KR102102107B1 - Method for preparing DNA library for SINE targeted-probe enrichment using HiSeq sequencer - Google Patents
Method for preparing DNA library for SINE targeted-probe enrichment using HiSeq sequencer Download PDFInfo
- Publication number
- KR102102107B1 KR102102107B1 KR1020190063834A KR20190063834A KR102102107B1 KR 102102107 B1 KR102102107 B1 KR 102102107B1 KR 1020190063834 A KR1020190063834 A KR 1020190063834A KR 20190063834 A KR20190063834 A KR 20190063834A KR 102102107 B1 KR102102107 B1 KR 102102107B1
- Authority
- KR
- South Korea
- Prior art keywords
- alu
- dna
- dna library
- target
- sine
- Prior art date
Links
- 229920003013 deoxyribonucleic acid Polymers 0.000 title claims abstract description 49
- 239000000523 sample Substances 0.000 title claims description 26
- 230000002068 genetic Effects 0.000 claims abstract description 49
- 238000004458 analytical method Methods 0.000 claims abstract description 20
- 238000004519 manufacturing process Methods 0.000 claims abstract description 8
- 238000007481 next generation sequencing Methods 0.000 claims description 29
- 239000000203 mixture Substances 0.000 claims description 12
- 230000003321 amplification Effects 0.000 claims description 7
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 7
- 239000004480 active ingredient Substances 0.000 claims description 4
- 238000005516 engineering process Methods 0.000 abstract description 15
- 238000007405 data analysis Methods 0.000 abstract description 2
- 239000000463 material Substances 0.000 description 13
- 238000003752 polymerase chain reaction Methods 0.000 description 11
- 238000000034 method Methods 0.000 description 9
- 238000009396 hybridization Methods 0.000 description 6
- 238000003780 insertion Methods 0.000 description 5
- 238000006243 chemical reaction Methods 0.000 description 4
- 230000000295 complement Effects 0.000 description 4
- 238000003766 bioinformatics method Methods 0.000 description 3
- 238000004925 denaturation Methods 0.000 description 3
- 239000002773 nucleotide Substances 0.000 description 3
- 125000003729 nucleotide group Chemical group 0.000 description 3
- 102000004190 Enzymes Human genes 0.000 description 2
- 108090000790 Enzymes Proteins 0.000 description 2
- 241000282412 Homo Species 0.000 description 2
- 229920001850 Nucleic acid sequence Polymers 0.000 description 2
- 229920000272 Oligonucleotide Polymers 0.000 description 2
- 241000288906 Primates Species 0.000 description 2
- 238000010276 construction Methods 0.000 description 2
- 230000036425 denaturation Effects 0.000 description 2
- 238000006062 fragmentation reaction Methods 0.000 description 2
- 230000035772 mutation Effects 0.000 description 2
- 238000003860 storage Methods 0.000 description 2
- 229920000160 (ribonucleotides)n+m Polymers 0.000 description 1
- 108020005345 3' Untranslated Regions Proteins 0.000 description 1
- 101710025987 ACSM2A Proteins 0.000 description 1
- 102100017651 ACSM2A Human genes 0.000 description 1
- 229920002425 Alu element Polymers 0.000 description 1
- 101710024788 HOMER1 Proteins 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 229920000401 Three prime untranslated region Polymers 0.000 description 1
- 238000009825 accumulation Methods 0.000 description 1
- 238000000137 annealing Methods 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 201000011510 cancer Diseases 0.000 description 1
- 230000000875 corresponding Effects 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 239000003989 dielectric material Substances 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 230000001973 epigenetic Effects 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 230000014509 gene expression Effects 0.000 description 1
- 201000002406 genetic disease Diseases 0.000 description 1
- 230000004034 genetic regulation Effects 0.000 description 1
- 239000011521 glass Substances 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 230000001404 mediated Effects 0.000 description 1
- 230000001617 migratory Effects 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- 150000007523 nucleic acids Chemical class 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 238000000527 sonication Methods 0.000 description 1
- 238000001308 synthesis method Methods 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
- 230000002194 synthesizing Effects 0.000 description 1
- 238000002525 ultrasonication Methods 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
- C12Q1/6855—Ligating adaptors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2523/00—Reactions characterised by treatment of reaction samples
- C12Q2523/30—Characterised by physical treatment
- C12Q2523/301—Sonication
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
- C12Q2525/10—Modifications characterised by
- C12Q2525/191—Modifications characterised by incorporating an adaptor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2535/00—Reactions characterised by the assay type for determining the identity of a nucleotide base or a sequence of oligonucleotides
- C12Q2535/122—Massive parallel sequencing
Abstract
Description
본 발명은 이동성 유전인자 SINE 선택적 발굴을 위한 HiSeq 시퀀서 기반의 DNA 라이브러리 제작 방법에 대한 것으로, 상세하게는 차세대 염기서열 해독 장비인 HiSeq 시퀀서를 이용하여 인간 유전체에서 이동성 유전인자 SINE (AluYb8 그리고 AluYb9)들을 선택적으로 동정하기 위한 탐침자(Probe)의 제작, 실험법 및 생명정보학적 분석 파이프 라인 구축에 관한 것이다.The present invention relates to a method of constructing a DNA library based on a HiSeq sequencer for selective discovery of a mobility gene SINE, and specifically, a mobility gene SINE ( Alu Yb8 and Alu Yb9) in the human genome using a HiSeq sequencer, a next-generation sequencing equipment. It is about the production of probe to selectively identify), experimental method and bioinformatics analysis pipeline construction.
차세대 염기서열해독 기술(Next-Generation Sequencing Technology, NGS technology)은 유전물질(DNA)로부터 다수 그리고 대량의 염기서열 해독을 동시에 진행할 수 있고, 단기간에 비교적 적은 비용으로 높은 처리량의 유전체 데이터를 얻을 수 있는 기술이다. 이 기술이 상용화된 2007년 이후 현재까지 매년 혁신적인 기술개량이 진행되었고, 이에 맞추어 어플리케이션 기술 역시 다양하게 개량 및 개발이 되고 있다.Next-Generation Sequencing Technology (NGS technology) can perform multiple and large-scale sequencing from genetic material (DNA) at the same time, and can obtain high-throughput genomic data at relatively low cost in a short period of time. Technology. Since 2007, when this technology was commercialized, innovative technology improvement has been carried out every year, and application technology has been variously improved and developed accordingly.
2003년 인간 유전체 프로젝트(Human Genome Project)는 미국을 주도로 선진 6개국의 18개 기관이 참여하였고 13년의 시간과 약 30억 달러의 비용이 사용되어 약 30억개의 인간 전체 유전체 해독 및 해석을 완료한 전세계적 프로젝트였다. 하지만, 현재 차세대 염기서열해독 기술을 활용하면 인간 전체 유전체 해독 및 해석이 약 1주일이라는 짧은 소요시간과 상대적으로 대단히 저렴한 비용으로 가능하게 되었다. 차세대 염기서열해독 및 분석 기술의 발전함에 따라, 의생명과학 전분야에 적용되어 다양한 지적재산권이 생산되고 관련산업이 성장하는 큰 동력이 되었다. 또한, 차세대 염기서열 해독 및 분석 기술의 발전으로 새로운 어플리케이션 기술(예, 진단 마커)과 원천기술의 발전 또한 요구되는 시점이다.In 2003, the Human Genome Project, led by the United States, involved 18 institutions from six developed countries, and spent 13 years and about $ 3 billion in cost to decode and interpret about 3 billion human-wide genomes. It was a completed worldwide project. However, using the next-generation sequencing technology, it is now possible to decode and interpret the entire genome of humans with a short time of about one week and relatively low cost. With the development of next-generation sequencing and analysis technology, it has been applied to all fields of biomedical science, producing a variety of intellectual property rights and becoming a great driving force for the growth of related industries. In addition, with the development of next-generation sequencing and analysis technology, new application technologies (eg, diagnostic markers) and development of original technologies are also required.
미국 Illumina사의 플랫폼 중 HiSeq 차세대 염기서열해독장비는 다양한 유전체 데이터 생성 장비 종류들 중 가장 보편적으로 사용되는 장비이다. Illumina사의 플랫폼은 전세계 유전체 데이터 생산량의 70% 이상을 차지하고 있고 높은 재연성과 정확도를 보이고 있다. 또한, 다양한 논문과 특허에서 HiSeq 장비를 이용해 얻어진 데이터를 분석 및 보고하고 있다. HiSeq은 Illumina사의 Sequencing By Synthesis (SBS) 기술과 Cluster generation 기술을 이용한 장비로 유리 Chip인 Flow Cell 표면에 존재하는 Adaptor oligo와 라이브러리를 혼성화 및 증폭한 후 하나씩 합성되는 핵산 종류에 따른 형광을 한 개씩 측정함으로써 염기서열을 해독하는 원리이다.HiSeq next-generation sequencing equipment among Illumina's platforms in the United States is the most commonly used equipment among various genome data generation equipment types. Illumina's platform accounts for over 70% of the world's genomic data production and is highly reproducible and accurate. In addition, various papers and patents analyze and report data obtained using HiSeq equipment. HiSeq is a device that uses Illumina's Sequencing By Synthesis (SBS) technology and Cluster generation technology. After hybridizing and amplifying the adapter oligo and library existing on the surface of the flow cell, which is a glass chip, the fluorescence according to the type of nucleic acid synthesized one by one is measured. By doing so, it is the principle to decipher the sequence.
현재 높은 정확성과 대량의 데이터를 필요로 하는 임상 및 연구 분야에서 사용되고 있고 다양한 목표 염기서열을 해독할 수 있는 응용기법들이 있다. 특히 인간을 포함하는 대형동물의 전체 유전체, 전사체, 후성유전체, 진유전체 그리고 목표서열 증폭법을 이용한 특정 부위에 대한 집단연구에 특화된 플랫폼이다. 차세대 염기서열해독 기술의 발달은 전체 유전체 분석에 막대한 영향을 주었으며 라이브러리 구축 방법이 개발됨에 따라 연구자가 원하는 표적영역에 초점을 맞추어 집단 염기서열 분석이 가능하여 특정 집단(예, 환자군)에서 유전학적 차이를 설명할 수 있는 좋은 기반이 된다.It is currently used in clinical and research fields that require high accuracy and large amounts of data, and there are application techniques for decoding various target sequences. In particular, it is a platform specialized in collective research on specific regions using the whole genome, transcripts, epigenetics, genomes, and target sequence amplification methods of large animals, including humans. The development of next-generation sequencing technology has had a huge impact on the entire genome analysis, and as library building methods are developed, it is possible to analyze the group sequencing by focusing on the target area desired by the researcher, so genetic differences in specific groups (eg, patient groups) It is a good basis for explaining.
하지만, 인간 유전체에 유전자 발현의 변화, 유전자 구조 변형 등을 야기하여 암과 같은 유전적 질병을 유발시키는 이동성 유전인자(Transposable Element, TE)가 약 44%를 차지하고 있다. 이들은 염기서열의 유사성이 매우 높아서 차세대 염기서열 해독기술을 직접 적용할 수 없으며, 목표 서열을 동정 방법과 분석법에 대한 연구가 미흡하다. 이동성 유전자는 삽입 메커니즘에 따라 레트로트랜스포손(Retrotransposon, Class I)과 DNA 트랜스포손(DNA transposon, Class II) 두 클래스로 분류된다. 이중 레트로트랜스포손은 스스로 리보헥산(Ribo nucleic acid, RNA)을 전사하여 이를 매개로 하는 삽입기작을 통해 새로운 유전체 영역에 삽입함으로써 유전적 변이 및 다양성에 관여하고 있다.However, the transposable element (TE), which causes genetic diseases such as cancer by causing changes in gene expression and genetic structure in the human genome, accounts for about 44%. These are very similar in sequence, so they cannot directly apply the next-generation sequencing technology, and research on methods for identifying and analyzing target sequences is insufficient. Mobility genes are classified into two classes according to the insertion mechanism: retrotransposon (Class I) and DNA transposon (Class II). Among them, retrotransposon is involved in genetic variation and diversity by transcribing ribohexane (RNA) itself and inserting it into a new genomic region through an insertion mechanism mediated by it.
레트로트랜스포손 중, Short INterspersed Element (SINE) 인자에 속하는 Alu과(科)는 인간 유전체의 약 10% 이상을 차지하는 유전인자이다. 인간 유전체에 약 100만 카피(copy)가 있다고 알려져 있으며 영장류 유전체에 특이적으로 삽입되어져 있다. Alu는 약 140 bp에 존재하는 Mid A-stretch를 기준으로 Left Arm과 Right Arm으로 구성되며 약 300 bp의 이동성 유전인자이다. 대부분의 Alu는 긴 영장류 진화 역사 동안 인자 이내에 유전적 구조적 변이와 단일염기 다형성(single nucleotide polymorphism)의 축적에 의해 Alu의 유전적 이동성을 상실한 것으로 알려져 있다. 하지만 최근 삽입된 몇몇의 Alu과와 AluYb8/9아과(亞科)는 여전히 이동성을 보인다고 보고되어 있으며, 이들은 인간의 질병에 관련된 유전자 조절 및 구조적 변화에 다양한 영향을 끼친다고 보고되었다. 따라서 참조 유전체에 보고 되지 않으며 인간 유전체에 새롭게 삽입되어 있는 AluYb8/9의 유전적 부위를 동정하고 AluYb8/9 삽입에 의한 유전적 변이 연구가 필요하다. 보고되지 않은 AluYb8/9의 삽입을 추적할 수 있는 기술을 통하여 특정 집단에서 공통변이 연구에 이용한다면 정확도 높은 진단마커가 개발될 수 있을 것이다.Among the retrotransposons, the Alu family belonging to the Short INterspersed Element (SINE) factor is a genetic factor that accounts for more than 10% of the human genome. It is known that there are about 1 million copies in the human genome and is specifically inserted into the primate genome. Alu is composed of Left Arm and Right Arm based on Mid A-stretch existing at about 140 bp and is a mobility genetic factor of about 300 bp. Most Alu is known to have lost the genetic structural variation and SNP (single nucleotide polymorphism) genetic mobility of Alu by the accumulation of factor for a longer within primate evolutionary history. However, several recently inserted Alu and Alu Yb8 / 9 subfamily are still reported to have mobility, and they have been reported to have various effects on genetic regulation and structural changes related to human disease. Therefore, the genetic site of Alu Yb8 / 9 that is not reported in the reference genome and is newly inserted into the human genome is identified, and genetic variation studies by Alu Yb8 / 9 insertion are needed. A technique that can track the insertion of unreported Alu Yb8 / 9 can be used to develop a high-accuracy diagnostic marker if it is used for common mutation studies in a specific population.
본 발명의 목적은 이동성 유전인자 SINE(Short INterspersed Element)을 표적하는 탐침자(probe)를 유효성분으로 포함하는 SINE 표적용 DNA 라이브러리(library) 제작용 조성물 또는 이를 포함하는 SINE 표적용 DNA 라이브러리 제작용 키트를 제공하는데 있다.An object of the present invention is to construct a DNA library for a SINE target or a composition for preparing a SINE target DNA library comprising a probe that targets the mobile genetic factor SINE (Short Interspersed Element) as an active ingredient It is to provide a kit.
또한, 본 발명의 다른 목적은 이동성 유전인자 SINE(Short INterspersed Element)을 표적하는 탐침자(probe)를 이용한 SINE 표적용 DNA 라이브러리 제작 방법을 제공하는데 있다. In addition, another object of the present invention is to provide a method for producing a DNA library for SINE targets using a probe that targets the mobile genetic factor Short Interspersed Element (SINE).
상기 목적을 달성하기 위하여, 본 발명은 서열번호 3으로 표시되는 이동성 유전인자 SINE(Short INterspersed Element)을 표적하는 탐침자(probe)를 유효성분으로 포함하는 SINE 표적용 DNA 라이브러리(library) 제작용 조성물을 제공한다.In order to achieve the above object, the present invention is a composition for preparing a DNA library for a SINE target comprising a probe targeting the mobility genetic factor SINE (Short Interspersed Element) represented by SEQ ID NO: 3 as an active ingredient Gives
또한, 본 발명은 조성물을 포함하는 SINE 표적용 DNA 라이브러리 제작용 키트를 제공한다.In addition, the present invention provides a kit for constructing a DNA library for a SINE target containing a composition.
또한, 본 발명은 게노믹(genomic) DNA를 절편화하는 단계; 상기 절편화된 DNA를 어댑터 접합시켜 양 말단을 평활화(end repair)시키는 단계; 상기 평활화된 DNA와, 서열번호 3으로 표시되는 이동성 유전인자 SINE을 표적하는 탐침자(probe)를 혼성화시키는 단계; 상기 혼성화된 DNA를 연장화시키는 단계; 및 상기 연장화된 DNA 단편 양 말단의 어댑터 서열을 이용하여 PCR 증폭시키는 단계를 포함하는 SINE 표적용 DNA 라이브러리 제작 방법을 제공한다.In addition, the present invention comprises the steps of fragmenting genomic DNA; Adapter repairing the fragmented DNA to smooth both ends (end repair); Hybridizing the smoothed DNA with a probe targeting the mobile genetic factor SINE represented by SEQ ID NO: 3; Extending the hybridized DNA; And PCR amplification using adapter sequences at both ends of the extended DNA fragment.
본 발명은 이동성 유전인자 SINE 선택적 발굴을 위한 HiSeq 시퀀서 기반의 DNA 라이브러리 제작 방법에 관한 것으로서, 이동성 유전인자의 임상 및 학술적 가치와 차세대 염기서열해독 기술의 발달 그리고 비용의 감소 및 분석 시스템 발전을 기반으로 인간의 특이적인 AluYb8/9를 동정할 수 있는 AluYb8/9-표적 염기서열 분석 방법을 개발함으로써 간단하고 빠르게 AluYb8/9에 의한 개개인의 유전적 변이와 그에 따른 유전적 영향연구에 한 방법이 될 수 있다. 또한 본 발명을 바탕으로 AluYb8/9를 포함한 인간 유전체내 이동성을 보이고 유전적 변이를 일으킬 수 있는 활동적인 이동성 유전인자만을 표적화하는 추가 기술 개발이 가능하다. 이동성 유전인자 표적화 염기서열 분석뿐만 아니라 표적화 서열 데이터 분석 방법이 단순화 보편화됨으로써 임상의학적 진단 마커 개발에 이용될 수 있을 것이라 기대할 수 있다.The present invention relates to a method of constructing a DNA library based on a HiSeq sequencer for selective discovery of a mobile genetic factor SINE, based on clinical and academic values of the mobile genetic factor, development of next-generation sequencing technology, cost reduction, and development of an analysis system A method to study the genetic variation of individuals and their genetic effects by Alu Yb8 / 9 simply and quickly by developing an Alu Yb8 / 9-target sequencing method that can identify human specific Alu Yb8 / 9 Can be In addition, based on the present invention, it is possible to develop additional technologies targeting only active mobility genetic factors that show mobility in the human genome, including Alu Yb8 / 9, and can cause genetic variation. It can be expected that the method of analyzing targeting sequence data as well as the sequencing targeting the migratory genetic factors can be used for the development of clinical diagnostic markers by simplifying the generalization.
도 1은 본 발명의 일 실시예에 따른 차세대 염기서열 해독 및 해석을 위한 유전물질 가공부터 AluYb8/9 표적화 서열 데이터 분석 방법까지의 연구 절차를 나타낸다.
도 2는 본 발명의 일 실시예에 따른 차세대 염기서열분석을 위한 AluYb8/9 표적 라이브러리 구축 과정을 나타낸다.
도 3은 본 발명의 일 실시예에 따른 차세대 염기서열해독 데이터의 교정/가공 및 생명정보학적 분석 과정을 나타낸다.1 shows a research procedure from genetic material processing for next-generation sequencing and analysis to Alu Yb8 / 9 targeted sequence data analysis method according to an embodiment of the present invention.
Figure 2 shows the Alu Yb8 / 9 target library construction process for next-generation sequencing according to an embodiment of the present invention.
3 shows a process of correcting / processing and bioinformatics analysis of next-generation sequencing data according to an embodiment of the present invention.
본 발명은 서열번호 3으로 표시되는 이동성 유전인자 SINE(Short INterspersed Element)을 표적하는 탐침자(probe)를 유효성분으로 포함하는 SINE 표적용 DNA 라이브러리(library) 제작용 조성물을 제공한다. The present invention provides a composition for preparing a DNA library for a SINE target comprising a probe targeting the mobile genetic factor SINE (Short Interspersed Element) represented by SEQ ID NO: 3 as an active ingredient.
바람직하게는, 상기 SINE은 AluYb8 또는 AluYb9일 수 있다.Preferably, the SINE may be Alu Yb8 or Alu Yb9.
바람직하게는, 상기 DNA 라이브러리는 차세대 염기서열해독(Next generation sequencing, NGS) 분석을 위한 것이고, 보다 바람직하게는, 상기 NGS 분석은 일루미나(Illumina) 플랫폼 HiSeq 시퀀서를 이용하는 것일 수 있으나, 이에 제한되는 것은 아니다.Preferably, the DNA library is for next generation sequencing (NGS) analysis, and more preferably, the NGS analysis may be using an Illumina platform HiSeq sequencer, but is not limited thereto. no.
또한, 본 발명은 상기 조성물을 포함하는 SINE 표적용 DNA 라이브러리 제작용 키트를 제공한다.In addition, the present invention provides a kit for preparing a DNA library for SINE targets containing the composition.
한편, 상기 키트는 SINE 표적용 DNA 라이브러리 제작에 일반적으로 사용되는 다른 기구, 용액 등을 추가로 포함할 수 있으나, 이에 제한되지 않는다.Meanwhile, the kit may further include other instruments, solutions, and the like, which are generally used in the production of DNA libraries for SINE targets, but is not limited thereto.
또한, 본 발명은 게노믹(genomic) DNA를 절편화하는 단계; 상기 절편화된 DNA를 어댑터 접합시켜 양 말단을 평활화(end repair)시키는 단계; 상기 평활화된 DNA와, 서열번호 3으로 표시되는 이동성 유전인자 SINE을 표적하는 탐침자(probe)를 혼성화시키는 단계; 상기 혼성화된 DNA를 연장화시키는 단계; 및 상기 연장화된 DNA 단편 양 말단의 어댑터 서열을 이용하여 PCR 증폭시키는 단계를 포함하는 SINE 표적용 DNA 라이브러리 제작 방법을 제공한다.In addition, the present invention comprises the steps of fragmenting genomic DNA; Adapter repairing the fragmented DNA to smooth both ends (end repair); Hybridizing the smoothed DNA with a probe targeting the mobile genetic factor SINE represented by SEQ ID NO: 3; Extending the hybridized DNA; And PCR amplification using adapter sequences at both ends of the extended DNA fragment.
바람직하게는, 상기 SINE은 AluYb8 또는 AluYb9일 수 있다.Preferably, the SINE may be Alu Yb8 or Alu Yb9.
바람직하게는, 상기 DNA 라이브러리는 차세대 염기서열해독(Next generation sequencing, NGS) 분석을 위한 것이고, 보다 바람직하게는, 상기 NGS 분석은 일루미나(Illumina) 플랫폼 HiSeq 시퀀서를 이용하는 것일 수 있으나, 이에 제한되는 것은 아니다.Preferably, the DNA library is for next generation sequencing (NGS) analysis, and more preferably, the NGS analysis may be using an Illumina platform HiSeq sequencer, but is not limited thereto. no.
본 발명에서 사용한 서열번호 3으로 표시되는 이동성 유전인자 SINE을 표적하는 탐침자(probe)는 서열번호 1로 표시되는 Illumina HiSeq system-based NuGen adaptor sequence(P7 어댑터 서열)과, 서열번호 2로 표시되는 AluYb8/9-표적 서열로 이루어져 있다.Probes targeting the mobile genetic factor SINE represented by SEQ ID NO: 3 used in the present invention are Illumina HiSeq system-based NuGen adapter sequence (P7 adapter sequence) represented by SEQ ID NO: 1, and SEQ ID NO: 2 Alu Yb8 / 9-target sequence.
본 발명의 SINE 표적용 DNA 라이브러리는 일루미나(Illumina) 플랫폼 장비인 HiSeq 시퀀서에 적용될 수 있으며, HiSeq에 사용되는 어댑터 서열은 P5 어댑터 서열와 P7 어댑터 서열 두 가지로 나누어지는데, P5와 P7 어댑터 서열은 방향성에 따라서 나뉜다. 보통 P7 어댑터가 주형가닥으로 부착되었을 때 첫 번째 염기분석을 시작하는 위치의 어댑터이고 P5 어댑터는 주형가닥 전환을 통해 상보적인 반대편 서열을 읽기 시작할 수 있는 어댑터이다. 이 두 어댑터는 모두 HiSeq 장비에 사용되는 플로우셀(Flow Cell) 표면에 심어져 있는 염기서열과 상보적이므로 플로우셀 내에서 혼성화 하여 증폭함으로써 라이브러리가 플로우셀에 가득차게 된다. P5 어댑터 서열과 P7 어댑터 서열은 상업적으로 공개된 서열을 사용할 수 있다.The DNA library for SINE target of the present invention can be applied to a HiSeq sequencer that is an Illumina platform equipment, and the adapter sequence used for HiSeq is divided into two types, a P5 adapter sequence and a P7 adapter sequence, and the P5 and P7 adapter sequences are directional. Therefore, it is divided. Usually, when the P7 adapter is attached to the template strand, it is the adapter at the position to start the first nucleotide analysis, and the P5 adapter is the adapter that can start reading the complementary opposite sequence through template strand conversion. Both of these adapters are complementary to the base sequence planted on the surface of the flow cell used in HiSeq equipment, so the library is filled with the flow cell by hybridizing and amplifying in the flow cell. The P5 adapter sequence and the P7 adapter sequence can use commercially published sequences.
이하에서는, 본 발명을 한정하지 않는 실시예에 따라 본 발명을 상세히 설명한다. 본 발명의 하기 실시예는 본 발명을 구체화하기 위한 것일 뿐 본 발명의 권리범위를 제한하거나 한정하는 것이 아님은 물론이다. 따라서, 본 발명의 상세한 설명 및 실시예로부터 본 발명이 속하는 기술분야의 전문가가 용이하게 유추할 수 있는 것은 본 발명의 권리범위에 속하는 것으로 해석된다. Hereinafter, the present invention will be described in detail according to examples not limiting the present invention. It should be understood that the following examples of the present invention are only intended to embody the present invention and do not limit or limit the scope of the present invention. Therefore, from the detailed description and examples of the present invention, what can be easily inferred by experts in the technical field to which the present invention pertains is interpreted as belonging to the scope of the present invention.
<< 실시예Example > >
본 발명은 인간 유전체에 특이적으로 존재한다고 알려진 AluYb8/9를 표적하는 탐침자(Probe)를 제작하여 개인 유전체 내에 개별적으로 가지고 있는 이동성 유전인자 AluYb8/9에 의한 구조적 변이를 동정하는 것이다. 이는 특정 집단연구를 통하여 정확도 높은 진단마커를 개발할 수 있다.The present invention is to identify a structural variation due to the mobility genetic factor Alu Yb8 / 9 individually possessed in the individual genome by constructing a probe targeting Alu Yb8 / 9, which is known to exist specifically in the human genome. This makes it possible to develop highly accurate diagnostic markers through specific group research.
- 단계 1 --Step 1-
이동성 유전인자 AluYb8/9의 염기서열을 인간 참조 유전체 데이터베이스인 UCSC genome 데이터베이스로부터 모두 검출한 뒤 다른 아종(Subfamily)의 Alu들과 다중염기서열정렬법을 통하여 AluYb8/9에 특이적으로 가지고 있는 염기 서열 부위를 확인하여 목표 서열 탐침자를 제작할 위치를 선정하였다.The base which has a specific mobility genes Alu Yb8 / a 9 base sequence of the human reference genome database, the UCSC then detected both from genome databases through the Alu and multiple sequences jeongryeolbeop of different sub-species (Subfamily) Alu Yb8 / 9 The location of the target sequence probe was selected by identifying the sequence region.
AluYb8/9 표적 탐침자는 AluYb8/9 인자의 3' 비번역영역에 위치한 서열을 포함하며 HiSeq (Illumina사 플랫폼 장비) 차세대 염기서열해독 장비에 적용할 수 있는 해독 어댑터 서열, 본 2가지 서열로 구성하였다. The Alu Yb8 / 9 target probe contains a sequence located in the 3 'untranslated region of the Alu Yb8 / 9 factor and is a translation adapter sequence that can be applied to HiSeq (Illumina platform equipment) next-generation sequencing equipment. It was constructed.
본 발명의 실시예에 따른 이동성 유전인자인 AluYb8/9 표적 염기서열을 축적하기 위해 제작된 탐침자(Probe)의 표적서열은 표 1에 나타냈다. The target sequence of the probe (Probe) prepared to accumulate the Alu Yb8 / 9 target nucleotide sequence, which is a mobility genetic factor according to an embodiment of the present invention, is shown in Table 1.
adaptor sequenceIllumina HiSeq system-based NuGen
adaptor sequence
GCAAGGATCGCTCTC-3' (서열번호 1)5'-CAAGCAGAAGACGGCATACGAGATGGAGTTCAGACGTGTGCTCTTCCGATCT
GCAAGGATCGCTCTC-3 '(SEQ ID NO: 1)
(서열번호 2)5'-TGCAGTGAGCCGAGATTGCGCCACTGCAGTCCGCAGTCCG-3 '
(SEQ ID NO: 2)
(AluYb8/9-targeted Probe)Manufactured Alu Yb8 / 9 target probe sequence
( Alu Yb8 / 9-targeted Probe)
GCAAGGATCGCTCTC
TGCAGTGAGCCGAGATTGCGCCACTGCAGTCCGCAGTCCG-3'
(서열번호 3)5'-CAAGCAGAAGACGGCATACGAGATGGAGTTCAGACGTGTGCTCTTCCGATCT
GCAAGGATCGCTCTC
TGCAGTGAGCCGAGATTGCGCCACTGCAGTCCGCAGTCCG-3 '
(SEQ ID NO: 3)
- 단계 2 --Step 2-
차세대 염기서열해독에 적합한 형태로 유전물질을 절편화 하기 위해 초음파 DNA Sonication 시스템을 사용하여 약 550 bp 크기로 절단한다. HiSeq 염기서열 해독장치에 사용할 수 있는 어댑터를 접합하기 위해 점착성 말단(Sticky end) 형태의 단편화된 유전물질을 End Repair 과정을 통해 평활 말단(Blunt end) 형태로 복원해 준다(25℃ (30 분) 1 사이클 그리고 70℃ (10 분)). HiSeq에 사용되는 어댑터 서열은 P5 어댑터 서열와 P7 어댑터 서열 두 가지로 나누어지는데, P5와 P7 어댑터 서열은 방향성에 따라서 나뉜다. 보통 P7 어댑터가 주형가닥으로 부착되었을 때 첫 번째 염기분석을 시작하는 위치의 어댑터이고 P5 어댑터는 주형가닥 전환을 통해 상보적인 반대편 서열을 읽기 시작할 수 있는 어댑터이다. 이 두 어댑터는 모두 HiSeq 장비에 사용되는 플로우셀(Flow Cell) 표면에 심어져 있는 염기서열과 상보적이므로 플로우셀 내에서 혼성화 하여 증폭함으로써 라이브러리가 플로우셀에 가득차게 된다. 차세대 염기서열해독 장비인 HiSeq을 사용하기 위해 어댑터 서열을 절편화된 유전물질 양 말단에 접합한다(25℃ (30 분) 1 사이클 그리고 70℃ (10 분)).In order to fragment the genetic material in a form suitable for next-generation sequencing, it is cut to a size of about 550 bp using an ultrasonic DNA sonication system. In order to join the adapter that can be used for the HiSeq sequencing device, the segmented genetic material in the form of a sticky end is restored to the blunt end form through the end repair process (25 ℃ (30 minutes). 1 cycle and 70 ° C (10 minutes)). The adapter sequence used for HiSeq is divided into two types, the P5 adapter sequence and the P7 adapter sequence, and the P5 and P7 adapter sequences are divided according to orientation. Usually, when the P7 adapter is attached to the template strand, it is the adapter at the position to start the first nucleotide analysis, and the P5 adapter is the adapter that can start reading the complementary opposite sequence through template strand conversion. Both of these adapters are complementary to the base sequence planted on the surface of the flow cell used in HiSeq equipment, so the library is filled with the flow cell by hybridizing and amplifying in the flow cell. To use HiSeq, a next-generation sequencing device, the adapter sequence is conjugated to both ends of the fragmented genetic material (25 ° C (30 min) 1 cycle and 70 ° C (10 min)).
- 단계 3 - -Step 3-
P5 어댑터 서열을 절편화된 유전물질 양 말단에 붙이는 과정 이후 AluYb8/9 표적 탐침자 서열(Illumina P7 어댑터 서열과 함께 구성됨)을 사용해 유전물질 단편 안에 존재하는 AluYb8/9 서열과 유전물질간 혼성화(DNA hybridization) 과정을 거쳐 두 서열을 붙여준다. 이 과정은 P5 어댑터가 접합된 유전물질 절편 500ng과 AluYb8/9 표적 탐침자 100 pM을 사용하여 중합효소 연쇄반응(PCR, Polymerase chain reaction) 기기에서 95℃(5 분) 1사이클, 80℃(10 초, 매 사이클 -0.1℃ 차감) 200 사이클, 60℃(16 시간) 동안 유전물질간 혼성화 반응을 진행한다.Hybridization between the Alu Yb8 / 9 sequence and the genetic material present in the genetic material fragment using the Alu Yb8 / 9 target probe sequence (composed with the Illumina P7 adapter sequence) after the process of attaching the P5 adapter sequence to both ends of the fragmented genetic material After attaching (DNA hybridization), two sequences are attached. This process was performed using a polymerase chain reaction (PCR) device using a 500 ng P5 adapter fragment and 500 pM of Alu Yb8 / 9 target probe. 10 seconds, every cycle -0.1 ° C subtracted) 200 cycles, 60 ° C (16 hours) hybridization reaction between dielectric materials.
- 단계 4 --Step 4-
유전물질 혼성화 반응이 끝난 후 혼성화된 유전물질 단편들을 연장화 작업(72℃ (10분)) 이후 중합효소 연쇄반응(Polymerase Chain Reaction, PCR)을 통해 증폭한다. 이 과정에서 P5와 P7 어댑터에 상응하는 프라이머를 사용하여 중합효소 연쇄반응을 진행한다. 탐침자가 표적하는 AluYb8/9를 포함하는 유전물질 절편서열이 접합되어 있는 경우에만 선택적으로 증폭반응이 일어나게 된다(37℃ (10분), 95℃(3 분) 1 사이클, [95℃(30 초), 62℃(15 초), 72℃(20 초) 총 15 사이클], 72℃(3 분) 1 사이클, 그리고 4℃ (보관)). Illumina사 P5와 P7 프라이머를 이용하여 증폭된 유전물질 절편 시료를 라이브러리라고 하며, 이 라이브러리를 사용해 차세대 염기서열해독을 진행한다.After the hybridization of the genetic material is completed, the hybridized genetic material fragments are amplified through a polymerase chain reaction (PCR) after an extension operation (72 ° C (10 minutes)). In this process, a polymerase chain reaction is performed using primers corresponding to P5 and P7 adapters. The amplification reaction occurs selectively only when the fragment sequence of the genetic material containing Alu Yb8 / 9 targeted by the probe is conjugated (37 ° C (10 min), 95 ° C (3 min) 1 cycle, [95 ° C (30 Seconds), 62 ° C (15 seconds), 72 ° C (20 seconds) total 15 cycles], 72 ° C (3 minutes) 1 cycle, and 4 ° C (storage)). Samples of genetic material fragments amplified using P5 and P7 primers from Illumina are called libraries, and next-generation sequencing is performed using these libraries.
본 발명의 실시예에 따른 AluYb8/9 표적 염기서열해독을 위한 라이브러리 구축을 위한 실험적 단계에 적용된 유전물질 절편화 준비 및 표적서열 증폭조건은 표 2에 나타냈다.Preparation of genetic material fragmentation and target sequence amplification conditions applied in the experimental step for constructing a library for Alu Yb8 / 9 target sequencing according to an embodiment of the present invention are shown in Table 2.
- 단계 5 --Step 5-
AluYb8/9 표적서열이 농축된 라이브러리를 플로우셀에서 증폭시키고 HiSeq 장비를 이용하여 염기서열해독을 진행한다. 시퀀싱 프라이머는 개시영역에 붙어서 표적서열의 반대쪽 말단부터 한 염기서열씩 합성해 나가간다. 이때, 각 A, T, G, C 염기서열은 고유의 파장을 갖는 올리고 뉴클레오타이드(Oligo Nucleotide)로 합성되어 Sequencing By Synthesis 방법으로 진행된다. 각 파장은 HiSeq 내부에 존재하는 검출카메라를 이용하여 파장을 측정하여 염기서열해독을 결정한다. The Alu Yb8 / 9 target sequence-concentrated library is amplified in a flow cell and sequenced using HiSeq equipment. The sequencing primer attaches to the starting region and synthesizes one nucleotide sequence from the opposite end of the target sequence. At this time, each A, T, G, C base sequence is synthesized with an oligonucleotide having a unique wavelength (Oligo Nucleotide) and proceeds by the Sequencing By Synthesis method. Each wavelength is determined by measuring the wavelength using a detection camera located inside the HiSeq to determine the sequencing.
- 단계 6 --Step 6-
차세대 염기서열해독이 종료된 후 염기서열을 결정해주고 bcl파일로 CASAVA라는 2차 분석 장비로 넘겨준다. 이때 Demultiplexing이라는 작업을 통해 각 샘플 별로 분류가 가능하며 fastq 파일을 생성해주며 Illumina에서 정의된 quality filters를 통해 Raw 데이터를 생성한다. Illumina 어댑터는 AluYb8/9 표적 서열이 아니기 때문에 cutadapt 1.1 version (https :// cutadapt . readthedocs .io/en/stable) 생명정보학 분석 도구를 이용하여 제거한다. AluYb8/9 표적 탐침자 서열을 제거한 게놈서열(genomic sequence)을 Bowtie (http://bowtie-bio.sourceforge.net) aligner 프로그램을 이용하여 인간 참조 유전체 서열에 맵핑(Mapping)을 진행하여 유사한 유전체 서열 영역에 정렬하는 단계를 진행한다. 정렬된 유전체 서열 내에 유의한 맵핑 정도를 보이는 표적 영역을 표시하기 위해 개발된 HOMER와 MACS2 두 개의 서로 다른 프로그램을 이용하여 공통적으로 검출한 표적 영역을 AluYb8/9 삽입영역으로 선별한다. After the next-generation sequencing is finished, the sequencing is determined and passed to a secondary analysis device called CASAVA as a bcl file. At this time, it is possible to classify for each sample through the operation called Demultiplexing, and it generates a fastq file and raw data through quality filters defined in Illumina. It is removed using: (// cutadapt readthedocs .io / en / stable. Https) bioinformatics analysis tools Illumina adapter cutadapt 1.1 version because it is not Yb8 Alu / 9 target sequences. A genomic sequence that removes the Alu Yb8 / 9 target probe sequence is mapped to a human reference genomic sequence using the Bowtie (http://bowtie-bio.sourceforge.net) aligner program, and similar genomes are mapped. The step of aligning to the sequence region proceeds. The target regions commonly detected using two different programs, HOMER and MACS2, developed to display target regions showing significant degree of mapping within the aligned genomic sequence are selected as Alu Yb8 / 9 insertion regions.
이 발명을 통해 개인 유전체 내 새롭게 삽입된 인간에 특이적인 AluYb8/9 유전인자 영역을 쉽고 빠르게 스크리닝 가능하며, 저렴한 가격으로 개인 유전체 내 AluYb8/9에 의한 유전학적 변이를 확인할 수 있다. 자동화 분석 방법을 이용해 임상의학 및 기초과학 연구자가 손쉽게 분석이 가능하며 AluYb8/9 유전인자에 국한된 변이 분석이 아닌 다른 목적 인자를 위한 탐침자 제작에 다양하게 이용 가능하다.Through this invention, the Alu Yb8 / 9 gene factor region specific to a newly inserted human in the personal genome can be quickly and easily screened, and the genetic variation caused by Alu Yb8 / 9 in the personal genome can be confirmed at a low price. It can be easily analyzed by researchers in clinical medicine and basic science using automated analysis methods, and it can be used in various ways to produce probes for other target factors other than mutation analysis limited to Alu Yb8 / 9 genetic factors.
<110> Dankook University Cheonan Campus Industry Academic Cooperation Foundation <120> Method for preparing DNA library for SINE targeted-probe enrichment using HiSeq sequencer <130> ADP-2019-0123 <160> 3 <170> KopatentIn 2.0 <210> 1 <211> 67 <212> DNA <213> Artificial Sequence <220> <223> Illumina HiSeq system-based NuGen adaptor sequence <400> 1 caagcagaag acggcatacg agatggagtt cagacgtgtg ctcttccgat ctgcaaggat 60 cgctctc 67 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> AluYb8/9-targeted sequence <400> 2 tgcagtgagc cgagattgcg ccactgcagt ccgcagtccg 40 <210> 3 <211> 107 <212> DNA <213> Artificial Sequence <220> <223> AluYb8/9-targeted Probe <400> 3 caagcagaag acggcatacg agatggagtt cagacgtgtg ctcttccgat ctgcaaggat 60 cgctctctgc agtgagccga gattgcgcca ctgcagtccg cagtccg 107 <110> Dankook University Cheonan Campus Industry Academic Cooperation Foundation <120> Method for preparing DNA library for SINE targeted-probe enrichment using HiSeq sequencer <130> ADP-2019-0123 <160> 3 <170> KopatentIn 2.0 <210> 1 <211> 67 <212> DNA <213> Artificial Sequence <220> <223> Illumina HiSeq system-based NuGen adapter sequence <400> 1 caagcagaag acggcatacg agatggagtt cagacgtgtg ctcttccgat ctgcaaggat 60 cgctctc 67 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> AluYb8 / 9-targeted sequence <400> 2 tgcagtgagc cgagattgcg ccactgcagt ccgcagtccg 40 <210> 3 <211> 107 <212> DNA <213> Artificial Sequence <220> <223> AluYb8 / 9-targeted Probe <400> 3 caagcagaag acggcatacg agatggagtt cagacgtgtg ctcttccgat ctgcaaggat 60 cgctctctgc agtgagccga gattgcgcca ctgcagtccg cagtccg 107
Claims (9)
상기 절편화된 DNA를 어댑터 접합시켜 양 말단을 평활화(end repair)시키는 단계;
상기 평활화된 DNA와, 서열번호 3으로 표시되는 이동성 유전인자 SINE의 아종(Subfamily) 중 AluYb8 또는 AluYb9를 표적하는 탐침자(probe)를 혼성화시키는 단계;
상기 혼성화된 DNA를 연장화시키는 단계; 및
상기 연장화된 DNA 단편 양 말단의 어댑터 서열을 이용하여 PCR 증폭시키는 단계를 포함하는 AluYb8 또는 AluYb9 표적용 DNA 라이브러리 제작 방법.Fragmenting the genomic DNA;
Adapter repairing the fragmented DNA to smooth both ends (end repair);
Hybridizing the smoothed DNA with a probe that targets Alu Yb8 or Alu Yb9 among the subfamily of the mobile genetic factor SINE represented by SEQ ID NO: 3;
Extending the hybridized DNA; And
Alu Yb8 or Alu Yb9 target DNA library production method comprising the step of PCR amplification using the adapter sequence at both ends of the extended DNA fragment.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020190063834A KR102102107B1 (en) | 2019-05-30 | 2019-05-30 | Method for preparing DNA library for SINE targeted-probe enrichment using HiSeq sequencer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020190063834A KR102102107B1 (en) | 2019-05-30 | 2019-05-30 | Method for preparing DNA library for SINE targeted-probe enrichment using HiSeq sequencer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| KR102102107B1 true KR102102107B1 (en) | 2020-04-20 |
Family
ID=70467317
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020190063834A KR102102107B1 (en) | 2019-05-30 | 2019-05-30 | Method for preparing DNA library for SINE targeted-probe enrichment using HiSeq sequencer |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR102102107B1 (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8663924B2 (en) | 2011-11-30 | 2014-03-04 | Agilent Technologies, Inc. | Quantitative PCR-based method to predict the efficiency of target enrichment for next-generation sequencing using repetitive DNA elements (lines/sines) as negative controls |
| JP2017512491A (en) * | 2014-02-27 | 2017-05-25 | アイゲノムクス インターナショナル ゲノミクス コーポレーション | Method for analysis of somatic cell mobile elements and use thereof |
| KR20180055905A (en) * | 2015-10-09 | 2018-05-25 | 아큐라젠 홀딩스 리미티드 | Methods and compositions for the enrichment of amplification products |
-
2019
- 2019-05-30 KR KR1020190063834A patent/KR102102107B1/en active IP Right Grant
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8663924B2 (en) | 2011-11-30 | 2014-03-04 | Agilent Technologies, Inc. | Quantitative PCR-based method to predict the efficiency of target enrichment for next-generation sequencing using repetitive DNA elements (lines/sines) as negative controls |
| JP2017512491A (en) * | 2014-02-27 | 2017-05-25 | アイゲノムクス インターナショナル ゲノミクス コーポレーション | Method for analysis of somatic cell mobile elements and use thereof |
| KR20180055905A (en) * | 2015-10-09 | 2018-05-25 | 아큐라젠 홀딩스 리미티드 | Methods and compositions for the enrichment of amplification products |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Van Dijk et al. | Ten years of next-generation sequencing technology | |
| Shendure et al. | DNA sequencing at 40: past, present and future | |
| Grada et al. | Next-generation sequencing: methodology and application | |
| AU2018331434B2 (en) | Universal short adapters with variable length non-random unique molecular identifiers | |
| ES2688458T5 (en) | Varietal nucleic acid count for genomic copy number information | |
| Duff et al. | Transgenic mouse models of Alzheimer's disease: how useful have they been for therapeutic development? | |
| AU2018261332A1 (en) | Optimal index sequences for multiplex massively parallel sequencing | |
| Eason et al. | Characterization of synthetic DNA bar codes in Saccharomyces cerevisiae gene-deletion strains | |
| KR20160122563A (en) | Method for predicting transplantation rejection using next generation sequencing | |
| CN103917654A (en) | Methods and systems for sequencing long nucleic acids | |
| TWI564393B (en) | Methods for full-length amplification of double-stranded linear nucleic acids of unknown sequences | |
| JP2022071064A (en) | High-molecular weight dna sample tracking tags for next generation sequencing | |
| Del Giacco et al. | Introduction to genomics | |
| WO2018161019A1 (en) | Methods for optimizing direct targeted sequencing | |
| CN110396539A (en) | For detecting the kit and method of hypertension medication related gene polymorphism | |
| Myllykangas et al. | Targeted deep resequencing of the human cancer genome using next-generation technologies | |
| Kapranov et al. | Beyond expression profiling: next generation uses of high density oligonucleotide arrays | |
| KR102102107B1 (en) | Method for preparing DNA library for SINE targeted-probe enrichment using HiSeq sequencer | |
| Yegnasubramanian | Explanatory chapter: next generation sequencing | |
| KR102024581B1 (en) | Method for preparing DNA library for LINE-1(L1HS) targeted-probe enrichment using HiSeq sequencer | |
| KR102027310B1 (en) | Method for preparing DNA library for LINE-1(L1HS) targeted-probe enrichment using Ion PGM sequencer | |
| CN114341638A (en) | Methods and compositions for proximity linking | |
| Taskova et al. | Tandem oligonucleotide probe annealing and elongation to discriminate viral sequence | |
| Ruchi | Bioinformatics: genomics and proteomics | |
| Devesa-Peiró et al. | Molecular biology approaches utilized in preimplantation genetics: real-time PCR, microarrays, next-generation sequencing, karyomapping, and others |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| E902 | Notification of reason for refusal | ||
| E701 | Decision to grant or registration of patent right | ||
| GRNT | Written decision to grant |