KR102102107B1 - Method for preparing DNA library for SINE targeted-probe enrichment using HiSeq sequencer - Google Patents

Abstract

The present invention relates to a method for producing a DNA library based on an HiSeq sequencer for selective discovery of a mobile genetic factor SINE. On the basis of clinical and academic values of mobile genetic factors, the development of a next-generation base sequence decoding technology, the reduction of costs, and the development of an analysis system, a method for analyzing an AluYb8/9-specific base sequence which can identify human-specific AluYb8/9 is developed to be used as a method for simply and rapidly studying individual genetic variation by AluYb8/9, and genetic influences thereby. In addition, on the basis of the present invention, it is possible to develop additional technologies for targeting only active mobile genetic factors that show mobility in a human genome including AluYb8/9 and can cause genetic variation. A targeting sequence data analysis method as well as mobile genetic factor targeting base sequence analysis are generalized, and thus can be expected to be used in developing clinical medical diagnostic markers.

Description

Method for preparing DNA library for SINE targeted-probe enrichment using HiSeq sequencer for selective discovery of the mobility genetic factor SINE

The present invention relates to a method of constructing a DNA library based on a HiSeq sequencer for selective discovery of a mobility gene SINE, and specifically, a mobility gene SINE ( Alu Yb8 and Alu Yb9) in the human genome using a HiSeq sequencer, a next-generation sequencing equipment. It is about the production of probe to selectively identify), experimental method and bioinformatics analysis pipeline construction.

Next-Generation Sequencing Technology (NGS technology) can perform multiple and large-scale sequencing from genetic material (DNA) at the same time, and can obtain high-throughput genomic data at relatively low cost in a short period of time. Technology. Since 2007, when this technology was commercialized, innovative technology improvement has been carried out every year, and application technology has been variously improved and developed accordingly.

In 2003, the Human Genome Project, led by the United States, involved 18 institutions from six developed countries, and spent 13 years and about $ 3 billion in cost to decode and interpret about 3 billion human-wide genomes. It was a completed worldwide project. However, using the next-generation sequencing technology, it is now possible to decode and interpret the entire genome of humans with a short time of about one week and relatively low cost. With the development of next-generation sequencing and analysis technology, it has been applied to all fields of biomedical science, producing a variety of intellectual property rights and becoming a great driving force for the growth of related industries. In addition, with the development of next-generation sequencing and analysis technology, new application technologies (eg, diagnostic markers) and development of original technologies are also required.

HiSeq next-generation sequencing equipment among Illumina's platforms in the United States is the most commonly used equipment among various genome data generation equipment types. Illumina's platform accounts for over 70% of the world's genomic data production and is highly reproducible and accurate. In addition, various papers and patents analyze and report data obtained using HiSeq equipment. HiSeq is a device that uses Illumina's Sequencing By Synthesis (SBS) technology and Cluster generation technology. After hybridizing and amplifying the adapter oligo and library existing on the surface of the flow cell, which is a glass chip, the fluorescence according to the type of nucleic acid synthesized one by one is measured. By doing so, it is the principle to decipher the sequence.

It is currently used in clinical and research fields that require high accuracy and large amounts of data, and there are application techniques for decoding various target sequences. In particular, it is a platform specialized in collective research on specific regions using the whole genome, transcripts, epigenetics, genomes, and target sequence amplification methods of large animals, including humans. The development of next-generation sequencing technology has had a huge impact on the entire genome analysis, and as library building methods are developed, it is possible to analyze the group sequencing by focusing on the target area desired by the researcher, so genetic differences in specific groups (eg, patient groups) It is a good basis for explaining.

However, the transposable element (TE), which causes genetic diseases such as cancer by causing changes in gene expression and genetic structure in the human genome, accounts for about 44%. These are very similar in sequence, so they cannot directly apply the next-generation sequencing technology, and research on methods for identifying and analyzing target sequences is insufficient. Mobility genes are classified into two classes according to the insertion mechanism: retrotransposon (Class I) and DNA transposon (Class II). Among them, retrotransposon is involved in genetic variation and diversity by transcribing ribohexane (RNA) itself and inserting it into a new genomic region through an insertion mechanism mediated by it.

Among the retrotransposons, the Alu family belonging to the Short INterspersed Element (SINE) factor is a genetic factor that accounts for more than 10% of the human genome. It is known that there are about 1 million copies in the human genome and is specifically inserted into the primate genome. Alu is composed of Left Arm and Right Arm based on Mid A-stretch existing at about 140 bp and is a mobility genetic factor of about 300 bp. Most Alu is known to have lost the genetic structural variation and SNP (single nucleotide polymorphism) genetic mobility of Alu by the accumulation of factor for a longer within primate evolutionary history. However, several recently inserted Alu and Alu Yb8 / 9 subfamily are still reported to have mobility, and they have been reported to have various effects on genetic regulation and structural changes related to human disease. Therefore, the genetic site of Alu Yb8 / 9 that is not reported in the reference genome and is newly inserted into the human genome is identified, and genetic variation studies by Alu Yb8 / 9 insertion are needed. A technique that can track the insertion of unreported Alu Yb8 / 9 can be used to develop a high-accuracy diagnostic marker if it is used for common mutation studies in a specific population.

U.S. registered patent US 8663924 (registered on March 4, 2014)

An object of the present invention is to construct a DNA library for a SINE target or a composition for preparing a SINE target DNA library comprising a probe that targets the mobile genetic factor SINE (Short Interspersed Element) as an active ingredient It is to provide a kit.

In addition, another object of the present invention is to provide a method for producing a DNA library for SINE targets using a probe that targets the mobile genetic factor Short Interspersed Element (SINE).

In order to achieve the above object, the present invention is a composition for preparing a DNA library for a SINE target comprising a probe targeting the mobility genetic factor SINE (Short Interspersed Element) represented by SEQ ID NO: 3 as an active ingredient Gives

In addition, the present invention provides a kit for constructing a DNA library for a SINE target containing a composition.

In addition, the present invention comprises the steps of fragmenting genomic DNA; Adapter repairing the fragmented DNA to smooth both ends (end repair); Hybridizing the smoothed DNA with a probe targeting the mobile genetic factor SINE represented by SEQ ID NO: 3; Extending the hybridized DNA; And PCR amplification using adapter sequences at both ends of the extended DNA fragment.

The present invention relates to a method of constructing a DNA library based on a HiSeq sequencer for selective discovery of a mobile genetic factor SINE, based on clinical and academic values of the mobile genetic factor, development of next-generation sequencing technology, cost reduction, and development of an analysis system A method to study the genetic variation of individuals and their genetic effects by Alu Yb8 / 9 simply and quickly by developing an Alu Yb8 / 9-target sequencing method that can identify human specific Alu Yb8 / 9 Can be In addition, based on the present invention, it is possible to develop additional technologies targeting only active mobility genetic factors that show mobility in the human genome, including Alu Yb8 / 9, and can cause genetic variation. It can be expected that the method of analyzing targeting sequence data as well as the sequencing targeting the migratory genetic factors can be used for the development of clinical diagnostic markers by simplifying the generalization.

1 shows a research procedure from genetic material processing for next-generation sequencing and analysis to Alu Yb8 / 9 targeted sequence data analysis method according to an embodiment of the present invention.
Figure 2 shows the Alu Yb8 / 9 target library construction process for next-generation sequencing according to an embodiment of the present invention.
3 shows a process of correcting / processing and bioinformatics analysis of next-generation sequencing data according to an embodiment of the present invention.

The present invention provides a composition for preparing a DNA library for a SINE target comprising a probe targeting the mobile genetic factor SINE (Short Interspersed Element) represented by SEQ ID NO: 3 as an active ingredient.

Preferably, the SINE may be Alu Yb8 or Alu Yb9.

Preferably, the DNA library is for next generation sequencing (NGS) analysis, and more preferably, the NGS analysis may be using an Illumina platform HiSeq sequencer, but is not limited thereto. no.

In addition, the present invention provides a kit for preparing a DNA library for SINE targets containing the composition.

Meanwhile, the kit may further include other instruments, solutions, and the like, which are generally used in the production of DNA libraries for SINE targets, but is not limited thereto.

In addition, the present invention comprises the steps of fragmenting genomic DNA; Adapter repairing the fragmented DNA to smooth both ends (end repair); Hybridizing the smoothed DNA with a probe targeting the mobile genetic factor SINE represented by SEQ ID NO: 3; Extending the hybridized DNA; And PCR amplification using adapter sequences at both ends of the extended DNA fragment.

Preferably, the SINE may be Alu Yb8 or Alu Yb9.

Preferably, the DNA library is for next generation sequencing (NGS) analysis, and more preferably, the NGS analysis may be using an Illumina platform HiSeq sequencer, but is not limited thereto. no.

Probes targeting the mobile genetic factor SINE represented by SEQ ID NO: 3 used in the present invention are Illumina HiSeq system-based NuGen adapter sequence (P7 adapter sequence) represented by SEQ ID NO: 1, and SEQ ID NO: 2 Alu Yb8 / 9-target sequence.

The DNA library for SINE target of the present invention can be applied to a HiSeq sequencer that is an Illumina platform equipment, and the adapter sequence used for HiSeq is divided into two types, a P5 adapter sequence and a P7 adapter sequence, and the P5 and P7 adapter sequences are directional. Therefore, it is divided. Usually, when the P7 adapter is attached to the template strand, it is the adapter at the position to start the first nucleotide analysis, and the P5 adapter is the adapter that can start reading the complementary opposite sequence through template strand conversion. Both of these adapters are complementary to the base sequence planted on the surface of the flow cell used in HiSeq equipment, so the library is filled with the flow cell by hybridizing and amplifying in the flow cell. The P5 adapter sequence and the P7 adapter sequence can use commercially published sequences.

Hereinafter, the present invention will be described in detail according to examples not limiting the present invention. It should be understood that the following examples of the present invention are only intended to embody the present invention and do not limit or limit the scope of the present invention. Therefore, from the detailed description and examples of the present invention, what can be easily inferred by experts in the technical field to which the present invention pertains is interpreted as belonging to the scope of the present invention.

< Example >

The present invention is to identify a structural variation due to the mobility genetic factor Alu Yb8 / 9 individually possessed in the individual genome by constructing a probe targeting Alu Yb8 / 9, which is known to exist specifically in the human genome. This makes it possible to develop highly accurate diagnostic markers through specific group research.

-Step 1-

The base which has a specific mobility genes Alu Yb8 / a 9 base sequence of the human reference genome database, the UCSC then detected both from genome databases through the Alu and multiple sequences jeongryeolbeop of different sub-species (Subfamily) Alu Yb8 / 9 The location of the target sequence probe was selected by identifying the sequence region.

The Alu Yb8 / 9 target probe contains a sequence located in the 3 'untranslated region of the Alu Yb8 / 9 factor and is a translation adapter sequence that can be applied to HiSeq (Illumina platform equipment) next-generation sequencing equipment. It was constructed.

The target sequence of the probe (Probe) prepared to accumulate the Alu Yb8 / 9 target nucleotide sequence, which is a mobility genetic factor according to an embodiment of the present invention, is shown in Table 1.

Usage Sequence (5'-Sequence-3 ') Illumina HiSeq system-based NuGen
adaptor sequence 5'-CAAGCAGAAGACGGCATACGAGATGGAGTTCAGACGTGTGCTCTTCCGATCT
GCAAGGATCGCTCTC-3 '(SEQ ID NO: 1) Alu Yb8 / 9-targeted sequence 5'-TGCAGTGAGCCGAGATTGCGCCACTGCAGTCCGCAGTCCG-3 '
(SEQ ID NO: 2) Manufactured Alu Yb8 / 9 target probe sequence
( Alu Yb8 / 9-targeted Probe) 5'-CAAGCAGAAGACGGCATACGAGATGGAGTTCAGACGTGTGCTCTTCCGATCT
GCAAGGATCGCTCTC
TGCAGTGAGCCGAGATTGCGCCACTGCAGTCCGCAGTCCG-3 '
(SEQ ID NO: 3)

-Step 2-

In order to fragment the genetic material in a form suitable for next-generation sequencing, it is cut to a size of about 550 bp using an ultrasonic DNA sonication system. In order to join the adapter that can be used for the HiSeq sequencing device, the segmented genetic material in the form of a sticky end is restored to the blunt end form through the end repair process (25 ℃ (30 minutes). 1 cycle and 70 ° C (10 minutes)). The adapter sequence used for HiSeq is divided into two types, the P5 adapter sequence and the P7 adapter sequence, and the P5 and P7 adapter sequences are divided according to orientation. Usually, when the P7 adapter is attached to the template strand, it is the adapter at the position to start the first nucleotide analysis, and the P5 adapter is the adapter that can start reading the complementary opposite sequence through template strand conversion. Both of these adapters are complementary to the base sequence planted on the surface of the flow cell used in HiSeq equipment, so the library is filled with the flow cell by hybridizing and amplifying in the flow cell. To use HiSeq, a next-generation sequencing device, the adapter sequence is conjugated to both ends of the fragmented genetic material (25 ° C (30 min) 1 cycle and 70 ° C (10 min)).

-Step 3-

Hybridization between the Alu Yb8 / 9 sequence and the genetic material present in the genetic material fragment using the Alu Yb8 / 9 target probe sequence (composed with the Illumina P7 adapter sequence) after the process of attaching the P5 adapter sequence to both ends of the fragmented genetic material After attaching (DNA hybridization), two sequences are attached. This process was performed using a polymerase chain reaction (PCR) device using a 500 ng P5 adapter fragment and 500 pM of Alu Yb8 / 9 target probe. 10 seconds, every cycle -0.1 ° C subtracted) 200 cycles, 60 ° C (16 hours) hybridization reaction between dielectric materials.

-Step 4-

After the hybridization of the genetic material is completed, the hybridized genetic material fragments are amplified through a polymerase chain reaction (PCR) after an extension operation (72 ° C (10 minutes)). In this process, a polymerase chain reaction is performed using primers corresponding to P5 and P7 adapters. The amplification reaction occurs selectively only when the fragment sequence of the genetic material containing Alu Yb8 / 9 targeted by the probe is conjugated (37 ° C (10 min), 95 ° C (3 min) 1 cycle, [95 ° C (30 Seconds), 62 ° C (15 seconds), 72 ° C (20 seconds) total 15 cycles], 72 ° C (3 minutes) 1 cycle, and 4 ° C (storage)). Samples of genetic material fragments amplified using P5 and P7 primers from Illumina are called libraries, and next-generation sequencing is performed using these libraries.

Preparation of genetic material fragmentation and target sequence amplification conditions applied in the experimental step for constructing a library for Alu Yb8 / 9 target sequencing according to an embodiment of the present invention are shown in Table 2.

DNA Fragmentation (Covaris S2 system (Covaris, Woburn, MA, USA)) Ultrasonication Duty cycle 10% Intensity 2 Cycles per Burst 200 Duration (seconds) 45 Water bath temperature 4 ℃ DNA end repair (PCR and End Repair Master Mix (NuGen, San Carlos, USA)) End repair 25 ℃ 30 minutes Enzyme deactivation 70 ℃ 10 minutes Adapter ligation (PCR and Ligation Master Mix (NuGen, San Carlos, USA)) Adapter ligation 25 ℃ 30 minutes Enzyme deactivation 70 ℃ 10 minutes Alu Yb8 / 9-targeted probe hybridization (PCR) Denaturation 95 ℃ 5 minutes Probe hybridization 80 ℃ (-0.1 ℃) 200 cycles 10 seconds in each cycle 60 ℃ 16 hours Library amplification (PCR and Target Enrichment Mix (NuGen, San Carlos, USA)) Initialization 37 ℃ 10 minutes Pre-denaturation 95 ℃ 3 minutes Denaturation 95 ℃ 30 seconds 15 cycles Annealing 62 ℃ 15 seconds Extension 72 ℃ 20 seconds Final extension 72 ℃ 3 min Storage 4 ℃ Hold

-Step 5-

The Alu Yb8 / 9 target sequence-concentrated library is amplified in a flow cell and sequenced using HiSeq equipment. The sequencing primer attaches to the starting region and synthesizes one nucleotide sequence from the opposite end of the target sequence. At this time, each A, T, G, C base sequence is synthesized with an oligonucleotide having a unique wavelength (Oligo Nucleotide) and proceeds by the Sequencing By Synthesis method. Each wavelength is determined by measuring the wavelength using a detection camera located inside the HiSeq to determine the sequencing.

-Step 6-

After the next-generation sequencing is finished, the sequencing is determined and passed to a secondary analysis device called CASAVA as a bcl file. At this time, it is possible to classify for each sample through the operation called Demultiplexing, and it generates a fastq file and raw data through quality filters defined in Illumina. It is removed using: (// cutadapt readthedocs .io / en / stable. Https) bioinformatics analysis tools Illumina adapter cutadapt 1.1 version because it is not Yb8 Alu / 9 target sequences. A genomic sequence that removes the Alu Yb8 / 9 target probe sequence is mapped to a human reference genomic sequence using the Bowtie (http://bowtie-bio.sourceforge.net) aligner program, and similar genomes are mapped. The step of aligning to the sequence region proceeds. The target regions commonly detected using two different programs, HOMER and MACS2, developed to display target regions showing significant degree of mapping within the aligned genomic sequence are selected as Alu Yb8 / 9 insertion regions.

Through this invention, the Alu Yb8 / 9 gene factor region specific to a newly inserted human in the personal genome can be quickly and easily screened, and the genetic variation caused by Alu Yb8 / 9 in the personal genome can be confirmed at a low price. It can be easily analyzed by researchers in clinical medicine and basic science using automated analysis methods, and it can be used in various ways to produce probes for other target factors other than mutation analysis limited to Alu Yb8 / 9 genetic factors.

<110> Dankook University Cheonan Campus Industry Academic Cooperation Foundation <120> Method for preparing DNA library for SINE targeted-probe          enrichment using HiSeq sequencer <130> ADP-2019-0123 <160> 3 <170> KopatentIn 2.0 <210> 1 <211> 67 <212> DNA <213> Artificial Sequence <220> <223> Illumina HiSeq system-based NuGen adapter sequence <400> 1 caagcagaag acggcatacg agatggagtt cagacgtgtg ctcttccgat ctgcaaggat 60 cgctctc 67 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> AluYb8 / 9-targeted sequence <400> 2 tgcagtgagc cgagattgcg ccactgcagt ccgcagtccg 40 <210> 3 <211> 107 <212> DNA <213> Artificial Sequence <220> <223> AluYb8 / 9-targeted Probe <400> 3 caagcagaag acggcatacg agatggagtt cagacgtgtg ctcttccgat ctgcaaggat 60 cgctctctgc agtgagccga gattgcgcca ctgcagtccg cagtccg 107

Claims (9)

In SEQ ID NO: 3 is shown, Alu Yb8 or Alu Yb9 table applies DNA library, which contains probes (probe) to target the Alu Yb8 or Alu Yb9 of mobile genetic elements SINE (Short INterspersed Element) Subspecies (Subfamily) of the active ingredient (library) Composition for production. delete The composition for preparing a DNA library for Alu Yb8 or Alu Yb9 target according to claim 1, wherein the DNA library is for next generation sequencing (NGS) analysis. The composition for preparing a DNA library for Alu Yb8 or Alu Yb9 target according to claim 3, wherein the NGS analysis uses an Illumina platform HiSeq sequencer. A kit for constructing a DNA library for Alu Yb8 or Alu Yb9 targets comprising the composition of any one of claims 1, 3, and 4. Fragmenting the genomic DNA;
Adapter repairing the fragmented DNA to smooth both ends (end repair);
Hybridizing the smoothed DNA with a probe that targets Alu Yb8 or Alu Yb9 among the subfamily of the mobile genetic factor SINE represented by SEQ ID NO: 3;
Extending the hybridized DNA; And
Alu Yb8 or Alu Yb9 target DNA library production method comprising the step of PCR amplification using the adapter sequence at both ends of the extended DNA fragment. delete 7. The method of claim 6, wherein the DNA library is for NGS analysis, Alu Yb8 or Alu Yb9 target DNA library production method. The method of claim 8, wherein the NGS analysis is performed using the Illumina platform HiSeq sequencer. A method for constructing a DNA library for Alu Yb8 or Alu Yb9 target.

Images