KR101971358B1 - Use of guanine deaminase as a seborrheic keratosis diagnostic marker - Google Patents

Abstract

The present invention relates to a composition for the diagnosis of black mold, which comprises an agent for measuring the expression level of guanine deaminase, and specifically provides a method for diagnosing the possibility and / or occurrence of black mold in an early stage by providing a guanine deaminase as a marker for black mold diagnosis And / or diagnosed. In addition, by using the diagnostic marker, it is possible to distinguish between benign tumors, malignant tumors and melanoma tumors, so that appropriate treatment can be started early, and the expression and activity of the diagnostic markers can be controlled to be useful It is expected to be possible.

Description

Use of a guanine deaminase as a marker for black spot diagnosis {Use of guanine deaminase as a seborrheic keratosis diagnostic marker}

The present invention relates to the use of a guanine deaminase as a marker for black mold diagnosis, and more specifically to a black and white diagnostic composition comprising an agent for measuring the expression level of a guanine deaminase.

The melanin pigment produced in melanocytes of body skin is a phenolic polymer substance having a complex form of black pigment and protein and plays an important role in inhibiting skin damage caused by ultraviolet rays irradiated from the sun. Over-synthesis and accumulation of melanin not only causes serious aesthetic problems such as skin stains, freckles and senile lentigo, but also promotes skin aging and skin cancer (Hearing VJ et al., FASEB J , 5: 2902-2909,1991).

Symptoms are hyperpigmentation symptoms that occur on the skin exposed to the sun, and generally have symmetrical features. They rarely occur in places such as the eyes or chin that receive less sunlight. Therefore, it becomes more severe in summer when it is strong in sunlight, but becomes thinner in winter. It is not largely affected by sex, race or age, but is found mostly in Asian or Latino women. The cause of the disease is still unclear, but it is known to be caused mainly by exposure to sunlight, hormonal changes due to pregnancy, malnutrition, and endocrine diseases.

Prevention is important because it is difficult to completely remove the stain once it is important. If you can check the stain-prone skin in advance and make intensive preventive measures, you will be able to prevent stain generation more efficiently. However, as described above, since the cause of the stain has not yet been clearly clarified, it is difficult to predict stain formation in advance.

On the other hand, black blotch is a circular or elliptical brown or black speck or raised pattern that occurs on the exposed parts of the sun, and may appear on other parts such as face, back, back, arm, leg, etc. .

However, the causal relationship between the external stimuli (UV, ROS, etc.) and the occurrence of black spots is not clear during the black spot generation of the skin, so effective methods for controlling black spot occurrence have not been developed. In addition, attempts to understand the characteristics of various proteins in order to understand the characteristics of black rot, are limited to studies in culture systems in which cells are treated with efficacious substances (kojic acid, hydroquinone, etc.) or stimulus source (UV, ROS) It has its limits.

Disclosure of Invention Technical Problem [8] Accordingly, the present invention has been made in an effort to solve the problems of the prior art as described above, and the inventors of the present invention found a gene whose expression is increased in a spot or a black spot lesion area as compared with a normal skin area, The present inventors have completed the present invention.

Accordingly, an object of the present invention is to provide mRNA or guanine deaminase of a gene encoding guanine deaminase (GDA) as a stigma or black spot diagnostic marker.

It is another object of the present invention to provide a stigmata or blackblood diagnostic composition and a kit comprising an agent for measuring the mRNA level of a gene encoding a guanine demineralizing enzyme or the level of a guanine deminotoxin protein.

It is another object of the present invention to provide a method for providing information for predicting or diagnosing stigma or black spot occurrence using the stigma or black spot diagnostic marker.

It is another object of the present invention to provide a method for distinguishing blackheads from melanomas using the stigma or black spot diagnostic markers.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In order to attain the above object, there is provided a black and white diagnostic composition comprising an agent for measuring an mRNA level of a gene encoding guanine deaminase (GDA) or a level of a guanine deaminase protein.

In addition, the present invention provides a blackberry diagnostic kit comprising an agent for measuring the mRNA level of a gene encoding a guanine deaminase or the level of a guanine deminotoxin protein.

In one embodiment of the present invention, the gene encoding the guanine deaminase may have the nucleotide sequence of SEQ ID NO: 1.

In another embodiment of the present invention, the agent for measuring the mRNA level of the gene may be an antisense oligonucleotide, a sense oligonucleotide, a primer, or a probe that specifically binds to a gene encoding the guanine deminotase.

In another embodiment of the present invention, the agent for measuring the level of the enzyme protein may be an antibody specific for the guanidaminease protein.

The present invention also relates to a method for the treatment of (a) obtaining a lesional skin tissue of an individual; (B) measuring the amount of the gene expression amount or guanine desaminase protein encoding the guanine deaminase present in the skin tissue; And (c) comparing the measurement result of step (b) with a gene expression amount or a guanine deaminase protein amount encoding a guanine deaminase of a normal control skin tissue. A method for providing information for the user.

In one embodiment of the present invention, the method may further comprise the step of: if the expression level of the guanine deaminase gene or the amount of the guanine deaminase protein in the lesion skin tissue is increased as compared with the normal control group, Is determined to have occurred.

The present invention also relates to a method for the treatment of cancer, comprising the steps of: (a) obtaining lesional skin tissue from a suspected individual of black or black paper; (B) measuring the amount of gene expression or guanine deaminase protein encoding the guanine deaminase present in the skin tissue; And (c) when the expression level of guanine deaminase gene or the amount of guanine deaminase protein present in the dermal tissue of the lesion is larger than that of the normal control group, it is judged to be melanoma when it is less than or equal to that of the control group The method comprising the steps of: a.

In one embodiment of the present invention, the lesional skin tissue may comprise keratinocytes.

In another embodiment of the present invention, the skin tissue keratinocyte of step (b) and / or step (b) may be included or may be a culture solution or culture supernatant of the obtained keratinocyte.

In another embodiment of the present invention, the method for measuring the expression level of the gene may be selected from the group consisting of RT-PCR, Competitive RT-PCR, Realtime RT- PCR, RNase protection assay (RPA), Northern blotting, and DNA chips.

In another embodiment of the present invention, the method for measuring the amount of the enzyme protein includes Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Immunoprecipitation Assay, Complement Fixation Assay, Fluorescence Activated Cell Sorter (FACS), and Protein Chip Assay. The immunoprecipitation assay was performed using an immunoassay method, Ouchterlony immunodiffusion method, rocket immunoelectrophoresis, tissue immuno staining, immunoprecipitation assay, a protein chip, and the like.

The present invention also relates to a method for the treatment of cancer, comprising the steps of (A) treating a candidate substance to cells expressing guanine deaminase; (B) measuring the expression level of guanine deaminase in the cell or the culture medium of the cell; And (C) when the level of expression of the guanine deaminase is decreased as compared with the control group not treated with the candidate substance as a result of the measurement in the step (B), the candidate substance is judged to be a substance for preventing or treating blindness A method for screening a substance for preventing or treating schistosomiasis.

Also, the present invention provides a method for producing a cell line, comprising the steps of: (a) treating a candidate substance in a culture cell model in which keratinocyte and normal melanocyte cells overexpressing guanine deaminase are co-cultured; (b) measuring the expression level of guanine deaminase or melanin in the cell or a culture medium of the cell; And (c) if the expression level of guanine deaminase or melanin is decreased as compared with a control group not treated with the candidate substance as a result of the measurement in the step (b), the candidate substance is determined to be a substance for preventing or treating blindness; A method for screening a substance for preventing or treating schistosomiasis.

In one embodiment of the present invention, the measurement of step (B) and / or step (b) may be performed by RT-PCR, competitive RT-PCR, (RT-PCR), RNase protection assay (RPA), Northern blotting, DNA chip, Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay Immunoprecipitation Assay, Complement Fixation Assay, Fluorescence Activated Immunoprecipitation, Ouchterlony Immunoprecipitation, Rocket Immunoelectrophoresis, Tissue Immunoassay, Immunoprecipitation Assay, Complement Fixation Assay, Fluorescence Activated Cell Sorter, FACS, and protein chips.

The present invention provides an early diagnosis and / or diagnosis of the occurrence and / or occurrence of black spots by providing a guanine deaminase as a black spot diagnostic marker. In addition, by using the diagnostic marker, it is possible to distinguish between benign tumors, malignant tumors and melanoma tumors, so that appropriate treatment can be started early, and the expression and activity of the diagnostic markers can be controlled to be useful It is expected to be possible.

FIG. 1 is a diagram showing the results of microarray analysis in blotch and spiny skin tissue. FIG.
FIG. 2 is a graph comparing the ratio of the amount of GDA mRNA expressed in the lesion (L) to the lesion (L) relative to the top (N) using Real-tiem PCR.
FIG. 3 is a graph comparing the ratio of the amount of GDA mRNA expressed in the lesion (L) to the peak (L) using real-time PCR.
FIG. 4 is a graph showing the amount of GDA mRNA expressed in skin cells (keratinocytes (KC), fibroblasts (FB), and melanocytes (MC)) primary cultured using Real-tiem PCR.
FIG. 5 is a graph showing the expression of GDA by staining with the GDA antibody and Hoechst staining the top (N) and lesion (L) tissues of the black spot patient (# 1).
FIG. 6 is a graph showing the expression of GDA by staining with the GDA antibody and Hoechst staining the top (N) and lesion (L) tissues of the black spot patient (# 2).
FIG. 7 is a graph showing the expression of GDA by staining with the GDA antibody and Hoechst staining the top (N) and lesion (L) tissues of the dysthymic patient (# 1).
FIG. 8 is a graph showing the expression of GDA by staining with the GDA antibody and Hoechst staining the top (N) and lesion (L) tissues of dysthymia patient # 2.
FIG. 9A is a diagram schematically showing the cloning and transfection process of GDA for the production of GDA-overexpressing keratinocyte.
FIG. 9B is a view showing the dissolving solution of GDA-overexpressing keratinocyte and the amount of GDA mRNA in the culture supernatant.
FIG. 10 shows the increase in expression of tyrosinase and PMEL17 in normal melanocytes co-cultured with GDA-overexpressing keratinocytes.
FIG. 11 is a graph showing that the culture supernatant of GDA-overexpressing keratinocytes contains a large amount of melanocyte growth factors bFGF and SCF.
FIG. 12 is a diagram illustrating a process of culturing normal melanocytes in a culture medium in which a culture supernatant of GDA-overexpressing keratinocytes is mixed.
FIG. 13 is a graph showing that tyrosinase expression is increased in normal melanocytes cultured in a medium in which culture supernatants of GDA-overexpressing keratinocytes are mixed.
FIG. 14 is a graph showing that the expression of GDA in the melanoma lesion (L) tissue is reduced compared to the peak (N).
FIG. 15 shows the absence of GDA expression in nevus cells of the same origin as melanocytes.
FIG. 16 is a graph showing that tyrosinase expression is decreased when WE, LN, and SBE are treated in normal melanocytes co-cultured with GDA-overexpressing keratinocytes.

Seborrheic keratosis is a benign lesion caused by hyperpigmentation of epidermal cells and pigmentation by melanin overgrowth. It is often seen in the upper body such as face, back, back, arms, and legs as age gets older.

On the other hand, melanoma is the most dangerous form of cancer among skin cancer and is caused by malignant transformation of melanocytes. Although it is a benign tumor, sometimes it is difficult to distinguish it from melanoma and the naked eye. Therefore, early diagnosis of black blotch and study of methods to distinguish it from melanoma are needed.

The inventors of the present invention have specifically confirmed that the expression of guanine deaminase (GDA) is increased in the black pigment lesion or the lesion of the skin pigment in the skin pigment disease in the Examples, while the expression is not increased in the melanoma lesion portion , Thereby completing the present invention.

Hereinafter, the present invention will be described in detail.

The present invention is characterized in that mRNA or a guanine deaminase encoding a guanine deaminase (GDA) -encoding gene is provided as a stigma or black spot diagnostic marker.

The present inventors confirmed that the guanine deaminase gene is highly expressed in the stomach and acanthosis lesion tissues as compared to the top, and the nucleotide sequence of the guanine deaminase gene is shown in SEQ ID NO: 1.

Accordingly, the present invention relates to a diagnostic and diagnostic composition and / or kit including related products and / or applications comprising an agent for measuring the mRNA level of a gene encoding guanine deaminase (guanine deaminase) or the level of a guanine deaminase protein ≪ / RTI >

In one embodiment of the present invention, it has been confirmed that the expression of guanine deaminase is specifically increased in the stigma or spinal cord lesion tissue (see Example 2). Using the diagnostic marker according to the present invention, And the like.

In addition, the present invention provides a stamina or blackberry diagnostic kit comprising a substance that measures the level of expression of a guanine deaminase gene or the level of a guanine deminotase protein.

The kit of the present invention can diagnose spots or black spots by confirming the expression level of the mRNA or protein of the guanine deaminase gene. Further, by confirming the expression level of the gene or protein, it is possible to diagnose whether or not the pigmented skin disease is caused by black mold or melanoma. The kit of the present invention may further include one or more other component compositions, solutions, or devices suitable for the analysis method as well as primers, probes, antibodies, etc., preferably RT-PCR kits, microarray chip kits, A DNA chip kit, or a protein chip kit.

As a specific example, in the present invention, a kit for measuring the mRNA expression level of the gene may be a kit containing essential elements necessary for performing RT-PCR. RT-PCR kits contain enzymes such as test tubes or other appropriate containers, reaction buffers, deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC- Water (DEPC-water), sterile water, and the like.

In addition, the kit of the present invention may be a kit including essential elements necessary for performing the microarray. The microarray kit may include a substrate to which a cDNA corresponding to a gene or a fragment thereof is attached as a probe, and the substrate may include cDNA corresponding to a quantitative control gene or a fragment thereof, Can be easily produced by a production method commonly used in the art. In order to fabricate a microarray, a micropipetting method using a piezo electric method or a micropipetting method using a pin-shaped method to immobilize the detected marker on a substrate of a DNA chip using the probe as a probe DNA molecule A method using a spotter or the like is preferably used, but the present invention is not limited thereto. The substrate of the microarray chip is preferably coated with an activator selected from the group consisting of amino-silane, poly-L-lysine and aldehyde, but is not limited thereto. In addition, the substrate is preferably selected from the group consisting of slide glass, plastic, metal, silicon, nylon film, and nitrocellulose membrane, but is not limited thereto.

In addition, the kit of the present invention may be a kit containing essential elements necessary for performing a DNA chip. The DNA chip kit may include a substrate to which a cDNA or oligonucleotide corresponding to a gene or a fragment thereof is attached, and reagents, preparations, enzymes, and the like for producing a fluorescent-labeled probe. The substrate may also comprise a cDNA or oligonucleotide corresponding to a control gene or fragment thereof.

In addition, the present inventors have found that the expression of GDA in the tissue cells obtained from lesions of melanoma patients is not increased in melanoma lesion cells compared with the normal group (see Example 5) , It is possible to determine whether the pigmentation disease is black spot or melanoma.

Accordingly, the present invention provides a method for distinguishing blackhead and melanoma by measuring the amount of guanine deaminase gene expression or protein contained in a biological sample obtained from suspected individuals of black or black species. Specifically, when the amount of the guanine deaminase gene expression or protein contained in the biological sample is greater than the amount of the normal control group, the melanoma can be judged to be less than or equal to the amount of the black rot and the normal control group.

Also, the present invention provides a method for screening substances for preventing or treating schistosomiasis by treating a candidate substance to cells expressing guanine deaminase, and then detecting changes in the expression level of guanine deaminase in the cell or cell culture medium do. Specifically, when the expression level of the guanine deaminase after the treatment of the candidate substance is lower than that of the control group not treated with the candidate substance, the candidate substance may be used as a prophylactic or therapeutic agent for black spots. In addition, the cell for treating the candidate substance may be a cell expressing a guanine deaminase, a keratinocyte for overexpressing a guanine deaminase, or a melanocyte co-cultured with a culture supernatant of the cell.

Also, in one embodiment of the present invention, in order to select a stain or black rot herb, a candidate substance is treated with a culture cell model in which GDA-overexpressing keratinocytes and normal melanocytes are co-cultured, and GDA and tyrosinase (See Example 6). By treating the candidate cell with the cultured cell model and measuring the expression level of GDA or tyrosinase in the cell or cell culture medium, the substance for preventing or treating blastocyst Can be selected.

In the present invention, " diagnosis " means confirming a pathological state. For the purpose of the present invention, the diagnosis is made by confirming the presence or absence or expression level of a stigma or a black spot diagnostic marker, In addition, the diagnosis of the present invention includes checking the presence or absence of expression of the stigma or the black spot diagnostic marker and the degree of expression thereof to determine whether the stigma or the black spot is onset, development and alleviation.

In addition, the "diagnosis marker" can be used to distinguish lesional skin cells such as keratinocyte (KC), fibroblast (FB), or melanocyte (MC) from normal cells (Such as mRNA), lipids, glycolipids, proteins, glycoproteins, sugars (monosaccharides, disaccharides, oligosaccharides, etc.) that show an increase in lesional skin cells as compared with normal cells Organic biomolecules and the like.

In the present invention, the agent for measuring the mRNA level of the guanine deaminase gene may be an antisense oligonucleotide, a sense oligonucleotide, a primer, or a probe that specifically binds to the gene encoding the guanine deaminase, A substance that measures the level of a deaminase protein may be an antibody that specifically recognizes a guanine deaminase protein.

The term " primer " of the present invention means a base sequence having a short free 3 'hydroxyl group and can form a base pair with a complementary template, Quot; short sequence " The primer can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i.e., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures. At this time, the PCR conditions, the lengths of the sense and antisense primers can be modified based on those known in the art.

The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, " capping ", replacement of natural nucleotides with one or more homologues, and modifications between nucleotides, such as uncharged linkers, such as methylphosphonate, Phosphoamidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

The term " probe " in the present invention means a nucleic acid fragment such as RNA or DNA corresponding to a few nucleotides or hundreds of nucleotides that can specifically bind to mRNA and is labeled so that presence or absence of a specific mRNA Can be confirmed. The probe can be produced in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, or an RNA probe. Selection of suitable probes and hybridization conditions can be modified based on what is known in the art.

In the present invention, " antibody " means a specific protein molecule directed against an antigenic site. For purposes of the present invention, an antibody refers to an antibody that specifically binds to a marker protein and includes both polyclonal antibodies, monoclonal antibodies, and recombinant antibodies.

Since the nucleic acid sequence of the present invention is registered in the gene bank, a person skilled in the art can design an antisense oligonucleotide, a primer pair, or a probe that specifically amplifies a specific region of these genes based on the sequence.

The antisense oligonucleotides, sense oligonucleotides, primers, or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, capping, substitution with one or more of the natural nucleotide analogs, and modifications between nucleotides, such as uncharged linkers (e.g., methylphosphonate, phosphotriester, Amidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

In addition, the present invention provides a method for predicting the development of a stain or blotch, comprising the step of measuring the expression amount or protein amount of a guanine deaminase gene present in a biological sample obtained from an individual and comparing the amount of the protein with that of a normal control sample And a diagnostic method.

In the present invention, the " biological sample " is not limited as long as it is isolated from an individual, but is preferably a skin tissue of a pigmented lesion, and the skin tissue may include keratinocyte. In addition, when the amount of the guanine deaminase gene expressed in the biological sample or the amount of the protein is increased as compared with the control, it can be determined that the skin is susceptible to stain or black mold, and it is judged that the stain or black mold has progressed .

Means an animal such as a human, a non-human primate, a mouse, a rat, a dog, a cat, a horse, a rabbit, and a cow, more specifically, Means a mammal, preferably a human, in need of prediction or diagnosis of the likelihood and / or occurrence, or in need of differential diagnosis of blindness and melanoma.

In the present invention, the term " gene expression level measurement " refers to the measurement of the expression level of keratinocytes (KC), fibroblasts (FB) or melanocytes (MC) And determining the presence and expression level of the mRNA of the gene in the cell, and measuring the amount of the mRNA. For example, RT-PCR, competitive RT-PCR, real-time RT-PCR, and RNase protection assay (RPA). RNase protection assay, Northern blotting, DNA chip, and the like.

The agent for measuring the level of a gene in the present invention is preferably an antisense oligonucleotide, a primer pair or a probe. In the present invention, " antisense " means that the antisense oligomer is hybridized with the target sequence in the RNA by Watson-Crick base pairing to form the sequence of the nucleotide base, typically within the target sequence, And an oligomer having a backbone between subunits. Oligomers may have an exact sequence complement or approximate complementarity to the target sequence. This antisense oligomer can alter the processing of mRNA that blocks or inhibits translation of mRNA and produces splice variants of mRNA.

The expression " measurement of protein expression level " in the present invention refers to measurement of protein expression level in skin cells such as keratinocytes (KC), fibroblasts (FB) or melanocytes (MC) It is a process of confirming the presence and the degree of expression of protein, and measuring the amount of protein. Examples of the assay methods include Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis But are not limited to, tissue immuno staining, immunoprecipitation assays, complement fixation assays, fluorescence activated cell sorters (FACS), protein chips, and the like. The agent for measuring the protein expression level in the present invention is preferably an antibody.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[Example]

Example 1. Experimental Preparation and Experimental Method

1-1. Tissue sample

Samples were obtained by biopsy of the tops and lesions of two lesions of each of the spots or blindness patients. The tissue samples used in this example were approved by IRB of Dongguk University Hospital of Ilsan and they were agreed in advance by the participants to meet the requirements of the Declaration of Helsinki. The obtained samples were subjected to microarray analysis by the method of Example 1-2 below to confirm the expression level of GDA, and the results are shown in FIG.

1-2. Microarray analysis

The total RNA of skin samples was identified as PureLink RNA mini kit (Thermo Fisher Scientific, Rockford, IL, USA) according to the manufacturer's instructions. Total RNA quality and quantification was assessed by Agilent bioanalyzer 2100 analysis. Gene expression was analyzed by GeneChip® Prime view arrays (Affymetrix, Santa Clara, Calif.) Consisting of over 530,000 probes representing approximately 20,000 well-characterized human genes. The biotinylated cRNA was prepared according to the standard affinity protocol of 500 ng total RNA (Expression Analysis Technical Manual, 2001, Affymetrix). After splitting, 12 μg of aRNA was hybridized on an Affymetrix primeview array at 45 ° C. for 16 hours. The GeneChip probe array was stained with Affymetrix Fluidics Station 450 after washing. The stained GeneChip probe array was scanned with the Affymetrix GeneChip Scanner 3000 + 7G. Data were analyzed by robust multichip analysis (RMA) using standard scoring and global scaling in a standardized manner. After normalization, the log-transformed intensity values were analyzed using GeneSpring GX 13.1.1 (Agilent technologies, CA). Fold change filters were included as a requirement that the gene be present at least 200% of the upregulated gene control and less than 50% of the downregulated gene control.

1-3. Real-tiem PCR

For RT-PCR, cDNA was synthesized from total RNA using a cDNA synthesis kit (Promega, Fichburg, WI, USA). The amount of target mRNA was quantified by RT-PCR using a Light Cycler real-time PCR machine (Roche, Penzberg, Germany). The relative amount of mRNA was calculated as the ratio of each target to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The primer sequences used in this experiment are shown in Table 1 below.

5'-3 ' GDA forward CATAGTGACACCACGTTTTTCC GDA reverse CGATTTTCACTTATATGGCTCTGA GAPDH forward TCCACTGGCGTCTTCACC GAPDH reverse GGCAGAGATGATGACCCTTT

1-4. Immunohistochemical staining

A 5 쨉 m fragment of the human skin biopsy specimen was embedded in paraffin. After deparaffinization and rehydration, the cells were pre-incubated with 3% bovine serum albumin. The fragments were sequentially reacted with anti-GDA antibody and 1: 200 Alexa Fluor-labeled goat anti-mouse IgG (488; Molecular Probes, Eugene, Oreg.) And the nuclei were counterstained with Hoechst 33258 (Sigma-Aldrich) . Fluorescence images were evaluated using an image analysis system (Dp Manager 2.1; Olympus Optical Co., Tokyo, Japan).

1-5. Western bolt

The same amount of extracted protein was dissolved and transferred to nitrocellulose membrane. The membrane was incubated with antibodies against GDA, Tyrosinase, PMEL17 (Santa Cruz Biotechnology, Santa Cruz, Calif.). After incubation with appropriate anti-mouse, anti-rabbit anti-rabbit horseradish peroxidase-conjugated antibody (Thermo) and enhanced chemiluminescent solution (Thermo), the image input device (LAS-3000, Fuji Photo Film, Tokyo, Japan ). ≪ / RTI > To monitor the amount of protein loaded in each lane, the membrane was re-probed with mouse monoclonal anti-beta-actin antibody (Sigma) and processed as described above. Protein bands were then analyzed by density measurement.

Example 2. Microarray analysis of stain or black skin tissue

As shown in Fig. 1, the results of the experiment are shown in Table 1. The results are shown in Table 1. As a result, as shown in Fig. 1, the deduced amino acid of guanine deaminase guanine deaminase, GDA) was increased.

Example 3. Confirmation of GDA expression in spots or black spots

Based on the results of Example 2, the same experiment as Example 1-3 was conducted to reaffirm the mRNA expression level of GDA in the spot or black spot.

As a result, as shown in FIG. 2 and FIG. 3, it was confirmed that the expression of GDA mRNA in the lesion was increased in all 10 patients with blindness (FIG. 2) 3). Furthermore, as shown in FIG. 4, the expression of GDA mRNA was clearly observed in primary keratinocytes (KC), but mRNA expression was not observed in fibroblasts (FB) and melanocytes (MC).

In addition, in order to reaffirm the degree of mRNA expression of GDA in the top (N) and lesion (L) tissues of spots or blindness patients, experiments were conducted as in Example 1-4. As a result, , Gonorrhoeae (Figs. 5 and 6), or spots (Fig. 7 and 8), respectively.

Example 4. Promotion of Melanogenesis Promotion by Overexpression of GDA in Keratinocytes

4-1. Production of GDA-overexpressing keratinocyte

In order to confirm that GDA overexpression activates melanogenesis, GDA-overexpressing keratinocytes were prepared as shown in FIG. 9A. Specifically, to construct a vector overexpressing GDA, a primer that has a gene sequence recognized by EcoRI and HindIII and specifically adhered to the GDA gene was prepared, and PCR was performed using human GDA clone (origene, Rockville, MD) And the amplified GDA was reacted with EcoRI and HindIII (promega) at 37 ° C for 4 hours. At the same time, the pCMV6-XL5 vector was also reacted with the same restriction enzymes. After restriction enzyme treatment, vector and amplified GDA were ligated to obtain a vector overexpressing GDA.

To culture keratinocytes, each epithelial cell was cultured in EpiLife Medium (Invitrogen) supplemented with bovine pituitary extract, bovine insulin, hydrocortisone, human epithelial growth factor, and bovine transferrin (HKGS; Invitrogen Carlsbad, CA) And suspended at a concentration of 2 x 10 < ⁵ > per 2 ml. After incubation for 24 hours, keratinocytes were suspended in a mixture of 5 μl of lipofectamine 2000 (Invitrogen) and 1 μg of GDA-overexpressing vector to induce overexpression of GDA in the cells, and cultured for 4 hours. Lipofectamine 2000 and GDA The over-expression vector was removed and the new culture was added. And cultured for 24 hours and 48 hours, respectively, to obtain keratinized cells overexpressing GDA.

Then, the amount of GDA in the culture supernatant and the lysate of GDA-overexpressing keratinocytes prepared by the above method was confirmed using the Western blotting method described in Example 1-5 above.

As a result, as shown in FIG. 9B, it was confirmed that the amount of GDA contained in the culture supernatant of GDA-overexpressing keratinocyte increased at 48 hours after 24 hours of incubation.

4-2. Confirming the effect of GDA-overexpressing keratinocytes on promoting melanogenesis

In order to confirm the production of melanin by GDA expression, keratinocytes over-expressing GDA prepared by the method of Example 4-1 and melanocytes cultured in 5 normal tissues were co-cultured to prepare tyrosinase and PMEL17 mRNA expression level. At this time, tyrosinase is known as an enzyme that promotes melanin production, and PMEL17 corresponds to a melanin gene in the skin. The amount of mRNA was corrected by the amount of β-actin, which is the antisense gene.

As a result, as shown in Fig. 10, it was confirmed that the degree of expression of GDA was higher than that of 48 hours of culture after 24 hours of culture, and in the case of tyrosinase, the expression was increased by GDA overexpression And it was also confirmed that the difference was much larger after 24 hours of incubation. Expression of PMEL17 was similar.

4-3. Confirmation of melanogenesis promoting effect of culture supernatant of GDA-overexpressing keratinocytes

In order to confirm the melanin promoting effect of the cultured supernatant of the keratinocytes overexpressing GDA, the keratinocyte cells overexpressing GDA were prepared as described in Example 4-1, and the keratinocytes overexpressing GDA Culture supernatants were separated 24 hours and 48 hours after the incubation and the amount of melanocyte growth factors bFGF and SCF was measured by ELISA (R & D systems, Minneapolis, MN).

As a result, as shown in Fig. 11, a significant increase in bFGF and SCF was found in the culture supernatant after 24 hours of incubation. These results suggest that the secretion of melanocyte growth factor in the keratinocytes overexpressing GDA is increased, ultimately leading to promotion of melanin production.

Next, based on the results of Example 4-2, in order to confirm the melanin promoting effect of the culture supernatant of keratinocytes overexpressing GDA, the culture supernatant of GDA-overexpressing keratinocytes was cultured as shown in Fig. Normal melanocytes were cultured in the mixed medium to confirm the expression level of tyrosinase. The amount of mRNA was corrected by the amount of β-actin, which is the antisense gene.

As a result, as shown in Fig. 13, it was confirmed that the expression of tyrosinase in melanocytes was increased by treatment of the culture supernatant of GDA-overexpressing keratinocytes.

Example 5. Distinction of melanoma and blackberry

5-1. Characterization of melanoma tissue samples and samples

Samples were obtained by biopsy of the tops and lesions of two melanoma patients. One of the patients was sampled by biopsy of the tissues in two places where the symptoms of the lesion were mild and severe. The tissue samples received IRB approval from Ilsan Dongguk University Hospital and were approved by the participants in advance to meet the requirements of the Helsinki Declaration.

Subsequently, the microarray was carried out by the method of Example 1-2 to confirm the expression level of GDA in the top (N) and melanoma lesion (L) tissues. The results are shown in FIG.

As a result, as shown in Fig. 14, a significant decrease in GDA expression was observed in the melanoma lesions in the two samples, and the decrease in the expression of GDA was observed in one sample although not significant. This result suggests that the diagnosis of blindness or melanoma can be made by comparing the amount of GDA expression or the amount of GDA with that of the normal group by taking a tissue sample from a lesion site of a suspected patient of black or black paper.

5-2. Identification of nascent tissue samples and samples

To obtain nodule tissue samples, paraffin blocks were selected from six patients who had undergone biopsy under the diagnosis of dysplastic nevus. In order to confirm the expression level of GDA in Nevus cells, the sections were immunohistochemically stained by the method of Example 1-4. In order to determine whether the immunofluorescent staining site is the correct lesion site, images were taken using an optical microscope (Olympus BX53) and compared and confirmed.

As a result, as shown in Fig. 15, it was confirmed that GDA was not expressed in nevus cells having the same origin as melanocytes.

Example 6. Screening of Substance Treating Materials

⁵ × 10 ⁴ normal melanocytes were floated and co-cultured with keratinocytes overexpressing GDA prepared by the method of Example 4-1, in order to select substances for treatment of black rot. 24 hours after the co-culture, 100 ppm WE, 150 ppm LN and 2 ppm SBE were added. For the appropriate concentration of each candidate substance, information on the actual usable concentration was provided and it was confirmed whether these concentrations did not cause cytotoxicity. 24 hours after the addition of the candidate substance, the co-cultured cells were extracted and Western blot was performed by the method of Example 1-5 to confirm expression of tyrosinase. The expression level of tyrosinase was corrected by the amount of β-actin, which is an antagonistic gene.

As a result, as shown in Fig. 16, when the candidate substances WE, LN, and SBE were treated, the amount of tyrosinase expression was significantly decreased.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> Dongguk University Industry-Academy Cooperation Foundation <120> Use of guanine deaminase as a seborrheic keratosis diagnostic          marker <130> MP17-211 <150> KR 10-2016-0123008 <151> 2016-09-26 <160> 1 <170> KoPatentin 3.0 <210> 1 <211> 1365 <212> DNA <213> guanine deaminase <400> 1 atgtgtgccg ctcagatgcc gcccctggcg cacatcttcc gagggacgtt cgtccactcc 60 acctggacct gccccatgga ggtgctgcgg gatcacctcc tcggcgtgag cgacagcggc 120 aaaatagtgt ttttagaaga agcatctcaa caggaaaaac tggccaaaga atggtgcttc 180 aagccgtgtg aaataagaga actgagccac catgagttct tcatgcctgg gctggttgat 240 acacacatcc atgcctctca gtattccttt gctggaagta gcatagacct gccactcttg 300 gagtggctga ccaagtacac atttcctgca gaacacagat tccagaacat cgactttgca 360 gaagaagtat ataccagagt tgtcaggaga acactaaaga atggaacaac cacagcttgt 420 tactttgcaa caattcacac tgactcatct ctgctccttg ccgacattac agataaattt 480 ggacagcggg catttgtggg caaagtttgc atggatttga atgacacttt tccagaatac 540 aaggagacca ctgaggaatc gatcaaggaa actgagagat ttgtgtcaga aatgctccaa 600 aagaactatt ctagagtgaa gcccatagtg acaccacgtt tttccctctc ctgctctgag 660 actttgatgg gtgaactggg caacattgct aaaacccgtg atttgcacat tcagagccat 720 ataagtgaaa atcgtgatga agttgaagct gtgaaaaact tataccccag ttataaaaac 780 tacacatctg tgtatgataa aaacaatctt ttgacaaata agacagtgat ggcacacggc 840 tgctacctct ctgcagaaga actgaacgta ttccatgaac gaggagcatc catcgcacac 900 tgtcccaatt ctaatttatc gctcagcagt ggatttctaa atgtgctaga agtcctgaaa 960 catgaagtca agatagggct gggtacagac gtggctggtg gctattcata ttccatgctt 1020 gatgcaatca gaagagcagt gatggtttcc aatatccttt taattaataa ggtaaatgag 1080 aaaagcctca ccctcaaaga agtcttcaga ctagctactc ttggaggaag ccaagccctg 1140 gggctggatg gtgagattgg aaactttgaa gtgggcaagg aatttgatgc catcctgatc 1200 aaccccaaag catccgactc tcccattgac ctgttttatg gggacttttt tggtgatatt 1260 tctgaggctg ttatccagaa gttcctctat ctaggagatg atcgaaatat tgaagaggtt 1320 tatgtgggcg gaaagcaggt ggttccgttt tccagctcag tgtaa 1365

Claims (18)

A composition for the diagnosis of black rot, comprising an agent for measuring an mRNA level of a gene encoding a guanine deaminase or a level of a guanine deminotypic enzyme protein.
The method according to claim 1,
Wherein the gene encoding the guanine deaminase comprises the nucleotide sequence of SEQ ID NO: 1.
The method according to claim 1,
Wherein the agent for measuring the mRNA level of the gene is an antisense oligonucleotide, a sense oligonucleotide, a primer, or a probe that specifically binds to a gene encoding the guanine deaminase.
The method according to claim 1,
Wherein the agent for measuring the level of the guanine deaminase protein is an antibody specific to the guanine deaminase protein.
A kit for the diagnosis of black rot, comprising an agent for measuring the mRNA level of a gene encoding guanine deaminase or the level of a guanine deminotypic enzyme protein.
6. The method of claim 5,
Wherein the agent for measuring the mRNA level of the gene is an antisense oligonucleotide, a sense oligonucleotide, a primer, or a probe that specifically binds to a gene encoding the guanine deaminase.
6. The method of claim 5,
Wherein the preparation for measuring the level of the guanine deaminase protein is an antibody specific to the guanine deaminase protein.
(A) measuring the amount of a gene expression amount or a guanine deaminase protein encoding a guanine deaminase present in the cutaneous tissue of the diseased lesion; And
(B) comparing the measurement result of the step (a) with a gene expression amount or an amount of a guanine deaminase protein encoding a guanine deaminase of a normal control skin tissue,
Wherein the skin tissue comprises keratinocytes. &Lt; RTI ID = 0.0 &gt; 25. &lt; / RTI &gt;
delete 9. The method of claim 8,
RT-PCR, competitive RT-PCR, real-time RT-PCR, and RNase protection assay (RPA) are used to measure the expression level of the gene. RNase protection assay, Northern blotting, and DNA chip. 2. The method according to claim 1,
9. The method of claim 8,
Methods for measuring the amount of the guanine deaminase protein include Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion , Immunohistochemistry, immunohistochemistry, immunoassay, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assays, complement fixation assays, Fluorescence Activated Cell Sorter (FACS), and protein chips. Wherein the method is one or more methods selected from the group consisting of:
9. The method of claim 8,
The method may further include determining the number of ganoderma when the expression level of the guanine deaminase gene or the amount of the guanine deaminase protein in the skin tissue of the lesion is increased compared to that of the normal control skin tissue A method of providing information for diagnosis of blind spots.

(A) measuring the amount of a gene expression amount or guanine deaminase protein encoding a guanine deaminase present in the cutaneous tissue of the diseased lesion; And
(B) when the expression level of guanine deaminase gene or the amount of guanine deaminase protein present in the skin tissue of the lesion is greater than that of the normal control group, it is judged to be melanoma when it is less than or equal to that of the normal control group Lt; / RTI &gt;
The lesion subcutaneous tissue of step (a) comprises keratinocyte, and the lesion subcutaneous tissue of step (b) comprises keratinocyte or culture medium of keratinocyte obtained. How to distinguish black spots from melanomas.
delete delete (A) treating the candidate substance with keratinocyte;
(B) measuring the expression level of guanine deaminase in the cell or the culture medium of the cell; And
(C) judging the candidate substance as a substance for preventing or treating blindness when the expression level of the guanine deaminase is decreased as compared with the control group in which the candidate substance is not treated, as a result of the measurement in the step (B) A method for screening for substances for preventing or treating schistosomiasis.
17. The method of claim 16,
The measurement of step (B) may be performed using RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection (RPA) assay, Northern blotting, DNA chip, Western blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion , Immunohistochemistry, immunohistochemistry, immunoassay, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assays, complement fixation assays, Fluorescence Activated Cell Sorter (FACS), and protein chips. Lt; RTI ID = 0.0 &gt; 1, &lt; / RTI &gt;
(a) treating a candidate substance in a culture cell model in which keratinocyte and normal melanocyte cells co-cultured with guanine deaminase overexpressing;
(b) measuring the expression level of guanine deaminase in the keratinocyte or in the culture medium of keratinocyte; or
Measuring the expression level of tyrosinase in the normal melanocytes; And
(c) determining that the candidate substance is a substance for preventing or treating schistosomiasis if the expression level of the guanine deaminase or tyrosinase is decreased as compared with the control group not treated with the candidate substance as a result of the measurement in the step (b) &Lt; / RTI &gt; wherein the method comprises screening a substance for preventing or treating schistosomiasis.

Images