75% and 100% 메틸화된 대조군 DNA를 사용하였다. 메틸화 표준은 제조자 지시에 따라 바이설파이트에 의해 변형되었다. 이러한 표준들은 각각의 실험에 포함되었다. MS-HRM 데이터는 Gene Scanning Software (Roche Diagnostics)를 이용하여 분석되었다. Control DNAs were used that were 0%, 5%, 10%, 25%, 50%, 75% and 100% methylated as commercial standards (Pre-mixed Calibration Standard, EpigenDx, Hopkinton, MA, USA). The methylation standard was modified by bisulfite according to the manufacturer's instructions. These standards were included in each experiment. MS-HRM data were analyzed using Gene Scanning Software (Roche Diagnostics).
직접 바이설파이트 시퀀싱(Direct Bisulfite Sequencing)을 수행하였다. Direct bisulfite sequencing was performed.
MS-HRM 분석결과를 다시 확인하기 위해, DNA 시퀀싱은 Cosmo Genetech Co., LTD, Seoul, Korea에 의해 수행되었다. 간략하게 수행과정을 설명하면 다음과 같다. MS-HRM으로부터 얻은 PCR 산물들은 시퀀싱 반응의 주형으로 사용되었다. DNA 앰플리콘들은 Big Dye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA)과 MS-HRM에서의 PCR 프라이머들을 사용하여 시퀀싱하였다. 산물들은 Magnesil®GREEN(Promega,Madison,WI,USA)으로 세정하였고, ABI 3730xl Genetic Analyzer (Thermo Fisher Scientific) 으로 resolution 하였다. 데이터는 the AB1 data collection software v3.0 (Thermo Fisher Scientific), DNASTAR®Lasergene sequence analysis software(DNASTAR,Madison,WI,USA)을 이용하여 분석되었다. 추가적으로 서열 분석 소프트웨어 (Sequencher, Genecodes)를 사용하여, CpG 부위에서의 티미딘과 사이토신의 염기서열 변화를 측정하였다. To confirm the MS-HRM analysis results, DNA sequencing was performed by Cosmo Genetech Co., LTD, Seoul, Korea. A brief description of the procedure is given below. The PCR products from MS-HRM were used as templates for sequencing reactions. DNA amplicons were sequenced using PCR primers from the Big Dye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, Mass., USA) and MS-HRM. The products were washed with Magnesil ® GREEN (Promega, Madison, WI, USA) and resolved with ABI 3730xl Genetic Analyzer (Thermo Fisher Scientific). Data were analyzed using the AB1 data collection software v3.0 (Thermo Fisher Scientific) and DNASTAR ® Lasergene sequence analysis software (DNASTAR, Madison, WI, USA). In addition, sequencing software (Sequencher, Genecodes) was used to measure the nucleotide sequence changes of thymidine and cytosine at the CpG site.
2. 실험결과2. Experimental results
태반과 모유를 통하여 PBDEs 노출된 경우에 글로벌 DNA 메틸화가 변경되었는지를 확인하기 위하여, LINE-1 메틸화 패턴을 측정하였다. LINE-1의 구조는 5‘UTR이 internal promoter activity와 함께 가지고 있고, 2개의 ORF, 3’UTR를 가지고 있다.LINE-1 methylation patterns were measured to determine if global DNA methylation was altered when exposed to PBDEs through placenta and breast milk. The structure of LINE-1 has 5'UTR with internal promoter activity, 2 ORFs, 3'UTR.
글로벌 DNA 메틸화를 분석하기 위해서, MethPrimer를 이용하여 high GC contents를 가진 5‘UTR에 10개의 CpG 부위를 도 1에서와 같이 찾아내었다. To analyze global DNA methylation, 10 CpG sites were found in 5'UTR with high GC contents using MethPrimer as in FIG.
도 2에 나타난 바와 같이, 다른 메틸화 율을 나타내는 표준 융해 곡선은 region의 methylation status를 정량화하는데 사용되었다. As shown in Figure 2, a standard melting curve representing different methylation rates was used to quantify the methylation status of the region.
도 3에 나타난 바와 같이, MS-HRM은 모든 시료들에서의 융해 곡선을 나타내었고, 출산 후 4일 에서의 노출된 offspring (총 4 중 2마리)을 제외하고는, 50-70% 범위에서 표준 융해 곡선과 매우 유사하였다.As shown in Fig. 3, MS-HRM showed the melting curve in all samples and the standard of 50-70% except for the offspring (2 in total 4) exposed at 4 days after birth It is very similar to the melting curve.
따라서, 상기 실험결과를 살펴보더라도, 대조물질이 메틸화에 따라서 melting 그래프가 잘 나타났음을 확인하였다. 즉 메틸화된 DNA 표준물질이 그래프로 정확히 표현 되었고, 이는 본 발명에 따른 프라이머가 성공적으로 원하는 부위를 증폭하였음을 알 수 있었다. Therefore, it was confirmed that the melting graph was well represented according to the methylation of the control substance. That is, the methylated DNA standard material was accurately represented in the graph, which indicates that the primer according to the present invention successfully amplified the desired site.
바이설파이트 시퀀싱은 CpG 디뉴클레오티드들에서의 메틸화 status를 확인하기 위하여 저메틸화를 보이는 노출군의 2마리의 출산 후 4일 젖먹이 새끼와 비노출군의 2마리의 출산 후 4일 젖먹이 새끼로 수행되었다. Bisulfite sequencing was carried out with 4 days postnatal infants in the exposed group showing low methylation and 4 days after the 2 births in the unexposed group to confirm the methylation status in CpG dinucleotides.
실험의 대조군으로써 메틸화된 DNA 표준들이 메틸화 정도에 따라 변화하였지만, 참고 서열과 비교하여 출산 후 4일의 노출군과 비노출된 새끼에서의 시료들에서의 염기서열 상에 아무런 차이가 없었다 (도 4).As a control for the experiment, the methylated DNA standards varied according to the degree of methylation, but there was no difference in the nucleotide sequence in the 4 day old exposed group compared to the reference sequence (Fig. 4) .
따라서, 바이설파이트 시퀀싱 실험에서도 본 발명에 따른 프라이머가 성공적으로 작용하여서, 염기서열 분석이 가능하였음을 확인할 수 있었다.Therefore, it was confirmed that the primer according to the present invention was successfully performed in the bisulfite sequencing experiment, and the base sequence analysis was possible.
이상으로 본 발명의 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the invention is not limited thereby. It will be obvious. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.
<110> National Cancer Center <120> Method for detecting LINE-1 global DNA methylation in Rat <130> KPA-1238 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 1620 <212> DNA <213> Artificial Sequence <220> <223> LINE-1 in Rat <400> 1 ttcctggttg ctccgctgca gagagccctg ggcagcaccc cacgagcgaa cctgagcctc 60 gggaccacag gtaagaccaa attttctgct gcaagaaagc tgcctggtga gcttgggaca 120 cacggaagca gaatttctct agaaccgggc acgttctgtg tttaccggaa gtcccacacc 180 cgcggatccc ggcccgcagc agctctctgc tcccagaccc ggtgagagag agacccaacc 240 gcctggtcag gtgggcactc ctgaggctgc agagcggaag agaccaccaa cactgctcac 300 ccctgcccac atccctggcc caagaggaaa ctgtataagg cctctgggct cccgtggcga 360 agggcccagg agcggcagga cccctgccgg agacaccgcc ggaccctgaa ggaaacagac 420 cggataaaca gttctctgca cccaaatccc gtgggaggga gagctaaacc ttcagagagg 480 cagacaggcc tgggaaacca gaagagactg ctccctgcac acacatctcg gacgccagag 540 gaaaaagcca aagaccatct ggaaccctgg tgcactgaag ctcccggaag gggcggcaca 600 ggtcttcctg gttgctgcca ctgcagagag cccctggaca gcaccccacg agcaaacctg 660 agcctcggga ccacaggtaa gaccaaattt tctgctgcaa gaaagctgcc tggtgaactc 720 aagacacagg cccacaggaa cagctgaaga cctgtagaga ggaaaaacta cacgcccgaa 780 agcagaacac tctgtcccca taactgactg aaagagagga aaacaggtct acagcactcc 840 tgacacacag gcttatagga cagtctagcc actgtcagaa atagcagaac aaagtaacac 900 tagagataat ctgatggcga gaggcaagcg caggaaccca agcaacagaa accaagacta 960 catggcatca tcggagccca attctcccac caaaacaaac atggaatatc caaacacacc 1020 agaaaagcaa gatctagttt caaaatcata tttgatcatg atgctggagg acttcaggaa 1080 agacctgaac acacttaggg aagcacagga aaacattaat aaacaagtaa aagcctacag 1140 agaggaatcg caaaaatccc tgaaagaatt ccaggaaaac acaatcaaac ggttgaagga 1200 attaaaaatg gaaatagaag caatcaagaa agaacacatg gaaacaaccc tggatataga 1260 aaaccaaaag aagagacaag gagctgtaga tacaagcnnn nnnnnnnnnn nnnnnnnnnn 1320 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 1380 nnnnnnnnnn nnnnnnncca tacatataca gccacccaat tagacaagat ggatgaagca 1440 aagaagtgca gaccgacagg agccggatgt agatcgctcc tgagagacac agccagaata 1500 cagcaaatat agaggcgaat gccagcagca aaccactgaa ctgagaatag gtcccctatt 1560 gaaggaatca gagaaagaac tggaagagct tgaaggggct cgagacccca aaagtacaac 1620 1620 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer <400> 2 ttgttgtaag aaagttgttt ggtga 25 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer <400> 3 ctacaacctc aaaaataccc accta 25 <110> National Cancer Center <120> Method for detecting LINE-1 global DNA methylation in RAT <130> KPA-1238 <160> 3 <170> KoPatentin 3.0 <210> 1 <211> 1620 <212> DNA <213> Artificial Sequence <220> <223> LINE-1 in Rat <400> 1 ttcctggttg ctccgctgca gagagccctg ggcagcaccc cacgagcgaa cctgagcctc 60 gggaccacag gtaagaccaa attttctgct gcaagaaagc tgcctggtga gcttgggaca 120 cacggaagca gaatttctct agaaccgggc acgttctgtg tttaccggaa gtcccacacc 180 cgcggatccc ggcccgcagc agctctctgc tcccagaccc ggtgagagag agacccaacc 240 gcctggtcag gtgggcactc ctgaggctgc agagcggaag agaccaccaa cactgctcac 300 ccctgcccac atccctggcc caagaggaaa ctgtataagg cctctgggct cccgtggcga 360 agggcccagg agcggcagga cccctgccgg agacaccgcc ggaccctgaa ggaaacagac 420 cggataaaca gttctctgca cccaaatccc gtgggaggga gagctaaacc ttcagagagg 480 cagacaggcc tgggaaacca gaagagactg ctccctgcac acacatctcg gacgccagag 540 gaaaaagcca aagaccatct ggaaccctgg tgcactgaag ctcccggaag gggcggcaca 600 ggtcttcctg gttgctgcca ctgcagagag cccctggaca gcaccccacg agcaaacctg 660 agcctcggga ccacaggtaa gaccaaattt tctgctgcaa gaaagctgcc tggtgaactc 720 aagacacagg cccacaggaa cagctgaaga cctgtagaga ggaaaaacta cacgcccgaa 780 agcagaacac tctgtcccca taactgactg aaagagagga aaacaggtct acagcactcc 840 tgacacacag gcttatagga cagtctagcc actgtcagaa atagcagaac aaagtaacac 900 tagagataat ctgatggcga gaggcaagcg caggaaccca agcaacagaa accaagacta 960 catggcatca tcggagccca attctcccac caaaacaaac atggaatatc caaacacacc 1020 agaaaagcaa gatctagttt caaaatcata tttgatcatg atgctggagg acttcaggaa 1080 agacctgaac acacttaggg aagcacagga aaacattaat aaacagtaa aagcctacag 1140 agaggaatcg caaaaatccc tgaaagaatt ccaggaaaac acaatcaaac ggttgaagga 1200 attaaaaatg gaaatagaag caatcaagaa agaacacatg gaaacaaccc tggatataga 1260 aaaccaaaag aagagacaag gagctgtaga tacaagcnnn nnnnnnnnnn nnnnnnnnnn 1320 nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 1380 nnnnnnnnnn nnnnnnncca tacatataca gccacccaat tagacaagat ggatgaagca 1440 aagaagtgca gaccgacagg agccggatgt agatcgctcc tgagagacac agccagaata 1500 cagcaaatat agaggcgaat gccagcagca aaccactgaa ctgagaatag gtcccctatt 1560 gaaggaatca gagaaagaac tggaagagct tgaaggggct cgagacccca aaagtacaac 1620 1620 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward Primer <400> 2 ttgttgtaag aaagttgttt ggtga 25 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Reverse Primer <400> 3 ctacaacctc aaaaataccc accta 25
Claims (12)
상기 메틸화 여부는 PCR, 메틸화 특이 PCR(methylation specific PCR), 실시간 메틸화 특이 PCR(real time methylation specific PCR), 메틸화 DNA 특이적 결합 단백질을 이용한 PCR, 메틸화 민감성 제한 효소를 사용한 메틸화 여부 측정, 정량 PCR, DNA 칩, 파이로시퀀싱, MS-HRM (Methylation-Sensitive High-Resolution Melting Analysis,메틸화 특이- 고해상도 융해곡선 분석) 및 바이설파이트 시퀀싱으로 구성된 군에서 선택되는 것으로 검출하는 것을 특징으로 하는 방법. The method according to claim 1,
The methylation status can be determined by PCR, methylation specific PCR, real time methylation specific PCR, PCR using methylated DNA specific binding protein, methylation detection using methylation sensitive restriction enzyme, quantitative PCR, DNA chip, pyrosequencing, MS-HRM (Methylation-Sensitive High-Resolution Melting Analysis, methylation-specific high-resolution melting curve analysis) and bisulfite sequencing.
상기 서열번호 1로 표시되는 LINE-1에서 86번째 내지 272 번째 bp 위치의 서열의 증폭함으로써, CpG 메틸화 여부를 측정하는 것을 특징으로 하는 방법. The method according to claim 1,
Wherein the amplification of the sequence at positions 86 to 272 bp in LINE-1 represented by SEQ ID NO: 1 is carried out to determine whether CpG methylation has occurred.
서열번호 2의 정방향 프라이머 및 서열번호 3의 역방향 프라이머로 이루어진 프라이머 셋트를 이용하여 증폭하는 것을 특징으로 하는 방법.The method of claim 3,
A primer set consisting of the forward primer of SEQ ID NO: 2 and the reverse primer of SEQ ID NO: 3.
상기 조성물은 암의 진단 또는 치료 모니터링을 위해 사용되는 것을 특징으로 하는 조성물. 8. The method of claim 7,
Wherein said composition is used for diagnostic or therapeutic monitoring of cancer.
상기 방법은 제 5 항에 따른 서열번호 2 및 서열번호 3의 프라이머 셋트를 이용하여 LINE-1 메틸화 여부 측정하는 것을 특징으로 하는 방법. 10. The method of claim 9,
Wherein the method comprises measuring the LINE-1 methylation using the primer set of SEQ ID NO: 2 and SEQ ID NO: 3 according to claim 5.
상기 방법은 제 5 항에 따른 서열번호 2 및 서열번호 3의 프라이머 셋트를 이용하여 LINE-1 메틸화 여부 측정하는 것을 특징으로 하는 방법. 12. The method of claim 11,
Wherein the method comprises measuring the LINE-1 methylation using the primer set of SEQ ID NO: 2 and SEQ ID NO: 3 according to claim 5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020160096050A KR101833023B1 (en) | 2016-07-28 | 2016-07-28 | Method for detecting LINE-1 global DNA methylation in Rat |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020160096050A KR101833023B1 (en) | 2016-07-28 | 2016-07-28 | Method for detecting LINE-1 global DNA methylation in Rat |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| KR20180014283A true KR20180014283A (en) | 2018-02-08 |
| KR101833023B1 KR101833023B1 (en) | 2018-02-28 |
Family
ID=61232467
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020160096050A KR101833023B1 (en) | 2016-07-28 | 2016-07-28 | Method for detecting LINE-1 global DNA methylation in Rat |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR101833023B1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019045533A1 (en) * | 2017-08-31 | 2019-03-07 | 서울대학교산학협력단 | Composition and kit for diagnosing breast cancer by using cpg site methylation level in line-1 regulatory region, and method using same |
| KR102024581B1 (en) | 2018-03-30 | 2019-09-24 | 단국대학교 천안캠퍼스 산학협력단 | Method for preparing DNA library for LINE-1(L1HS) targeted-probe enrichment using HiSeq sequencer |
| KR102027310B1 (en) | 2018-03-30 | 2019-10-01 | 단국대학교 천안캠퍼스 산학협력단 | Method for preparing DNA library for LINE-1(L1HS) targeted-probe enrichment using Ion PGM sequencer |
| KR102559496B1 (en) * | 2022-04-26 | 2023-07-25 | 연세대학교 산학협력단 | Composition for determining whether a nucleic acid is methylated and Method for determining whether a nucleic acid is methylated |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2686451A4 (en) * | 2011-03-18 | 2014-12-24 | Baylor Res Inst | Line-1 hypomethylation as a biomarker for early-onset colorectal cancer |
-
2016
- 2016-07-28 KR KR1020160096050A patent/KR101833023B1/en active IP Right Grant
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019045533A1 (en) * | 2017-08-31 | 2019-03-07 | 서울대학교산학협력단 | Composition and kit for diagnosing breast cancer by using cpg site methylation level in line-1 regulatory region, and method using same |
| KR102024581B1 (en) | 2018-03-30 | 2019-09-24 | 단국대학교 천안캠퍼스 산학협력단 | Method for preparing DNA library for LINE-1(L1HS) targeted-probe enrichment using HiSeq sequencer |
| KR102027310B1 (en) | 2018-03-30 | 2019-10-01 | 단국대학교 천안캠퍼스 산학협력단 | Method for preparing DNA library for LINE-1(L1HS) targeted-probe enrichment using Ion PGM sequencer |
| KR102559496B1 (en) * | 2022-04-26 | 2023-07-25 | 연세대학교 산학협력단 | Composition for determining whether a nucleic acid is methylated and Method for determining whether a nucleic acid is methylated |
| WO2023211003A1 (en) * | 2022-04-26 | 2023-11-02 | 연세대학교 산학협력단 | Composition for determining whether nucleic acid is methylated and method for determining whether nucleic acid is methylated |
Also Published As
| Publication number | Publication date |
|---|---|
| KR101833023B1 (en) | 2018-02-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101833023B1 (en) | Method for detecting LINE-1 global DNA methylation in Rat | |
| Konstantinidis et al. | Live births following Karyomapping of human blastocysts: experience from clinical application of the method | |
| Nelson et al. | Global methylation in exposure biology and translational medical science | |
| CA2887218C (en) | System for amplification of a fetal dna species | |
| Borozdin et al. | SALL4 deletions are a common cause of Okihiro and acro-renal-ocular syndromes and confirm haploinsufficiency as the pathogenic mechanism | |
| Colosimo et al. | Application of MLPA assay to characterize unsolved α-globin gene rearrangements | |
| CN107475366B (en) | Composition for detecting diseases and kit and application thereof | |
| KR101965380B1 (en) | Composition for diagnosing Alzheimer's disease using alteration of CpG methylation in promoter region of IDE gene in skin cell and uses thereof | |
| JP2008517601A (en) | Method and kit for detecting germ cell genomic instability | |
| Park et al. | Analytical validation of the droplet digital PCR assay for diagnosis of spinal muscular atrophy | |
| KR20110094041A (en) | Gene sensitive to normal-tension glaucoma disease, and use thereof | |
| KR102261606B1 (en) | Method for Detection of Colorectal Cancer | |
| EP1964934A1 (en) | Sample treatment solution and reagent kit for preparing sample for detecting DNA methylation | |
| KR100617649B1 (en) | Composition For Cancer diagnosis Containing Methylated Promoters of Colon Cancer Specific Expression-decreased Genes and Use Thereof | |
| US8377657B1 (en) | Primers for analyzing methylated sequences and methods of use thereof | |
| WO2015120142A2 (en) | Differential methylation level of cpg loci that are determinative of kidney cancer | |
| US20130309667A1 (en) | Primers for analyzing methylated sequences and methods of use thereof | |
| AU2007292202A1 (en) | Method of determining an amount of fatty acid contents in bovine intramuscular fat on the basis of genotype of fatty acid synthase gene and method of determining goodness of eating quality of beef on the basis of the results thereof | |
| KR101695347B1 (en) | Composition for predicting a risk of preterm delivery using CpG methylation status of gene and uses thereof | |
| KR20210042614A (en) | A SNP marker composition and a method for diagnosis or prediction of osteochondrodyplasia in cats | |
| Wiedemann et al. | Genomewide scan for anal atresia in swine identifies linkage and association with a chromosome region on Sus scrofa chromosome 1 | |
| US10501804B2 (en) | Differential methylation level of CPG loci that are determinative of a biochemical reoccurrence of prostate cancer | |
| US20080268433A1 (en) | Use of Mitochondrial Point Mutations as Sensitive Clonal Markers | |
| González et al. | Incomplete DJH rearrangements | |
| Menon et al. | Molecular Endocrinology, Endocrine Genetics, and Precision Medicine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AMND | Amendment | ||
| E601 | Decision to refuse application | ||
| AMND | Amendment | ||
| X701 | Decision to grant (after re-examination) | ||
| GRNT | Written decision to grant |