KR102023637B1 - Food or feed composition for improving cognitive function or memory comprising extract of desalted Salicornia europaea - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing, treating or improving cognition of dementia comprising an acanthoside B compound as an active ingredient. In the present invention, acanthoside B, an acetylcholine esterase inhibitory active ingredient isolated from desalted tongung extract and extracts, has superior neuroprotective activity through the inhibition of brain neuropathy, and is characterized by the memory loss-induced animal model induced by scopolamine. Passive avoidance test and Y-maze test were found to significantly improve memory and spatial cognition. The acantoside B or tung bark extract of the present invention may be applied to a pharmaceutical composition for preventing or treating dementia, a cognitive improvement pharmaceutical composition or a functional food or feed for improving memory and cognition.

Description

Food or feed composition for improving cognitive function or memory comprising extract of desalted Salicornia europaea}

The present invention relates to a pharmaceutical composition for preventing or treating dementia and improving cognitive function, which includes an extract of horsetail, and more specifically, a dementia comprising a horsetail extract comprising an acanthoside B compound as an active ingredient. It relates to a pharmaceutical composition for preventing or treating and improving cognitive function and a method of preparing the same.

Dementia is defined as impaired memory and cognitive impairment in everyday life, and Alzheimer's disease (AD) is a neurodegenerative disorder with clinical and pathologic memory and cognitive loss, mental and behavioral disorders. to be. This disease is the leading cause of senile dementia, with 20-50% of AD cases occurring in older people aged 85 or older. AD requires long-term treatment and social support for the patient's family and caregiver due to the nature of the disease, which amounts to $ 64 billion worldwide as of 2010. [Wimo A, Prince, M (2010) World Alzheimer Report 2010: The Global Economic Impact of Dementia (London: Alzheimer's Disease International). Already in many developed countries, dementia is considered a serious economic burden on patients, families and society. To date, the exact mechanism of the disease is not known, and due to the nature of the disease has a very complex pathogenesis, it is difficult to develop a treatment.

Various evidences suggest that memory loss, one of the symptoms of dementia, is related to the content of acetylcholine, a neurotransmitter. Based on the hypothesis that `` Cholinergic deficient hypothesis '', or dementia symptoms, is due to a decrease in acetylcholine in neuronal presynapse, after acetylcholine secretion and the number of cholinergic neurons have been demonstrated in the brain of patients with dementia, It has been accepted that treatment of dementia by increasing acetylcholine by inhibiting degrading enzymes [Francis PT, Palmer AM, Snape M, Wilcock GK (1999) The cholinergic hypothesis of Alzheimer's disease: a review of progress. Journal of neurology, neurosurgery, and psychiatry 66: 137-147].

In addition, as the concentration of acetylcholine esterase (AChE) increases in the cerebrovascular vessels, it has been reported that neuronal cholinergic neurotransmitters may be deficient and cause memory and cognitive impairment. Currently, all four FDA-approved therapies are known as acetylcholine esterase (AChE) inhibitors, including Tacrine (Cognex), Donepezil (Aricept), Rivastigmine (Exelon), and Galantamine (Reminyl). In addition to the above four drugs approved by the FDA, many therapeutic agents are currently in clinical trials. However, Tacrine is rarely used because of side effects such as drugs showing hepatic acetylcholine esterase inhibitory activity or hepatotoxicity, and it is known that Rivastigmine can cause vomiting and dizziness, and is difficult to administer at high concentrations effective for treatment. (Naik RS, Hartmann J, Kiewert C, Duysen EG, Lockridge O, Klein J (2009) Effects of rivastigmine and donepezil on brain acetylcholine levels in acetylcholinesterase-deficient mice.Journal of pharmacy & pharmaceutical sciences: a publication of the Canadian Society for Pharmaceutical Sciences, Societe canadienne des sciences pharmaceutics 12: 79-85).

Therefore, there is an urgent need to develop AChE inhibitors made from natural products that do not have side effects and toxicity to replace chemical synthetic drugs, and research on the prevention and treatment of dementia using new AChE inhibitor compounds derived from natural products is active. Development of next-generation AChE inhibitors for intravenous injection is also ongoing [Hong-Qi Y, Zhi-Kun S, Sheng-Di C (2012) Current advances in the treatment of Alzheimer's disease: focused on considerations targeting Abeta and tau. Translational neurodegeneration 1: 21].

Meanwhile, it is known that neuroinflammation is involved in the pathogenesis of neurological diseases such as Alzheimer's dementia, senile dementia, Parkinson's disease, multiple sclerosis, and AIDS dementia, and the inflammatory response due to hypersensitivity of microglia and astrocytes is representative. The main cause and effect of Parkinson's disease, one of the neurodegenerative diseases, has attracted attention.

Glial cells are one of the important cells that make up the central nervous system. Properly activated glial cells and well-regulated inflammatory responses have neuroprotective effects on neurons and tissues. If not, the inflammatory mediators they produce can be neurotoxic and can lead to degenerative mutations in nerve tissue.

Degenerative diseases of the cranial nervous system are disorders in which specific groups of neurons in the brain and spinal cord lose their function and decrease in the number of neurons. Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD).

Degenerative neurodegenerative disorders are the most important neurotransmitters and the formation of synapses that transmit information between brain neurons, through molecular biology and immunohistochemical staining research accumulated over the past 30 years. It is also known to be caused by functional problems or by an ideal increase or decrease in electrical activity of the cranial nerve. This phenomenon increases with age. The aging population is rapidly progressing around the world, especially in emerging economies and the West. In Korea, more than 8 million elderly people aged 65 or over accounted for 15.7% of the total population in 2015, and 40.1% in 2060. It is expected to be.

On the other hand, one of the major features of AD brain lesions is microgliosis, neuroneuritis, and many epidemiologic studies have shown that the prevalence of AD decreases with long-term administration of NSAIDs. A 10-year long-term project in Canada has also shown that the prevalence of AD decreases when NSAIDs are treated in a mildly cognitive impairment group. Therefore, in the case of mild and moderate cognitive impairment, it is expected that an inhibitor of inflammation of cerebral neurons can be used as an effective prophylactic and therapeutic agent. However, even in the case of the inflammatory drug Novartis COX-2 inhibitor, Prexige, lumiracoxib, has been withdrawn from Canada and Australia as a side effect, it has recently been reported that there are few side effects of neuronal cells with fewer side effects from natural products rather than conventional synthetic drugs. The development of prophylactic and therapeutic agents of AD using anti-inflammatory or protective drugs is drawing attention.

Salicornia spp. Is a 1 year-old herbaceous plant belonging to the family Ming Dynasty, and its salt resistance is strong, so it is possible to grow without sacrificing growth even in the cultivation of NaCl 200mM. Absolute salt that absolutely requires salt for growth Plant (Obligatory halophyte or True halophyte).

Solutes that contribute to osmotic control in absolute salt plants are known as osmotic organic substances. Representative osmotic substances that accumulate in cells include amino acids proline, onium compounds such as glycin betaine, sugar alcohols such as mannitol, sorbitol, inositol, and monosaccharide trehalose. Validation of suitable reference genes for gene expression analysis in the halophyte Salicornia europaea by real-time quantitative PCR. 2015.Front Plant Sci. 21 (5): 788].

It is an eco-friendly / sustainable crop that grows and eats seawater and does not need 'fertilizer' because of its high salinity. In particular, 'three crops' are possible in the subtropical and tropical regions, and it is an optimal model plant of 'Seawater Agriculture' suitable for the water shortage and food shortage due to global warming.

It is also known as a "mineral report" because it contains a large amount of vegetable salts in the body (NaCl, KCl, etc.), calcium, magnesium, potassium, and the like. It is also rich in nutrients such as dietary fiber and essential amino acids, and plant physiologically active substances such as chlorophyll, polyphenols, and flavonoids, which eliminate toxins and stool that have accumulated in the body since ancient times, and treat cancer, hypertension, diabetes, hepatitis, skin disease, and arthritis. The research on the bioactive substances of Korean native plants has been active for the past 10 years, and the functional research of Tungtun, a salt plant that has grown wild on the west coast of Korea, has been activated mainly by domestic researchers. Domestic and international academic papers and numerous patents have been derived.

In particular, choline in the bark is known as an important precursor of acetylcholine, a neurotransmitter, sphingomyelin, a neuronal component in the brain, and lecithin, a component of constituent cells in the brain. Is a substance that plays a major role in detoxification in the liver and is known to make a decisive contribution to reducing blood toxicity by removing body toxicity. [Study on Physicochemical Properties of Hamcho and Chil-myeon Cho, Journal of the Korean Society of Food Hygiene and Safety 2010. 25 (2): 170-179]

As the raw material itself contains a large amount of salt (more than 35%), it is used as a substitute for salt or preserves the salty taste in the currently marketed products of tung bark (powder, extract, pill, etc.). It is being developed as a low salt product through mixing. In addition, despite the various functional studies of the bark, there was a limitation in functional materialization of 100% bark or 100% bark due to the high concentration of sodium in the bark extract or powder. The present inventors possess the original technology regarding the functional reinforcing bark dechlorination material and its manufacturing method through desalination.

In the present invention, it was confirmed that the extract of desalted tongung had excellent acetylcholine esterase inhibitory activity, and isolated the acanthoside B compound as an active ingredient from the extract, the tongung extract and acanto The effect of side B compounds on the cytoprotective activity and the memory and cognitive improvement in amnesia animal model through the inhibition of neuroinflammation was confirmed. Accordingly, the present invention proposes a pharmaceutical composition and a functional food for preventing and treating dementia and improving cognitive ability containing desalted tongung extract or acantoside B compound as an active ingredient.

The present inventors made extensive efforts to develop a preventive or therapeutic agent for dementia as a drug having a low side effect of inhibiting neuronal cell nerve. As a result, the present inventors isolated the acanthoside B (acanthoside B) compound from the extract of Salicornia europaea , and the compound has the effect of improving the memory and cognitive abilities in the cell protective activity and the forgetful animal model through the inhibition of neuroinflammation. The present invention was completed by confirming the appearance.

Accordingly, it is an object of the present invention to provide a pharmaceutical composition for preventing, treating or improving cognitive dementia.

Another object of the present invention to provide a functional food or feed composition for improving cognition and memory.

It is another object of the present invention to provide a method for separating acanthoside B compounds.

According to an aspect of the present invention, the present invention comprises acanthoside B (Acanthoside B) represented by the following formula (1) or a medicament for preventing, treating or improving cognition of dementia comprising an pharmaceutically acceptable salt thereof as an active ingredient To provide a pharmaceutical composition.

[Formula 1]

The present inventors have made intensive studies to develop a preventive or therapeutic agent for dementia as a drug having low side effects, and thus, isolated acanthoside B compounds from the extract of Salicornia europaea , and the compound Inhibition of inflammation and cell protective activity and forgetfulness have been shown to improve memory and cognitive ability in animal models.

The present inventors freeze-dried the dried bark, pulverized, powdered and desalted using cold water, and then dehydrochlorinated or dehydrogenated the desalted powder, and then fractionated an organic solvent using chloroform, followed by column chromatography. Was carried out. After separation of a single substance by HPLC and structural analysis, it was confirmed that the acanthoside B (acanthoside B), the cell protective activity was confirmed.

In the present invention, after washing the lumps, lyophilized, hot air dried or crushed by drying, the obtained dried powders are desalted using cold water at 3-9 ° C. to obtain lumps demineralized products (eg, demineralized powders). Can be.

Deungkung bark extract defined in the present invention uses demineralized bark as a raw material, extraction is water or C1 to C4 lower alcohol or a mixed solvent thereof, more preferably desalted bark before extraction It includes the extract extracted with water or ethanol mixed solvent after decomposition.

The dementia of the present invention is Alzheimer's dementia, cerebrovascular dementia, neuroinflammatory dementia, and degenerative brain diseases (e.g., Dementia with Lewy Bodies (DLB), multiple infarct dementia). MID), frontotemporal lobar degeneration (FTLD), Pick's disease, Corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), Parkinson's disease, and Huntington's disease. It is not limited to this.

In the present invention, the pharmaceutical composition for improving cognition may be used in the same sense as the composition for improving memory disorder or improving memory.

As used herein, the term "comprising as an active ingredient" is meant to include an amount sufficient to achieve the efficacy or activity of the following acantoside B.

The acantoside B included in the composition of the present invention is a compound separated from the stalk of natural plant material, and the upper limit of the amount contained in the composition of the present invention can be carried out by those skilled in the art.

Acantoside B used as an active ingredient in the present invention may be used by itself or in the form of a salt, preferably in the form of a pharmaceutically acceptable salt.

As the salt, an acid addition salt formed by a pharmaceutically acceptable free acid is preferable. The free acid may be an organic acid or an inorganic acid.

The organic acid may be citric acid, acetic acid, lactic acid, tartaric acid, maleic acid, fumaric acid, formic acid, propionic acid, oxalic acid, trifluoroacetic acid, benzoic acid, gluconic acid, metasulfonic acid, glycolic acid, succinic acid, 4-toluenesulfonic acid, glutanoic acid, and aspartic acid. It includes, but is not limited to. In addition, the inorganic acid includes, but is not limited to, hydrochloric acid, bromic acid, sulfuric acid and phosphoric acid.

The pharmaceutical composition of the present invention may comprise a pharmaceutically acceptable carrier.

The pharmaceutically acceptable carrier is conventionally used in the preparation, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, Polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like.

In addition to the above components, the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention may be administered orally or parenterally, and in the case of parenteral administration, it may be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, or the like.

Suitable dosages of the pharmaceutical compositions of the invention vary depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, condition of food, time of administration, route of administration, rate of excretion and response to reaction, Usually a skilled practitioner can easily determine and prescribe a dosage effective for the desired treatment or prophylaxis.

According to a preferred embodiment of the present invention, the daily dose of the pharmaceutical composition of the present invention is 0.001-10000 mg / kg.

The pharmaceutical compositions of the present invention may be prepared in unit dosage form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container. In this case, the formulation may be in the form of a solution, suspension or emulsion in an oil or an aqueous medium, or may be in the form of extracts, powders, granules, tablets or capsules, and may further include a dispersant or stabilizer.

According to another aspect of the present invention, the present invention provides a functional food or feed composition for improving cognition and memory comprising acanthoside B represented by the following general formula (1) or an pharmaceutically acceptable salt thereof: .

[Formula 1]

Functional food or feed composition for improving the cognition and memory of the present invention is to use the same active ingredient acanthoside B (acanthoside B) as the pharmaceutical composition for preventing, treating or improving cognition of dementia of the present invention, The content in common between the two is omitted in order to avoid excessive complexity of the present specification.

When the composition of the present invention is a food composition, it may be prepared in the form of powder, granules, tablets, capsules or beverages. For example, there are various foods, beverages, gums, teas, vitamin complexes, or health supplements of candy.

The food composition of the present invention may include not only acantoside B as an active ingredient, but also components commonly added in preparing foods, and include, for example, proteins, carbohydrates, fats, nutrients, seasonings, and flavoring agents. do.

Examples of the above carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose, oligosaccharides and the like; And sugars such as conventional sugars such as polysaccharides such as dextrin, cyclodextrin and the like and xylitol, sorbitol, erythritol. As the flavoring agent, natural flavoring agents (tauumatin, stevia extract (for example rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used. For example, when the food composition of the present invention is prepared with a drink, in addition to the acantoside B compound of the present invention, citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, fruit juice, tofu extract, jujube extract, licorice extract, etc. Can be included.

On the other hand, because it has been used as an edible and folk medicine for a long time, it can be expected that the components extracted from it or the extract itself is free from problems such as toxicity and side effects. For this reason, the stalk extract or its fractional component can be developed for animal medicine and functional feed for the same purpose.

According to another embodiment of the present invention, the present invention provides a pharmaceutical composition for preventing or treating dementia and improving cognition including Salicornia spp. Extract, or including Salicornia spp. Extract It provides a functional food or feed composition for improving cognition and memory.

According to one embodiment of the present invention, the tongung extract can be obtained by extracting demineralized tongung with water or a low alcohol having 1 to 4 carbon atoms at a concentration of 50 to 100 (v / v,%).

According to another embodiment of the present invention, the tongung extract can be obtained by extracting dehydrogenated enzymatic hydrolyzate of tongung with water or a low alcohol having 1 to 4 carbon atoms at a concentration of 50 to 100 (v / v,%). have.

According to another aspect of the present invention, the present invention provides a method for separating an acanthoside B compound comprising the following steps:

(a) obtaining (i) a polar solvent extract or (ii) an enzymatic hydrolysis extract from Salicornia spp .;

(b) adding an acidic solution to the resultant of step (a) to remove the precipitate after stirring and standing;

(c) adding a basic solution to the product of step (b) and then adding a nonpolar organic solvent to obtain an alkaloid fraction; And

(d) purifying the alkaloid fraction of step (c) to obtain acanthoside B compound as a single substance.

Hereinafter, the acantoside B separation method of the present invention will be described in detail.

Step (a): Obtaining Stalk Extract

First, a suitable solvent is added to Salicornia spp. To obtain (i) polar solvent extract or (ii) enzymatic hydrolysis extract.

According to a particular embodiment of the present invention, said brack is a stem, leaf or stem / leaf region.

In the present invention, an extract is obtained by treating a spout or spout desalted solvent with a solvent. For example, debris (for example, demineralized powder) can be obtained by rinsing the bark and then crushing it by lyophilization or hot air drying or drying and desalting the obtained dry powder using cold water at 3-9 ° C. .

The polar solvents used in the separation method of the present invention are (i) water, (ii) alcohol (preferably methanol, ethanol, propanol, butanol, normal-propanol, iso-propanol, normal-butanol, 1-pentanol , 2-butoxyethanol or ethylene glycol), (iii) acetic acid, (iv) dimethyl-formamide (DMFO), and (v) dimethyl sulfoxide (DMSO). According to one embodiment of the present invention, the polar solvent is water or a low alcohol having 1 to 4 carbon atoms at a concentration of 50 to 100 (v / v,%).

The enzymes include, but are not limited to, cellulase, hemicellluase, pectinase and β-glucanase or combinations thereof.

Step (b): adding an acidic solution to remove the precipitate after stirring and standing

Subsequently, an acidic solution is added to the resultant of step (a), followed by stirring and standing to remove the precipitate.

According to one embodiment of the present invention, hydrochloric acid was added to the Rung bark extract obtained in step (a) and stirred, followed by standing at 4 ° C. for 12 hours. The precipitate produced in this process is removed by centrifugation and vacuum filtration.

In the present invention, the acid solution may use hydrochloric acid, acetic acid, sulfuric acid, and the like, but is not limited thereto.

Step (c): obtaining an alkaloid fraction

Next, the basic solution is added to the resultant of step (b) and reacted, followed by sequentially adding a nonpolar organic solvent to obtain an alkaloid fraction.

According to one embodiment of the present invention, 6N ammonia water was added to the resultant of step (b) to adjust the pH to 10 or more, and then chloroform was added to carry out a fractionation fraction. The chloroform fraction in the chloroform fraction can be removed with a vacuum volatilizer and then lyophilized to yield an alkaloid fraction (PM-AL) of desalinated bracts.

In the present invention, the basic solution may use ammonia water or caustic soda (NaOH), but is not limited thereto.

The nonpolar organic solvent used in the separation method of the present invention is chloroform, hexane, ethyl acetate, butanol, acetone, acetonitrile, methyl acetate, fluoroalkane, pentane, 2,2,4-trimethylpentane, decane, cyclohexane Cyclopentane, diisobutylene, 1-pentene, 1-chlorobutane, 1-chloropentane, o-xylene, diisopropylether, 2-chloropropane, toluene, 1-chloropropane, chlorobenzene, benzene, Diethyl ether, diethyl sulfide, diclobiromethane, 1,2-dichloroethane, anneal, diethylamine, ether, carbon tetrachloride or THF.

According to one embodiment of the invention, the nonpolar solvent is chloroform.

Step (d): separating acanthoside B

Finally, the alkaloid fraction of step (c) is purified to obtain a single compound acanthoside B.

In step (d), the alkaloid fraction of step (c) may be separated by high performance liquid chromatography.

The present inventors identified the molecular structure of the purely separated compound by the above method and found that it was acantoside B (Formula 1).

The features and advantages of the present invention are summarized as follows:

(a) The present invention relates to a pharmaceutical composition for preventing, treating or improving cognition of dementia comprising an acanthoside B compound as an active ingredient.

(b) In the present invention, acanthoside B, an acetylcholine esterase inhibitory active ingredient isolated from desalted tongung extract and extracts, has superior neuroprotective activity through the inhibition of brain neuropathy, and memory loss induced by scopolamine (scopolamine). Passive avoidance test and Y-maze test of animal model showed significant improvement in memory and spatial cognition.

(c) The acantoside B or tung bark extract of the present invention may be applied to a pharmaceutical composition for preventing or treating dementia, a cognitive improvement pharmaceutical composition or a health functional food or feed for improving memory and cognition.

1. HPLC chromatogram comparison of isolated S7-L3-3 (acanthoside B) compounds with major fractions during the purification of acetylcholine esterase inhibitory active compounds from demineralized Rhizome extract (PM-EE) and S7-L3-3 ( UV spectrum and chemical structure of acanthoside B).
2 is a schematic diagram of the separation and purification process of an AChE inhibitory active compound from demineralized bark extract (PM-EE).
Fig. 3. Comparison of AChE inhibitory activity of isolated S7-L3-3 (acanthoside B) compounds with major fractions during the purification of AChE inhibitory active compounds from demineralized bark extract (PM-EE).
4. ESI-MS spectrum of isolated compound S7-L3-3; (A) positive mode, (B) negative mode.
Figures 5A-5B. NMR analysis of isolated compound S7-L3-3; (5a) ¹ H-NMR spectrum, (5b) ¹³ C-NMR spectrum.
Figures 6a-6b. HMBC-NMR (6a) and ¹ H- ¹ H COSY (6b) spectra of isolated compound S7-L3-3.
7. Identification and chemical structure determination of S7-L3-3 through the conformational structure (A) of S7-L3-3 through ¹ H and ¹³ C-NMR and 2D-NMR analysis and intramolecular carbon and hydrogen positioning ( B).
8A-8B. Inhibitory Effect of Demineralized Rhizome Extract (PM-EE) on Inflammatory Neuroglial Cells; (8a) Inhibitory effect of PM-EE on LPS-induced nitric oxide (NO) production, (8b) Inhibitory effect of PM-EE on brain neuroinflammatory factor proteins (iNOS, COX-2).
Figure 9. Confirmation of the inhibitory effect of brain inflammation gene expression of desalted tongsae extract (PM-EE) via RT-PCR.
10A-10C. Inhibitory Effects of acanthoside B on Inflammatory Glial Cell Inflammation from Demineralized Rhizome Extract (PM-EE); (10a) Acanthoside B cytotoxicity test by MTT assay (10b) Inhibition of LPS-induced nitric oxide (NO) production of acanthoside B, (10c) Inhibition of the expression of acanthoside B cerebral neuroinflammatory factor proteins (iNOS, COX-2) effect.
Figure 11. Confirmation of the inhibitory effect of acanthoside B expression of the neurocancer gene expression isolated from desalted tongung extract (PM-EE) via RT-PCR.
12A-12B. Passive avoidance test of demineralized Rhizome extract (PM-EE) and acanthoside B in Scopolamine-type amnesia animal model; (12a) Treatment effect of PM-EE, (12b) Treatment effect of acanthoside B.
Figures 13A-13B. Y-maze experiments of demineralized Rhizome extract (PM-EE) and acanthoside B in Scopolamine-induced forgetful animal models; (13a) Treatment effect of PM-EE, (13b) Treatment effect of acanthoside B.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

Example

Example 1 Preparation of Various Extracts from Demineralized Dung Bark Dry Powder

Various extracts were extracted from 10g of Tungmad Desalted Powder prepared by cold and cold desalting method after harvesting and washing the leaves and stems before seed was formed in July-August. Prepared.

The hot water extract was added with 100 mL of distilled water to 10 g of de-salted powder, and subjected to reflux cooling extraction for 3 hours at 100 ± 1 ° C. after two ultrasonic treatments for 15 minutes. Thereafter, the supernatant obtained by cooling and centrifuging (10,000 rpm, 25 minutes) was concentrated in vacuo and lyophilized to prepare a hot water extract powder.

Methanol and ethanol extraction was performed by adding 100 mL of methanol and ethanol to 10 g of demineralized powder and then sonicating twice for 15 minutes, followed by reflux cooling extraction at a temperature near the boiling point of each solvent for 3 hours. After cooling, the supernatant obtained by filtration under reduced pressure and centrifugation (10,000rpm, 25min) was dried under reduced pressure and concentrated to remove each alcohol, suspended in distilled water, and then lyophilized to prepare methanol and ethanol extract powder.

In addition, the hydrolyzed alcohol extract was mixed with water, methanol or water and ethanol at a ratio of 1: 1 or 3: 7 (v / v) to prepare 50%, 70% methanol and 50%, 70% ethanol, respectively, 10 g. 100 mL of each desalted powder was added, and after 15 minutes of two sonication treatments, reflux cooling extraction was performed at a temperature near the boiling point for 3 hours. Subsequently, the supernatant obtained by cooling and depressurizing filtration and centrifugation was removed by alcohol drying through pressure-sensitive drying and then lyophilized to prepare 50% or 70% methanol and ethanol extract powder.

Example 2 Preparation of Various Extracts from Demineralized Enzyme Hydrolysates

After washing and drying the leaves and stems of the bark harvested from July to August, 60 ml of distilled water was added to 10g of the bark desalted powder prepared by cold and cold desalination, followed by two sonication treatments for 15 minutes, celluase, hemicelluase , pectinase and β-glucanase (Sigma Co, USA) were each added 0.1% (v / v) and subjected to enzymatic hydrolysis at 50 ° C. for 18 hours to obtain dehydrogenated yeast hydrolysates.

In the case of enzymatic hydrolysis hot water extract, 40 mL of distilled water was added to the dehydrogenated diaphragm hydrolyzate to carry out reflux cooling extraction in the same manner as in Example 1 to prepare an enzymatic hydrolysis hot water extract.

Methanol and ethanol extracts of demineralized hydrolytic enzyme hydrolysates were added to 100 mL of methanol and ethanol, respectively, for 15 minutes after sonication of the dehydrogenated hydrolyzed enzyme hydrolyzate. Reflux cooling extraction was performed for 3 hours at temperature. After cooling, the supernatant obtained by filtration under reduced pressure and centrifugation (10,000 rpm, 25 min) was removed by drying under reduced pressure and concentrated under reduced pressure, suspended in distilled water, and then lyophilized to remove methanol and ethanol from dehydrogenated hydrolysis enzyme. Extract powder was prepared.

50% methanol and 50% ethanol extract of demineralized hydrolytic enzyme hydrolyzate was prepared by adding the same amount of methanol or ethanol (60 mL, v / v = 1: 1) after enzyme hydrolysis and extracting in the same manner as in Example 1. .

70% methanol and 70% ethanol extract of demineralized hydrolytic enzyme hydrolyzate were prepared by adding 140 mL methanol or ethanol, respectively, and then extracting in the same manner as in Example 1.

Example 3. Determination of Acetylcholine esterase (AChE) Inhibitory Activity

As the concentration of acetylcholine esterase (AChE) increases in the cerebrovascular vessels, the deficiency of cholinergic neurotransmitters in neurons may cause memory and cognitive dysfunction. It can be used as a tool for the development of drugs or health functional ingredients. In the present invention, the AChE inhibitory activity of the purified fractions obtained from the desalted tongung extract, the desalted tongung enzyme hydrolysis extract, or the demineralized tongung extract was measured, and the measurement method was performed by partially modifying the Ellman's coupled enzyme assay.

In other words, add 170 μl of 100 mM Phosphate buffer (pH8), 20 μl of 2 mM dithiobisnitrobenzoic acid (DTNB), 20 μl of extraction sample, and dispense 20 μl of AChE 0.25U / mL in the Buffer into a 96-well microplate and pre-incubation at 37 ° C for 10 minutes. Subsequently, a substrate solution of 3.75 mM acetylcholine Iodide was added. After the enzyme reaction was incubated at 37 ° C for 10 minutes, the absorbance was measured at 410 nm UV-VIS microreader, and the absorbance (Ac) of the control group containing no substrate and sample was compared with the absorbance (As) of the test group. Inhibitory activity was calculated as follows.

AChE inhibitory activity (%) = [1- (As / Ac)] X 100

Ac: absorbance of the control group, As: absorbance of the sample group

Experimental Example 1. Yield and AChE Inhibitory Activity of Extracts from Demineralized Tuna

Table 1 shows the results of measuring AChE inhibitory activity at the same concentration (100 μg / mL) with respect to the various extracts of desalted tongap prepared in Example 1, and the yields of the extracts.

Yield and AChE Inhibitory Activity of Extracts from Demineralized Stalks - Hydrothermal Methanol ethanol 50% methanol 50% ethanol 70% methanol 70% ethanol Yield (%) 15.6 8.7 7.8 11.6 10.9 9.8 9.2 AChE inhibitory activity (%) 52.6 58.9 61.2 62.5 65.2 60.5 62.8

* Sample concentration: 100 μg / mL

As shown in Table 1, the demineralized hot water extract and methanol and ethanol or hydrolyzed methanol and ethanol extracts and hydrolyzed alcohol extracts showed high AChE inhibitory activity of 52.6% or more at a concentration of 100 μg / mL. In particular, the highest AChE inhibitory activity (65.2%) in the 50% ethanol extract and the highest yield (15.6%) in the hydrothermal extract were found.

Experimental Example 2 Yield and AChE Inhibitory Activity of Demineralized Kite Hydrolysates

Table 2 shows the results of measuring the AChE inhibitory activity and the yields of the extracts at the same concentration (100 μg / mL) for the various extracts of the desalted tungase enzyme hydrolyzate prepared in Example 2.

Yield and AChE Inhibitory Activity of Desalted Salty Hydrolysates - Hydrothermal Methanol ethanol 50% methanol 50% ethanol 70% methanol 70% ethanol Yield (%) 32.6 19.1 17.4 28.7 29.3 21.5 21.1 AChE inhibitory activity (%) 54.0 60.9 65.2 62.7 66.4 61.8 63.6

* Sample concentration: 100 μg / mL

As shown in Table 2, the hot water extract and the methanol and ethanol or the hydrolyzed methanol and ethanol extracts and the hydrolyzed alcohol extracts of the demineralized spondylolytic enzyme hydrolyzate were increased compared to the extracts before enzyme hydrolysis at a concentration of 100 μg / mL. In addition to showing the AChE inhibitory activity, it was found that the yield is particularly high.

This resulted in an increase in soluble components of water and alcohol as the macromolecular fiber in hydrolyzed was hydrolyzed through the action of enzymes such as celluase, hemicelluase, pectinase and β-glucanase.

In particular, demineralized hydrolytic enzyme hydrolyzate was used as a bulk extraction condition for the separation of active ingredients showing the highest AChE inhibitory activity (67.2%) and significant yield (29.3%) in 50% ethanol extract. 50% ethanol extraction was performed.

Example 4 Isolation and Purification of AChE Inhibitory Substances from Desalted Knots

4-1. Preparation of Demineralized Stun Bark Extract (PM-EE) and Alkaloid Fraction (PM-AL)

Based on the results of Experimental Examples 1 and 2, to separate the active ingredient exhibiting AChE inhibitory activity from the desalted tongung extract, the leaves and stems of the tongung harvested from July to August were washed and lyophilized, and then obtained by cold desalination. 3L of distilled water was added to 500 g of demineralized demineralized powder, and then mixed with celluase, hemicelluase, pectinase, and β-glucanase (Optivin Mash, Connell Bros Company, Australia), respectively, 0.3% (v / v). ) And enzymatic hydrolysis at 50 ° C. for 18 hours. An equal amount of ethanol was added to the resulting enzyme hydrolyzate, reflux cooled for 3 hours at 85 ± 1 ° C., followed by cooling and centrifuged at 4 ° C. and 10,000 rpm for 25 minutes. The obtained centrifuged supernatant was completely removed by ethanol at 45 ° C. under reduced pressure and lyophilized to obtain a desalted horsetail extract (PM-EE). The resulting extract PM-EE (100 g) was dissolved in 2 L of distilled water, 6N hydrochloric acid was added to adjust the pH to 2.0, stirred for 30 minutes, and allowed to stand at 4 ° C for 12 hours. The precipitate produced in this process was removed by centrifugation and vacuum filtration, and then the pH was adjusted to 10 or more by adding 6N ammonia water, and the fractions were partitioned into the same amount of chloroform. Equivalent amount of chloroform was added to the aqueous layer to carry out the second partitioned fraction in the separating funnel, and then the chloroform in the primary and secondary chloroform fractions was removed with a vacuum volatilizer, and then suspended in distilled water and lyophilized to remove the alkaloid fraction of the salty bark. -AL).

4-2: Column Chromatography Purification

PM-AL fraction (8 g) obtained in Example 4-1 was loaded on a column (3.3 x 40 cm) filled with polar silica gel (Silicagel 60G, Merck, Germany), and then the mobile phase with different mixing ratios of chloroform and methanol Eight fractions of 100 ml (PM-1, PM-2, PM-3, PM-4, PM-5, PM-6, PM-7, eluted at a rate of 0.3 ml / min using a solvent) PM-8) was obtained. Among them, a fraction (PM-S7, 187 mg) having excellent AChE inhibitory activity was dissolved in 3 ml of methanol after drying under reduced pressure, and a third column (2.5 × 33) filled with low molecular gel filtration Sephadex LH-20. 7 fractions (PM-7-L1, ˜L2, ˜L3, ˜L4, ˜L5, 50 cm each, followed by 100% methanol (flow rate 0.2 ml / min) as mobile phase solvent. , ~ L6, ~ L7). Finally, PM-S7-L3 fraction having the best AChE inhibitory activity among the seven fractions was concentrated under reduced pressure and lyophilized to obtain 90 mg.

4-3. Pure water separation by high performance liquid chromatography (HPLC)

PM-S7-L3 fraction (90 mg) obtained in Example 4-2 was dissolved in 2 ml of methanol for HPLC, filtered through a 0.22 μm filter, and then AChE inhibitory activity was determined using high-performance liquid chromatography for analysis and preparative. Strong single material (S7-L3-3) was isolated. Analytical HPLC was performed on a model equipped with a Solbox Eclipse C18 analytical column (Zorbax Eclips, 5 μm, 4.5 × 250 mm, Agilent) (1260 Infinity, Agilent, USA). The model (Multiple Preparative HPLC (LC-forte / R, YMC, Japan)) equipped with a rep column (Triart C18, 20 mm × 150 mm, 5 μm, YMC, Japan) was used. The solution was flowed at a flow rate of 1 ml / min under gradient conditions using tertiary distilled water containing% trifluoroacetic acid (TFA), and an Agilent, 1200 DAD detector or YMC-YUV-3400 UV detector was used. Pure fractionation of the compounds using the absorption in the wavelength range (254 and 210 nm) yielded compound S7-L3-3 1 (38.5 mg) at a retention time of 26.5 min. PM-EE), alkaloid fraction (PM-AL), PM purified fraction The analytical HPLC chromatogram profiles of -S7 and PM-S7-L3, and compound S7-L3-3, finally isolated by preparative HPLC, were compared. As purification progressed, the retention time of the active ingredient, S7-L3-3, The peak size of the 26.5 component was increased and the overall chromatogram was simple, and the UV spectrum and chemical structure of acanthoside B revealed by the structural analysis of purified S7-L3-3 were shown. Schematic diagram of the overall separation and purification of the active ingredient.

4-4. Identification and AChE Inhibitory Activity of Extracts from Purified Desalination ₅₀ value

Purified desalination extract (PM-EE), alkaloid fraction (PM-AL), and column chromatography purified from the purification of AChE inhibitory compound S7-L3-3 from Examples 4-1 to 4-3 AChE inhibitory activity of people (PM-S7 and PM-S7-L3) and the final isolated compound S7-L3-3 were measured and the concentration of each sample was repeated three or more times at concentrations of 100, 50 and 10 μg / mL, respectively. The average value of the experiment is shown in FIG. 3.

AChE inhibitory activity of demineralized Rhizome extract (PM-EE) at 6Og / mL concentration was 65.2%, which was considerably superior to fermented Aronia extract disclosed in Korean Patent Publication No. 10-2016-0088622, which was recently published. AChE inhibitory activity of the fractions was found to increase gradually.

In particular, it was confirmed that the AChE inhibitory activity of the final purified compound S7-L3-3 was significantly increased (93.2%) than PM-EE (25.8%) at a concentration of 10μg / mL. In addition, the concentration of 50% of the AChE inhibitory activity of the extracts and purified fractions at each stage, namely IC _50, was compared with the AChE inhibitor synthetic drug, galantamine, which is prescribed as a treatment for dementia, and berberine, which is isolated from natural products. 3) In addition, since the final purified compound S7-L3-3 was identified as acanthoside B through the structural analysis of Example 5 below, it was compared and compared with elutheroside E of the phenylpropanoid glycoside strain having a similar structure. Indicated.

Determination of AChE Inhibition IC ₅₀ Values of Demineralized Rhizome Extracts, Purified Fractions, and Purified Compounds (S7-L3-3) Sample name IC ₅₀ (μg / mL) PM-EE 78.9 ± 3.90 PM-AL 20.7 ± 1.23 PM-S7 10.5 ± 0.8 PM-S7-L3 4.4 ± 0.5 S7-L3-3 (acanthoside B) 2.8 ± 0.21 Tacrine 0.036 ± 0.01 Galantamine 3.6 ± 0.41 Berberine 10.7 ± 0.59 Elutheroside e 8.2 ± 0.37

Wherein as shown in Table 3, IC ₅₀ value of an AChE inhibitory activity IC ₅₀ value of each sample measurement, desalted Salicornia extract (PM-EE) was shown to 78.9 ± 3.9, the more purification is taking place, the value is It could be confirmed that the smaller, and the IC ₅₀ value of the final purified S7-L3-3 (acanthoside B) is 2.8 ± 0.21, indicating that the AChE inhibitory activity of the purification increased about 28-fold.

AChE inhibitory activity of S7-L3-3 (acanthoside B) was prescribed as an initial FDA-approved anti-dementia drug, but was lower than Tacrine (IC ₅₀ value: 0.038 ± 0.01), which is currently prohibited from clinical prescription due to hepatotoxicity. As an inhibitor, it was about 3.8 times better than galantamine (IC ₅₀ value: 3.6 ± 0.41), and berberine (IC ₅₀ value: 5.6 ± 0.19), which is AChE inhibitor compound.

Meanwhile, the IC ₅₀ value of elutheroside E, which has one more glucose molecule than acanthoside B as a similar structure of the phenylpropanoid glycoside line such as acanthoside B, was measured at 8.2 ± 0.37, which is S7- This means that L3-3 (acanthoside B) is 3 times stronger in AChE inhibitory activity than elutheroside E.

The difference in AChE inhibitory activity between elutheroside E and acanthoside B compounds showed that the degree of glucose substitution in the phenylpropanoid molecule acts as an important factor for AChE inhibitory activity.

Tung bark extract (PM-EE, IC ₅₀ : 78.9 ± 3.90) also showed previously reported mugwort extracts showing AChE inhibitory activity [Kor. J. Herbology 2009; 24 (4): 121-126] and aronia fermented extracts [Korea Patent Publication No. 10-2016-0088622] showed a higher level than both acanthoside B compound and sperm extract (PM-EE) side effects and toxicity It is suggested that it can be developed for the use of medicines and functional foods for preventing and treating dementia and improving cognition as a natural AChE inhibitory active material.

Example 5 Structural Analysis of Compound (S7-L3-3) Isolated from Demineralized Rhizome Extract (PM-EE) Showing AChE Inhibitory Activity

5-1. Determination of Molecular Weight and UV λmax of S7-L3-3

To determine the molecular weight of Compound S7-L3-3 isolated in Example 4-3, 1 mg of Compound A was positively determined by an electron-formation ionization (ESI) mass spectrometer (LC-ESI mass spectrometer, AGILENT 1100, USA Micromass Quattro II). And negative scans were performed and high resolution MS was measured (FIGS. 4A and 4B). UV maximum absorption band of the isolated compound S7-L3-3 was dissolved in methanol at a concentration of 1 mg / ml and then 190-400 nm region using an ultraviolet spectrometer (Genesys 10S UV-VIS spectrophotometer, Thermo Scientific, USA). Measured within.

5-2. Nuclear Magnetic Resonance (NMR) Analysis

Dry the compound S7-L3-3 (5 ㎎) was poured into 5 mm NMR tube was dissolved in CDCl ₃ (0.5 ml) and analyzed by JEOL model aircraft (JNM-ECA 600, Jeol, Japan), 1 H- NMR (FIG. 5A) was measured at 600 MHz and ¹³ C-NMR (FIG. 5B) was measured at 150 MHz. Then, the position and steric structure of hydrogen and carbon in compound S7-L3-3 were determined by HMBC-NMR (FIG. 6A) and ¹ H- ¹ H COZY-NMR (FIG. 6B) measurement (FIG. 7).

As a result of the above measurement, Compound S7-L3-3 has acanthoside B ((2S, 3R, 4S, 5S, 6R) -2- [4 having a molecular weight of 580, which has not been reported so far in the bark. [(3S, 3aR, 6S, 6aR) -3- (4-hydroxy-3,5-dimethoxyphenyl) -1,3,3a, 4,6,6a-hexahydrofuro [3,4-c] furan-6- yl] -2,6-dimethoxyphenoxy] -6- (hydroxymethyl) oxane-3,4,5-triol) and its physical and chemical properties are as follows.

(1) Molecular formula: C ₂₈ H ₃₆ O ₁₃

(2) Molecular weight: 580, ESI-MS: m / z 579.0 [MH] ⁺ , m / z 602.9 [M + Na] ⁺ (FIG. 4)

(3) UV lambda max: 210nm, 238sh, 272nm

(4) Appearance: white powder

(5) Solubility: Soluble in methanol, ethanol, ethyl acetate, chloroform, pyridine

(6) ¹ H and ¹³ C-NMR: ¹ H-NMR (CDCl ₃ , 600 MHz): d 6.47 (2H, s, H-2 and H-6), 4.62 (1H, d, J 4.6 Hz, H -7), 3.00 (1H, m, H-8), 3.81 (1 H, m, H-9a), 4.19 (1H, m, H-9b), 6.51 (2H, 1H, H-2 'and H -6 '), 4.65 (1H, H-7'), 4.50 (1H. H-1 "), 3.49 (1H, H-2"), 3.37 (1H, H-3 "), 3.41 (1H, H -4 "), 3.16 (1H. H-5"), 3.71 (1H, H-6 "a), 3.64 (1H, H-6" b), 3.77 (6H, s, 2-OCH3), 3.78 ( 6H, s, 2-OCH3) (FIG. 5A); ¹³ C-NMR (CDCl ₃ , 150 MHz): d131.2 (C-1), 102.3 (C-2), 147.3 (C-3), 134.4 ( C-4), 147.3 (C-5), 102.7 (C-6), 86.0 (C-7), 53.9 (C-8), 71.6 (C-9), 56.1 (2 X-OCH3), 56.2 ( 2 Y-OCH3), 138.2 (C-1 '), 102.9 (C-2'), 152.6 (C-3 '), 134.4 (C-4'), 152.6 (C-5 '), 102.9 (C- 6 '), 85.6 (C-7'), 54.2 (C-8 '), 71.7 (C-9'), 105.4 (C-1 "), 73.9 (C-2"), 75.9 (C-3 " ), 69.5 (C-4 "), 76.2 (C-5"), 61.5 (C-6 ") (Figure 5B)

(7) chemical structure

Example 6 Cerebral Neuroglial Protective Effect of Demineralized Rhizome Extract (PM-EE)

Experimental Example 1. Confirmation of the inhibitory effect of PM-EE protein expression

To determine the effect of LPS (200ng / ml), a desalination tongung extract (PM-EE, 0-100μg / mL), which is a test sample, on brain neuroglial cells, BV2 microglia stimulated with LPS, As a result of cytotoxicity test through MTT assay, it was confirmed that the cell viability did not change significantly compared to the control group in the concentration group of all test substances treated with LPS and PM-EE alone or together. Therefore, it was produced in mouse BV2 microglia cells stimulated with LPS (200ng / ml), a neuroinflammatory factor, in order to analyze the inhibitory effect of PM-EE (20, 50, 100μg / mL) on neuroinflammation in the non-cytotoxic concentration. Whether the nitrite (NO) is inhibited by PM-EE treatment, the intracellular LPS-induced nitrite (NO) content was measured by the NO assay using Griess reagent.

In the results of FIG. 8A, LPS-induced amplification of intracellular nitrite (NO) content was increased by about 9 times compared to the control group, but PM-EE was treated by concentration (20, 50, 100 μg / mL) as a result of nitrite ( NO) was significantly reduced in a concentration-dependent (Fig. 8a). In addition, the expression of inducible nitric oxide synthetase (iNOS) protein, which is a synthetic inducer of nitrite (NO) induced by LPS, and cyclooxygenase type 2 (COX-2) protein, known as an inflammatory factor in brain neurons, were detected by SDS-PAGE (SDS-polyacrylamide gel). As a result of Westin blotting using electrophoresis, it was confirmed that PM-EE inhibited the expression of iNOS and COX-2 at the protein level in a concentration-dependent manner (FIG. 8B).

Experimental Example 2. Confirmation of PM-EE Inhibitory Effect on Gene Inflammation

LPS and demineralized Rhizome extract (PM-EE) were treated in concentrations (0-100 μg / mL) in BV2 microglia, which are neuroglial cells, and stimulated with LPS after 1 hour, and RNA samples with RNA extraction buffer after 3 hours. Was separated. Thereafter, the RNA purification process was carried out to synthesize cDNA using RNA as a template and amplify by PCR, ie, RT-PCR. Table 4 below shows the primers used in the RT-PCR of this experiment, using the primers of Table 4 on RNA isolated from BV2 microglia cells at 95 ° C for 30 minutes, 95 ° C for 5 seconds, and 60 ° C for 20 seconds. After 45 consecutive reactions, the reaction was terminated after heating up to 95 ° C under 0.2 ° C / 15 sec. Finally, separation was carried out by abp size through agarose gel electrophoresis, and the fluorescence was imaged with a camera by checking the band under UV light. .

In the control group not treated with LPS as shown in the results of FIG. 9, the expression of brain cell inflammation-related genes (IL-1β, iNOS, COX-2, TNF-α) was low or insignificant, but in the experimental group treated with LPS, The expression level of mRNA was markedly increased, and the expression change pattern was decreased depending on the concentration of demineralized Rhizome extract (PM-EE).

In particular, by confirming that at high concentration (100 μg / mL), brain cell inflammation-related genes (IL-1β, iNOS, COX-2, TNF-α) genes amplified by LPS induction recover to almost the same level as the control group before LPS induction. This suggests that demineralized Rhizome extract (PM-EE) can strongly inhibit cerebral neuritis in the brain neuroglial BV2 microglia, from the mRNA gene level as well as the expression of inflammatory factor proteins, which in turn inhibits brain neuritis It is the result of confirming that brain damage can be improved by preventing damage.

Primer sequence used for RT-PCR Gene Sequence (5 '-> 3') iNOS Forward TGAAGAAAACCCCTTGTGCT iNOS Reverse TTCTGTGCTGTCCCAGTGAG COX2 Forward CAAGACAGATCATAAGCGAGGA COX2 Reverse GGCGCAGTTTATGTTGTCTGT TNF-α Forward CCACCACGCTCTTCTGTCTAC TNF-α Reverse AGGGTCTGGGCCATAGAACT IL-1 β Forward TGTGAAATGCCACCTTTTGA IL-1 β Reverse GGTCAAAGGTTTGGAAGCAG IL-6 Forward TGATGCACTTGCAGAAAACA IL-6 Reverse ACCAGAGGAAATTTTCAATAGGC GAPDH Forward AAGGGCTCATGACCACAGTC GAPDH Reverse TTCAGCTCTGGGATGACCTT

Example 7 Cerebral Neuroglial Protective Effects of Acanthoside B, an Active Ingredient Isolated from PM-EE

Experimental Example 1. Confirmation of the inhibitory effect of Acanthoside B protein expression

In order to determine the effect of LPS (200ng / ml) and acanthoside B, an active ingredient of PM-EE, on brain neuroglial cells in BV2 microglia, LPS-stimulated neuroglial cells (1, 5, 10μg / mL)) and cytotoxicity test through MTT assay (Fig. 10a), the cell viability was significantly higher than the control group in the concentration group of all test substances treated with LPS and acanthoside B alone or together. It was confirmed that it did not change. Therefore, in order to analyze the inhibitory effect of acanthoside B on neuroinflammation at a concentration without cytotoxicity (1, 5, 10μg / mL), it was produced in mouse BV2 microglia cells stimulated with LPS (200ng / mL), which is a neuroinflammatory factor. Nitrite (NO) was inhibited by acanthoside B treatment, and the intracellular LPS-induced nitrite (NO) content was measured by NO assay using Griess reagent. In the results of FIG. 10B, it was confirmed that LPS-induced amplification of intracellular nitrite (NO) was significantly reduced depending on the acanthoside B treatment concentration. In addition, acanthoside B was found to significantly reduce the expression of iNOS, a synthesis inducing enzyme of nitrite (NO) induced by LPS, and the protein of COX-2, an inflammatory factor in cerebral neurons (Fig. 10c). It was confirmed that EE inhibits protein expression of iNOS and COX-2 even at a significantly lower concentration than PM-EE as an active ingredient of neuronal cell inflammation suppression.

Experimental Example 2. Confirmation of the inhibitory effect of Acanthoside B gene expression

To investigate the effect of Acanthoside B on the gene expression of CNS factor, LPS and acanthoside B were treated in BV2 microglia, the neuroglial cells, by concentration (1, 5, 10μg / mL), and the cells were stimulated with LPS after 1 hour. After 3 hours, RNA samples were separated by RNA extraction buffer to synthesize cDNA, and RT-PCR was performed in the same manner as in Example 6 using the primers of Table 4 above.

As shown in the results of FIG. 11, there was no or minimal expression of genes related to inflammation of brain cells (IL-1β, iNOS, COX-2, TNF-α) in the control group not treated with LPS, but these genes in the experimental group treated with LPS. Their mRNA expression was significantly increased, and acanthoside B treatment showed a concentration-dependent decrease in expression.

In particular, by confirming that at a high concentration (10 μg / mL), brain cell inflammation-related genes (IL-1β, iNOS, COX-2, TNF-α) genes amplified by LPS induction recover to almost the same level as the control group before LPS induction. It was confirmed that acanthoside B isolated from PM-EE as an AChE inhibitory active ingredient can improve brain cognitive function by preventing cerebral neuropathy by preventing cerebral neuropathy by acting not only on inflammatory factor protein expression but also mRNA level. Could.

Example 8 Confirmation of Memory and Cognitive Improving Effects of Demineralized Rhizome Extract (PM-EE) and Its Active Ingredients (acanthoside B) in Cognitive Impaired Animal Models

Experimental Example 1. Analysis of cognitive and memory-improving efficacy of PM-EE and acanthoside B in in vivo cognitive impairment model

Cognitive and Memory of acanthoside B, an AChE Inhibitory and Neuronal Inflammation Inhibitor, Isolated from Examples of PM-EE and PM-EE from Example 4-2 and 4-3 Obtained in Example 4-1 In order to confirm the improvement effect, we tried to measure the effect of learning ability through passive avoidance experiment in Scopolamine-based forgetful animal model.

The mice were placed in brightly lit compartments, and after 20 seconds of exploration, the guillotine doors were opened to enter the dark compartments. Mice that did not enter the dark side within 60 seconds after the guillotine door was opened were excluded from the experiment. After the guillotine door was opened, the time until the mouse entered the dark side was measured. Once the mouse enters the dark side, the guillotine door closes and an electric shock of 0.25 mA flows through the bottom of the grid for 3 seconds and the mouse remembers this electrical action. The experiment was conducted 24 hours after the study test. Experiments consisted of 10 SD rats (240-260 g) in each group treated with concentrations of PM-EE and acanthoside B and dissolved in distilled water 30 minutes after the last dose of the test sample (Sigma-Aldrich, Co. USA). Intraperitoneally at a dose of 1 mg / kg, and 30 minutes after scopolamine administration, it takes 150 seconds for the mouse to open the guillotine door and enter all four feet in the dark (Transfer Latency Time, TLT). Measured up to seconds. The longer the time taken, the better the cognition and memory of passive avoidance. In addition, 10 mg / kg of dementia treatment galantamine (galantamine, Sigma-Aldrich, Co. USA) was administered as a positive control group apart from PM-EE and acanthoside B extract samples. The computer recorded the TLT (Transfer latency time), and in all the experiments, the retention time of the scopolamine-only group was significantly reduced, confirming that the memory and cognitive decline model was produced. In the mouse model with memory impairment, the treatment of PM-EE (Fig. 12a) and acanthoside B (Fig. 12b) improved impaired cognition and significantly increased the TLT. All these effects were concentration-dependent. In particular, high concentrations of PM-EE and acanthoside B showed better cognitive and memory-improving effects than galantamine, a dementia treatment (FIGS. 12A-12B).

Experimental Example 2. Analysis of cognition and memory improvement efficacy by Y-maize test

Cognitive and Memory of acanthoside B, an AChE Inhibitory and Neuronal Inflammation Inhibitor, Isolated from Examples of PM-EE and PM-EE from Example 4-2 and 4-3 Obtained in Example 4-1 Y-maize test was performed in an amnesia animal model using Scopolamine to confirm the improvement effect. In this experiment, PM-EE and acanthoside B were dissolved in 10% tween 80 and orally administered by concentration (PM-EE: acanthoside B). In addition, 10 mg / kg of dementia treatment galantamine (galantamine, Sigma-Aldrich, Co. USA) was administered as a positive control. The Y-maze experiment consists of three branches (A, B and C) made of black polyvinyl plastic, each arm is 50cm long, 10cm wide and 20cm high, with three arms folded at 120 degrees. The animals were carefully placed in the lab apparatus, allowed to move freely for 8 minutes, and the branches were recorded. One point (actual change, actual altenation) was given to three different branches in turn, and the alteration behavior was calculated by the following formula.

[formula]

Alteration behavior = actual alteration / maximum alternation X 100 (maximum change: total entries-2)

As a result, the behavior of normal animals, or control group, was 67 points, but it was reduced to 45.5 points by the administration of scopolamine, and the cognitive ability and memory were decreased. It was confirmed that spatial cognition is restored. Therefore, it was confirmed that PM-EE (FIG. 13A) and acanthoside B (FIG. 13B) within the concentration range used in this experiment showed better cognitive and memory improvement effects than galantamine, a dementia treatment agent.

Example 9 Single Dose Toxicity Test

Mice were subjected to a single dose toxicity test of demineralized Rhizome extract (PM-EE). As a result of a single dose toxicity test, PM-EE was not observed at all when administered at 2 g / kg of ICH as prescribed for 2 weeks, and no significant abnormalities were found in weight gain and feed intake. I could not. Therefore, it can be seen that the desalted tongung extract (PM-EE) containing the acanthoside B of the present invention can be developed as a drug for preventing and treating dementia and as a functional food ingredient and feed.

Claims (10)

A pharmaceutical composition for preventing, treating or improving cognitive function of dementia comprising an extract of demineralized Salicornia spp . The method of claim 1, wherein the dementia is Alzheimer's dementia, cerebrovascular dementia, neuroinflammatory dementia, dementia with Lewy Bodies (DLB), multi-infarct dementia (MID), frontotemporal dementia pharmaceutical composition, lobar degeneration (FTLD), Pick's disease, Corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), Parkinson's disease or Huntington's disease. The method of claim 1, wherein the desalted tongung extract is obtained by extracting desalted tongung with water or a low alcohol having 1 to 4 carbon atoms of 50 to 100 (v / v,%) concentration, pharmaceutical Composition. The method of claim 1, wherein the desalted tongung extract is obtained by extracting dehydrogenated tongung hydrolyzate with water or a low alcohol having 1 to 4 carbon atoms at a concentration of 50 to 100 (v / v,%). Phosphorus, pharmaceutical composition. Functional food composition for improving cognitive function and memory, including the desalted extract of Salicornia spp . The functional food of claim 5, wherein the desalted tongung extract is obtained by extracting desalted tongung with water or a low alcohol having 1 to 4 carbon atoms at a concentration of 50 to 100 (v / v,%). Composition. According to claim 5, The desalted extracts of debris is obtained by extracting the dehydrochlorinated enzymatic hydrolyzate with water or a low alcohol of 1 to 4 carbon atoms in a concentration of 50 to 100 (v / v,%) Phosphorus, nutraceutical composition. Feed composition for improving cognitive function and memory, including the extract of desalted Salicornia spp . The method according to claim 8, wherein the desalted extract of the debris is obtained by extracting desalted debris with a low alcohol of 1 to 4 carbon atoms in the concentration of 50 to 100 (v / v,%), feed composition . The method of claim 8, wherein the desalted tongung extract is obtained by extracting the dehydrogenated tongol hydrolyzate with water or a low alcohol having 1 to 4 carbon atoms at a concentration of 50 to 100 (v / v,%). Phosphorus, feed composition.

Images