KR102039176B1 - Diagnosis for skin aging caused by increased formation of skin wrinkles - Google Patents

Diagnosis for skin aging caused by increased formation of skin wrinkles Download PDF

Info

Publication number
KR102039176B1
KR102039176B1 KR1020190124080A KR20190124080A KR102039176B1 KR 102039176 B1 KR102039176 B1 KR 102039176B1 KR 1020190124080 A KR1020190124080 A KR 1020190124080A KR 20190124080 A KR20190124080 A KR 20190124080A KR 102039176 B1 KR102039176 B1 KR 102039176B1
Authority
KR
South Korea
Prior art keywords
methylation
skin
seq
gene
involucrin
Prior art date
Application number
KR1020190124080A
Other languages
Korean (ko)
Other versions
KR20190116231A (en
Inventor
김태억
김동현
김아람
Original Assignee
의료법인 성광의료재단
차의과학대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 의료법인 성광의료재단, 차의과학대학교 산학협력단 filed Critical 의료법인 성광의료재단
Priority to KR1020190124080A priority Critical patent/KR102039176B1/en
Publication of KR20190116231A publication Critical patent/KR20190116231A/en
Application granted granted Critical
Publication of KR102039176B1 publication Critical patent/KR102039176B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/154—Methylation markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 인볼루크린(Involucrin) 유전자의 메틸화된 5’-UTR을 포함하는, 피부노화 특이적 바이오마커 및 상기 바이오마커의 수준을 측정하는 제제를 포함하는 피부노화 또는 피부노화 진행단계의 탐지용 조성물에 관한 것이다.The present invention is for the detection of skin aging or skin aging progression step comprising a skin aging specific biomarker, including the methylated 5'-UTR of the Involucrin gene and an agent for measuring the level of the biomarker To a composition.

Description

피부주름 형성 증가에 의한 피부노화의 진단{Diagnosis for skin aging caused by increased formation of skin wrinkles} Diagnosis for skin aging caused by increased formation of skin wrinkles}

본 발명은 피부노화 관련 후성 유전자 마커 및 이를 이용한 피부 노화의 탐지 용도에 관한 것으로서, 구체적으로 인볼루크린(Involucrin) 유전자의 메틸화된 5’-UTR을 포함하는, 피부노화 특이적인 바이오마커 및 상기 바이오마커의 수준을 측정하는 제제를 포함하는 피부노화 또는 피부노화 진행단계의 탐지용 조성물에 관한 것이다. The present invention relates to a skin aging-related epigenetic marker and a use for detecting skin aging using the same, and specifically, a biomarker specific for skin aging, including the methylated 5'-UTR of the Involucrin gene, and the bio It relates to a composition for detection of skin aging or progression of skin aging, including an agent measuring the level of a marker.

후성유전자 DNA 메틸화는 유전자 프로모터 부위의 CpG 섬 (CpG island)의 시토신 (cytosine)에 메틸기가 결합하는 현상으로, 상기 유전자 DNA 메틸화로 인해서 전사 인자 (transcription factor)의 유전자 프로모터의 결합이 저해되어 해당 유전자의 발현이 저해되는 것으로 알려져있다.Epigene DNA methylation is a phenomenon in which a methyl group is bound to the cytosine of the CpG island in the gene promoter region, and the binding of the gene promoter of the transcription factor is inhibited due to the gene DNA methylation. It is known that the expression of is inhibited.

최근, 후생유전자(Epigenetic), DNA 메틸화(DNA Methylation) 측정을 통해 암을 진단하는 방법들이 제시되고 있고. 유전자 프로모터 부위의 CpG 섬(CpG island)의 시토신(cytosine)에서 일어나는 DNA 메틸화에 의해서 해당 프로모터 염기서열에 결합하여 해당 유전자의 발현을 조절하는 전사 인자의 프로모터 염기서열에 대한 결합이 저해되어 특정 유전자의 발현이 억제됨이 보고 되고 있다.Recently, methods for diagnosing cancer through epigenetic and DNA methylation measurements have been proposed. DNA methylation that occurs in the cytosine of CpG island at the gene promoter region binds to the promoter nucleotide sequence and inhibits the binding of the transcription factor that controls the expression of the gene to the promoter nucleotide sequence. It has been reported that expression is suppressed.

특히, 종양 억제 유전자의 메틸화에 대한 연구는 암의 치료제 개발에 중요한 단초를 제공할 수 있고, 이러한 이유로 종양 관련 유전자의 메틸화를 조사하여 각종 암 진료에 사용하려는 시도가 활발하게 이루어지고 있으나 (Esteller, M. et al., Cancer Res., 59:67, 1999; Sanchez-Cespedez, M. et al., Cancer Res., 60:892, 2000; Ahlquist, D.A. et al., Gastroenterol., 119:1219, 2000), 현재까지는 피부노화와 관련된 유전자의 메틸화에 대한 연구는 초기단계에 머물러 있는 실정이다.In particular, research on methylation of tumor suppressor genes can provide an important step in the development of cancer therapeutics, and for this reason, attempts have been made to investigate the methylation of tumor-related genes and use them in various cancer treatments (Esteller, M. et al., Cancer Res., 59:67, 1999; Sanchez-Cespedez, M. et al., Cancer Res., 60:892, 2000; Ahlquist, DA et al., Gastroenterol., 119:1219, 2000), until now, research on the methylation of genes related to skin aging remains in its infancy.

대한민국 공개특허공보 제2014-0122529호에는 방광암 바이오마커 유전자의 CpG 섬 부위의 메틸화를 검출하는 방법에 대해 개시되어 있고, 대한민국 등록특허공부 제10-1597812호에는 ZFP37 유전자 프로모터의 CpG 부위의 메틸화 수준을 측정하여 난소암 환자의 백금 기반의 항암제에 대한 반응성 예측 정보를 제공하는 조성물에 대해 개시되어 있다.Republic of Korea Patent Publication No. 2014-0122529 discloses a method for detecting the methylation of the CpG island region of the bladder cancer biomarker gene, and the Korean Patent Publication No. 10-1597812 discloses the methylation level of the CpG region of the ZFP37 gene promoter. Disclosed is a composition that provides information on predicting the reactivity of ovarian cancer patients with platinum-based anticancer drugs.

그러나, 피부노화와 관련된 유전자의 후성유전자 DNA 메틸화와의 상관관계 및 이를 이용한 피부노화 진단 방법에 대해서는 아직까지 알려진 바가 없다.However, the correlation between the methylation of the epigene DNA of the gene related to skin aging and the method for diagnosing skin aging using the same has not been known yet.

본 발명은 인볼루크린(Involucrin) 유전자의 메틸화된 5’-UTR 부위를 포함하는 피부노화 측적용 바이오 마커를 제공한다.The present invention provides a biomarker for measuring skin aging comprising a methylated 5'-UTR region of an Involucrin gene.

또한, 본 발명은 인볼루크린 유전자의 메틸화된 5’-UTR의 메틸화를 측정하는 제제를 포함하는, 피부노화 또는 피부노화 진행단계의 탐지, 검출, 평가 또는 진단용 조성물 및 이를 포함하는 키트를 제공한다.In addition, the present invention provides a composition for detecting, detecting, evaluating, or diagnosing skin aging or progression of skin aging, including an agent for measuring the methylation of methylated 5'-UTR of the involucrine gene, and a kit comprising the same. .

또한, 본 발명은 인볼루크린 유전자의 메틸화된 5’-UTR의 메틸화 수준을 측정하는 단계를 포함하는 피부노화 또는 피부노화 진행단계의 진단에 필요한 정보의 제공방법을 제공한다.In addition, the present invention provides a method of providing information necessary for diagnosis of skin aging or skin aging progression comprising the step of measuring the methylation level of the methylated 5'-UTR of the involucrine gene.

본 발명의 추가 목적은 피부노화 특이적 바이오마커인 인볼루크린 유전자의 메틸화된 5’-UTR을 이용한 피부노화 억제 약물의 스크리닝 방법을 제공하는 것이다.A further object of the present invention is to provide a method for screening a skin aging inhibitory drug using methylated 5'-UTR of an involucrine gene, which is a skin aging-specific biomarker.

본 발명은 인볼루크린(Involucrin) 유전자의 메틸화된 5’-UTR을 포함하는, 피부노화 특이적 바이오마커와 상기 바이오마커의 메틸화를 측정하는 제제를 포함하는 피부노화 또는 피부노화 진행단계의 탐지용 조성물, 및 이를 이용한 피부노화 진단에 필요한 정보를 제공하는 방법에 관한 것이다.The present invention is for detection of skin aging or skin aging progression stage comprising a skin aging-specific biomarker comprising methylated 5'-UTR of an Involucrin gene and a preparation for measuring methylation of the biomarker It relates to a composition and a method of providing information necessary for diagnosing skin aging using the composition.

본 발명자들은 우선, 광노화를 유도한 쥐의 피부 조직으로부터 DNA를 추출하여 MeDIP(Methylated DNA immunoprecipitation) 분석법을 실시하여 후생유전학적으로 조절되는 유전자 후보군을 선별하였다. First, the present inventors extracted DNA from the skin tissue of the mouse induced photoaging and subjected to MeDIP (Methylated DNA immunoprecipitation) analysis to select a gene candidate group that is epigenetically regulated.

일반적으로 후성유전자 DNA 메틸화가 일어날 경우, 전사 인자 (transcription factor)의 유전자 프로모터의 결합이 저해되어 해당 유전자의 발현이 저해되는 것으로 알려져 있다. 종래에는 피부 광노화에 의해서 Involucrin 유전자 및 단백질의 발현이 증가함이 밝혀졌으며, 따라서 Involucrin 유전자의 메틸화는 광노화에 의해서 감소될 것이라 예상되어 왔다.In general, it is known that when epigene DNA methylation occurs, the binding of a gene promoter of a transcription factor is inhibited, thereby inhibiting the expression of the corresponding gene. Conventionally, it has been found that the expression of Involucrin gene and protein is increased by skin photoaging, and therefore, it has been expected that the methylation of Involucrin gene will be reduced by photoaging.

그러나 본 발명자들은 기존에 추측된 것과 상반되는 결과로써, 광노화 유도에 의해 발현이 증가된 인볼루크린(Involucrin) 유전자의 5’-UTR부분, 특히 5’-UTR 의 CpG 섬의 메틸화가 증가됨을 새로이 밝힘으로써 본 발명을 완성하였다.However, as a result contrary to the previously speculated results, the present inventors newly found that the methylation of the 5'-UTR portion of the Involucrin gene whose expression was increased by induction of photoaging, especially the CpG island of 5'-UTR, was increased. By revealing, the present invention was completed.

이하 본 발명을 더욱 자세히 설명하고자 한다.Hereinafter, the present invention will be described in more detail.

본 발명은 인볼루크린(Involucrin) 유전자의 메틸화(Methylation)된 5’-UTR(Untranslated region) 부위를 포함하는, 피부노화 측정용 바이오마커를 제공한다.The present invention provides a biomarker for measuring skin aging, including a methylated 5'-UTR (Untranslated region) site of an Involucrin gene.

상기 인볼루크린(Involucrin)은 포유류의 피부를 구성하는 단백질로 알려져 있으며, 광노화 유도에 의해서 Involucrin을 암호화하는 유전자 및 단백질의 발현이 증가하는 것으로 알려져 있다.Involucrin is known as a protein constituting mammalian skin, and it is known that the expression of genes and proteins encoding Involucrin increases by inducing photoaging.

Involucrin 단백질은 인간 (Homo sapiens) 등을 포함하는 영장류, 마우스 (Mus musculus), 래트 (Rattus norvegicus) 등을 포함하는 설치류 등의 포유류, 개구리 (Xenopus laevis) 등의 양서류 등으로부터 유래한 것일 수 있으며, 예컨대, 인간 Involucrin (Accession no. NP_005538.2. (유전자: NM_005547.3.))일 수 있으나, 이에 제한되는 것은 아니다.Involucrin protein may be derived from primates including humans (Homo sapiens), mammals such as rodents including mice (Mus musculus), rats (Rattus norvegicus), and amphibians such as frogs (Xenopus laevis), For example, it may be human Involucrin (Accession no. NP_005538.2. (gene: NM_005547.3.)), but is not limited thereto.

상기 메틸화된 Involucrin 유전자는 표 1의 서열번호 1의 폴리뉴클레오타이드 서열을 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다. The methylated Involucrin gene may include the polynucleotide sequence of SEQ ID NO: 1 in Table 1, but is not limited thereto.

표 1의 서열번호 1은 Involucrin 유전자의 전체 염기서열을 나타낸 것이며, 굵은 글씨로 나타낸 CG는 UV조사시 메틸화가 일어나는 CpG 섬 부위를 나타나며, 굵은 글씨 ATG는 개시코돈이다. 밑줄로 표시한 부분은 Involucrin 유전자의 5'-UTR 부분을 표시한 것이다. SEQ ID NO: 1 in Table 1 shows the entire nucleotide sequence of the Involucrin gene, CG shown in bold indicates a CpG island region where methylation occurs upon UV irradiation, and ATG in bold indicates the start codon. The underlined part indicates the 5'-UTR part of the Involucrin gene.

서열번호 2는 서열번호 1의 Involucrin 유전자의 전체 염기서열 중, Transcription site를 포함하는 Exon1 부위의 염기서열을 나타낸 것이다.SEQ ID NO: 2 shows the nucleotide sequence of the Exon1 site, including the transcription site, among the entire nucleotide sequence of the Involucrin gene of SEQ ID NO: 1.

서열번호 3은 서열번호 1의 Involucrin 유전자의 전체 염기서열 중, 5'-UTR 부위를 나타낸 것이며, 굵은 글씨로 나타낸 CG는 UV조사시 메틸화가 일어나는 CpG 섬 부위를 나타나며, 굵은 글씨 ATG는 개시코돈이다.SEQ ID NO: 3 shows the 5'-UTR site in the entire nucleotide sequence of the Involucrin gene of SEQ ID NO: 1, CG shown in bold indicates the CpG island site where methylation occurs upon UV irradiation, and the bold ATG is the initiation codon. .

서열번호 4는 서열번호 3의 5'-UTR 부위 중 메틸화가 일어날 가능성이 큰 CpG 섬 부위 의 염기서열을 나타낸것으로, 구체적으로 Meth primer tool을 통해 IVL 염기서열 중 CpG 섬 집약부위를 선별한 부분이다.SEQ ID NO: 4 shows the nucleotide sequence of the CpG island region that is likely to undergo methylation among the 5'-UTR region of SEQ ID NO: 3. Specifically, the CpG island intensive region of the IVL nucleotide sequence was selected through the Meth primer tool. .

서열번호 5는 Involucrin 단백질을 코딩하는 Exon2 부위의 염기서열이며, 굵은글씨 ATG는 개시코돈을 나타낸다. SEQ ID NO: 5 is the base sequence of the Exon2 site encoding the Involucrin protein, and the bold ATG represents the start codon.

명명denomination 서열order 서열번호Sequence number Involucrin 유전자 full sequenceInvolucrin gene full sequence CTCCTAGAAGCCTTCTACTTGACTCTACTTGGCCTAAAGTCAAACTCCCTCCACCAAAGACAGAGTTTATTTCCACATAGGATGGAGTTAAAAAATATATTCTGAGAGAGGAAGGGCTTGTGGCCCAAGAGAACACCCCAGAAATACCACCCCTTCATGGGAAGTGACTCTATCTTCAAACATATAACCCAGCCTGGACATCCCCGAAAGACACATAACTTTCCATTTCATGCCCTTGAAAGTGAATCTTTTGGCCTAATAATGAGAACAAACTCATTTTGAAAGTGGAAAAATTGAGATTCAGAGCAGAAGTTTGACTAAGGTCACAAAACAGTAGGATGCCTCACTCAGCTCCCTGTGCCTAGGTCAGAAAAGCATCACAGGAATAGTTGAGCTACCAGAATCCTCTGGCCAGGCAGGAGCTGTGTGTCCCTGGGAAATGGGGCCCTAAAGGGTTTGCTGCTTAAGATGCCTGTGGTGAGTCAGGAAGGGGTTAGAGGAAGTTGACCAACTAGAGTGGTGAAACCTGTCCATCACCTTCAACCTGGAGGGAGGCCAGGCTGCAGAATGATATAAAGAGTGCCCTGACTCCTGCTCAGCTCAGCACTCCACCAAAGCCTCTGCCTCAGCCTTACTGTGAGTCTGGTAAGTGTCGGATGGTAGAACCAGGGTTGGGACT CG GGACCTCCAACAGCATA CG ATGTGGTGGGGGTGGGCAGCCTGGGTGGGGGTGGGCATTACTCTGGGGCTGGATTCAGCTGGACTTTCATTCTAGGGGGACT CG AGTCAGAGTACTGAGAGAAAAGTGCCTTGGCACAGAAGTGCAGAACAGAGAGTAATCATCCTATGTCCCATCTTTTCTTGTGACCATATTTTTGGATTTGTGTGTGAGAGAGAATTATGGAAGGGAGGAGGGGAATAGCATTCAACTTCTTTCCTAAACCTCTTGGGTTTTGACAGACCATCATTTTGCCTTCTTTATGGAGGGAGAGGTTCAGGGAAGAGCTTCTACCTTTTGGCTATGCTGCACAGAGGGATGGCAGAATGGGGAAACCTTTCTATTTGGAGAAACCTAGGCAGAGCTGGGACAGGAAAACTCAACTTAGAAGTATAAGACTTGGAAGAACAACCTCCAACTCTCAGCAACCTTCCAGCTCCCGCAGCCCCACCCCAGACACAAGGACTGCAGCTAAACCTCAGAAGGTCAGGAGAGAAAGCAGCCCTGGGGTTGAATAGGCCAACCTGCTGGCTTTACAGGGGGGAAAACCAAATCCCAGGAGACTAAGTGACATGCCCAGAAACACACAGCATTCCAATGGGAGATTCAGGCCTAGAGCATGTCCTGTGGCTCCAGTCTGGAGGTCACACCATGACCTCTTAGGTCCTCTCTGGCACGGCCTATTGGTTTTCTAGGACTTGGTGTTCTCCAAGAGACATTTCATTCCCTAAGGCCTTACTCCTCACTGTGACATAATCCCAGAACGCATCTCTGCTCCTTGGTCAGTGAAGCGATGAGGGTGGACACAAGGACTAGACAAGAGCAGACAGTGAGCTGGCACCTGACCCACCCTTGCAGAACAGCCCTGCAGACAGATCTCCTTGTTGGCTCTCACCTGGGAACAAGGAGGCTCCTAGGAGGACCTTTCTCTGCCCCTCCACATTTCCACCCTTCTCTCTCTGCTGCTTTTGGGAAATGATAGTCCAGAGGTGGTAGAACAGTACCCTGCCCAAGGGAAGAGGGGATGCTAAAAAACCAGATACTTCTGCAGATTCCCAAGGTTTCATCTATTTCCTTTGCCTTCAGCCTGTGCATCAGACCTCTTCTGTCTTTCAGGTTGACAGTAGCTTCTAAG ATGTCCCAGCAACACACACTGCCAGTGACCCTCTCCCCTGCCCTCAGTCAGGAGCTCCTCAAGACTGTTCCTCCTCCAGTCAATACCCATCAGGAGCAAATGAAACAGCCAACTCCACTGCCTCCCCCATGCCAGAAGGTGCCTGTCGAGCTCCCAGTGGAGGTCCCATCAAAGCAAGAGGAAAAGCACATGACTGCTGTAAAGGGACTGCCTGAGCAAGAATGTGAGCAACAGCAGAAGGAGCCACAGGAGCAGGAGCTGCAGCAACAGCACTGGGAACAGCATGAGGAATATCAGAAAGCAGAAAACCCAGAGCAGCAGCTTAAGCAGGAGAAAACACAAAGGGATCAGCAGCTAAACAAACAGCTGGAAGAAGAGAAGAAGCTCTTAGACCAGCAACTGGATCAAGAGCTAGTCAAGAGAGATGAGCAACTGGGAATGAAGAAAGAGCAACTGTTGGAGCTCCCAGAGCAGCAGGAGGGGCACCTGAAGCACCTAGAGCAGCAGGAGGGACAGCTGAAGCACCCGGAGCAGCAGGAGGGGCAGCTGGAGCTCCCAGAGCAGCAGGAGGGGCAGCTGGAGCTCCCAGAGCAGCAGGAGGGGCAGCTGGAGCTCCCAGAGCAGCAGGAGGGGCAGCTGGAGCTCCCAGAGCAGCAGGAGGGGCAGCTGGAGCTCCCAGAGCAGCAGGAGGGGCAGCTGGAGCTCCCACAGCAGCAGGAGGGGCAGCTGGAGCTCTCTGAGCAGCAGGAGGGGCAGCTGGAGCTCTCTGAGCAGCAGGAGGGACAGCTGAAGCACCTGGAGCACCAGGAGGGGCAGCTGGAGGTCCCAGAGGAGCAGATGGGGCAGCTGAAGTACCTGGAACAGCAGGAGGGGCAGCTGAAGCACCTGGATCAGCAGGAGAAGCAGCCAGAGCTCCCAGAGCAGCAGATGGGGCAGCTGAAGCACCTGGAGCAGCAGGAGGGGCAGCCTAAGCATCTGGAGCAGCAGGAGGGGCAACTGGAGCAGCTGGAGGAGCAGGAGGGGCAGCTGAAGCACCTGGAGCAGCAGGAGGGGCAGCTGGAGCACCTGGAGCACCAGGAAGGGCAGCTGGGGCTCCCAGAGCAGCAGGTGCTGCAGCTGAAGCAGCTAGAGAAGCAGCAGGGGCAGCCAAAGCACCTGGAGGAGGAGGAGGGGCAGCTGAAGCACCTGGTGCAGCAGGAGGGGCAGCTGAAGCATCTGGTGCAGCAGGAGGGGCAGCTGGAGCAGCAGGAGAGGCAGGTGGAGCACCTGGAGCAGCAGGTGGGGCAGCTGAAGCACCTAGAGGAGCAGGAGGGACAACTGAAGCATCTGGAGCAGCAGCAGGGGCAGTTGGAGGTCCCAGAGCAGCAGGTGGGGCAGCCAAAGAACCTGGAGCAGGAGGAGAAGCAACTGGAGCTCCCAGAGCAGCAAGAGGGCCAGGTGAAGCACCTGGAGAAGCAGGAGGCACAGCTGGAGCTCCCAGAGCAGCAGGTAGGACAGCCAAAGCACCTGGAACAGCAGGAAAAGCACCTAGAGCACCCAGAGCAGCAGGACGGACAACTAAAACATCTGGAGCAGCAGGAGGGGCAGCTGAAGGACCTGGAGCAGCAGAAGGGGCAGCTGGAGCAGCCTGTGTTTGCCCCAGCTCCAGGCCAGGTCCAAGACATTCAACCAGCCCTGCCCACAAAGGGAGAAGTATTGCTTCCTGTAGAGCACCAGCAGCAGAAGCAGGAGGTGCAGTGGCCACCCAAACATAAATAACCACCCGCAGTGTCCAGAGGCCCTCAGATCGTCTCATACAAGGGAAGAGAGAGCCACTGGCTCCACTTATTTCGGGTCCGCTAGGTGGCCCGTCTCATCTGTGAACTTGACTCTGTCCCTCTACATGTCTCTTTAATGGGGTGAGGGTGGGGGAGAGAGGGAATTATTGTCCAGTGCCAACCCCAATGACCCCAATCCCAACCTCAGGTGAGCAGAGCCTCTACTTGAGGGACTATTGTTACTATAGGAATCCTTACTTCCCCAGTATTGAAGCTGAATCAGTGAGTGTGTACAATGATACATAATAAATCCTGGAAGTCTTGGGATCCTATATTCTCTTTAGCATTTTCTTCTATCACACCACATAAAAACCTGTGTATGGGTCAATGGCTGCAAGAGACTCCCACGGCCCATTCTCAAAGGAGGACAGACTCTTTTTAAATTTTGGTCCTCAAACCACTCAATAGATCTAACAGTTCCTGAAAAAGAAACAAACCCCCCCCCAAAAAAAATCAGCTTCACTTGATGTACTTGAAAACAACACTTGCCAGCCATGAAAAGGGGATACGTTGTTCTGGTTGCATCTCAGTCCAACACTACCTTCCACCACAACACCACACTCAACCCCTGGCAGAGCCCACCCTACACTTCTGCTCCAGACTCAGCTCCTCTCAGGAGGGGGACTGGGAAGATGCTAGGAAAGCTTGGGGGCTCCATCTGGGTTCTAGTCCCTTCCCTGGAAACATTTCCTGGCTCTTCTTCTTGGGTTTTCTCTCTTAGAAAATCTCATGATTTCAAAAAGTCTTATGGTCTGCCTACTTGGCTGAGGAAGACTTTAGCAAAGCAATAGAAGTAGAATTGGGCAAGGTGGGAAGAGGAGGTGTTCCAGATTGTCTCTGAGGGAAAGTGACAGCGTTATTAAAGTAAGTAA ACCAGGGTTGGGACT CG GGACCTCCAACAGCATA CG ATGTGGTGGGGGTGGGCAGCCTGGGTGGGGGTGGGCATTACTCTGGGGCTGGATTCAGCTGGACTTTCATTCTAGGGGGACT CG AGTCAGAGTACTGAGAGAAAAGTGCCTTGGCACAGAAGTGCAGAACAGAGAGTAATCATCCTATGTCCCATCTTTTCTTGTGACCATATTTTTGGATTTGTGTGTGAGAGAGAATTATGGAAGGGAGGAGGGGAATAGCATTCAACTTCTTTCCTAAACCTCTTGGGTTTTGACAGACCATCATTTTGCCTTCTTTATGGAGGGAGAGGTTCAGGGAAGAGCTTCTACCTTTTGGCTATGCTGCACAGAGGGATGGCAGAATGGGGAAACCTTTCTATTTGGAGAAACCTAGGCAGAGCTGGGACAGGAAAACTCAACTTAGAAGTATAAGACTTGGAAGAACAACCTCCAACTCTCAGCAACCTTCCAGCTCCCGCAGCCCCACCCCAGACACAAGGACTGCAGCTAAACCTCAGAAGGTCAGGAGAGAAAGCAGCCCTGGGGTTGAATAGGCCAACCTGCTGGCTTTACAGGGGGGAAAACCAAATCCCAGGAGACTAAGTGACATGCCCAGAAACACACAGCATTCCAATGGGAGATTCAGGCCTAGAGCATGTCCTGTGGCTCCAGTCTGGAGGTCACACCATGACCTCTTAGGTCCTCTCTGGCACGGCCTATTGGTTTTCTAGGACTTGGTGTTCTCCAAGAGACATTTCATTCCCTAAGGCCTTACTCCTCACTGTGACATAATCCCAGAACGCATCTCTGCTCCTTGGTCAGTGAAGCGATGAGGGTGGACACAAGGACTAGACAAGAGCAGACAGTGAGCTGGCACCTGACCCACCCTTGCAGAACAGCCCTGCAGACAGATCTCCTTGTTGGCTCTCACCTGGGAACAAGGAGGCTCCTAGGAGGACCTTTCTCTGCCCCTCCACATTTCCACCCTTCTCTCTCTGCTGCTTTTGGGAAATGATAGTCCAGAGGTGGTAGAACAGTACCCTGCCCAAGGGAAGAGGGGATGCTAAAAAACCAGATACTTCTGCAGATTCCCAAGGTTTCATCTATTTCCTTTGCCTTCAGCCTGTGCATCAGACCTCTTCTGTCTTTCAGGTTGACAGTAGCTTCTAAG ATG 1One Exon 1including Transcription Start Site Exon 1including Transcription Start Site TCAGCACTCCACCAAAGCCTCTGCCTCAGCCTTACTGTGAGTCTGTCAGCACTCCACCAAAGCCTCTGCCTCAGCCTTACTGTGAGTCTG 22 5'-UTR5'-UTR ACCAGGGTTGGGACT CG GGACCTCCAACAGCATA CG ATGTGGTGGGGGTGGGCAGCCTGGGTGGGGGTGGGCATTACTCTGGGGCTGGATTCAGCTGGACTTTCATTCTAGGGGGACT CG AGTCAGAGTACTGAGAGAAAAGTGCCTTGGCACAGAAGTGCAGAACAGAGAGTAATCATCCTATGTCCCATCTTTTCTTGTGACCATATTTTTGGATTTGTGTGTGAGAGAGAATTATGGAAGGGAGGAGGGGAATAGCATTCAACTTCTTTCCTAAACCTCTTGGGTTTTGACAGACCATCATTTTGCCTTCTTTATGGAGGGAGAGGTTCAGGGAAGAGCTTCTACCTTTTGGCTATGCTGCACAGAGGGATGGCAGAATGGGGAAACCTTTCTATTTGGAGAAACCTAGGCAGAGCTGGGACAGGAAAACTCAACTTAGAAGTATAAGACTTGGAAGAACAACCTCCAACTCTCAGCAACCTTCCAGCTCCCGCAGCCCCACCCCAGACACAAGGACTGCAGCTAAACCTCAGAAGGTCAGGAGAGAAAGCAGCCCTGGGGTTGAATAGGCCAACCTGCTGGCTTTACAGGGGGGAAAACCAAATCCCAGGAGACTAAGTGACATGCCCAGAAACACACAGCATTCCAATGGGAGATTCAGGCCTAGAGCATGTCCTGTGGCTCCAGTCTGGAGGTCACACCATGACCTCTTAGGTCCTCTCTGGCACGGCCTATTGGTTTTCTAGGACTTGGTGTTCTCCAAGAGACATTTCATTCCCTAAGGCCTTACTCCTCACTGTGACATAATCCCAGAACGCATCTCTGCTCCTTGGTCAGTGAAGCGATGAGGGTGGACACAAGGACTAGACAAGAGCAGACAGTGAGCTGGCACCTGACCCACCCTTGCAGAACAGCCCTGCAGACAGATCTCCTTGTTGGCTCTCACCTGGGAACAAGGAGGCTCCTAGGAGGACCTTTCTCTGCCCCTCCACATTTCCACCCTTCTCTCTCTGCTGCTTTTGGGAAATGATAGTCCAGAGGTGGTAGAACAGTACCCTGCCCAAGGGAAGAGGGGATGCTAAAAAACCAGATACTTCTGCAGATTCCCAAGGTTTCATCTATTTCCTTTGCCTTCAGCCTGTGCATCAGACCTCTTCTGTCTTTCAGGTTGACAGTAGCTTCTAAG ATG ACCAGGGTTGGGACT CG GGACCTCCAACAGCATA CG ATGTGGTGGGGGTGGGCAGCCTGGGTGGGGGTGGGCATTACTCTGGGGCTGGATTCAGCTGGACTTTCATTCTAGGGGGACT CG ATG 33 5'-UTR 중 메틸화 가능한 부분Methylable portion of 5'-UTR TGGGACT CG GGACCTCCAACAGCATA CG ATGTGGTGGGGGTGGGCAGCCTGGGTGGGGGTGGGCATTACTCTGGGGCTGGATTCAGCTGGACTTTCATTCTAGGGGGACT CG AGTCAGAGTACTGAGAGAAAAGTGCCTTTGGGACT CG GGACCTCCAACAGCATA CG ATGTGGTGGGGGTGGGCAGCCTGGGTGGGGGTGGGCATTACTCTGGGGCTGGATTCAGCTGGACTTTCATTCTAGGGGGACT CG AGTCAGAGTACTGAGAGAAAAGTGCCTT 44 Exon2Coding InvolucrinExon2Coding Involucrin GTTGACAGTAGCTTCTAAG ATG TCCCAGCAACACACACTGCCAGTGACCCTCTCCCCTGCCCTCAGTCAGGAGCTCCTCAAGACTGTTCCTCCTCCAGTCAATACCCATCAGGAGCAAATGAAACAGCCAACTCCACTGCCTCCCCCATGCCAGAAGGTGCCTGTCGAGCTCCCAGTGGAGGTCCCATCAAAGCAAGAGGAAAAGCACATGACTGCTGTAAAGGGACTGCCTGAGCAAGAATGTGAGCAACAGCAGAAGGAGCCACAGGAGCAGGAGCTGCAGCAACAGCACTGGGAACAGCATGAGGAATATCAGAAAGCAGAAAACCCAGAGCAGCAGCTTAAGCAGGAGAAAACACAAAGGGATCAGCAGCTAAACAAACAGCTGGAAGAAGAGAAGAAGCTCTTAGACCAGCAACTGGATCAAGAGCTAGTCAAGAGAGATGAGCAACTGGGAATGAAGAAAGAGCAACTGTTGGAGCTCCCAGAGCAGCAGGAGGGGCACCTGAAGCACCTAGAGCAGCAGGAGGGACAGCTGAAGCACCCGGAGCAGCAGGAGGGGCAGCTGGAGCTCCCAGAGCAGCAGGAGGGGCAGCTGGAGCTCCCAGAGCAGCAGGAGGGGCAGCTGGAGCTCCCAGAGCAGCAGGAGGGGCAGCTGGAGCTCCCAGAGCAGCAGGAGGGGCAGCTGGAGCTCCCAGAGCAGCAGGAGGGGCAGCTGGAGCTCCCACAGCAGCAGGAGGGGCAGCTGGAGCTCTCTGAGCAGCAGGAGGGGCAGCTGGAGCTCTCTGAGCAGCAGGAGGGACAGCTGAAGCACCTGGAGCACCAGGAGGGGCAGCTGGAGGTCCCAGAGGAGCAGATGGGGCAGCTGAAGTACCTGGAACAGCAGGAGGGGCAGCTGAAGCACCTGGATCAGCAGGAGAAGCAGCCAGAGCTCCCAGAGCAGCAGATGGGGCAGCTGAAGCACCTGGAGCAGCAGGAGGGGCAGCCTAAGCATCTGGAGCAGCAGGAGGGGCAACTGGAGCAGCTGGAGGAGCAGGAGGGGCAGCTGAAGCACCTGGAGCAGCAGGAGGGGCAGCTGGAGCACCTGGAGCACCAGGAAGGGCAGCTGGGGCTCCCAGAGCAGCAGGTGCTGCAGCTGAAGCAGCTAGAGAAGCAGCAGGGGCAGCCAAAGCACCTGGAGGAGGAGGAGGGGCAGCTGAAGCACCTGGTGCAGCAGGAGGGGCAGCTGAAGCATCTGGTGCAGCAGGAGGGGCAGCTGGAGCAGCAGGAGAGGCAGGTGGAGCACCTGGAGCAGCAGGTGGGGCAGCTGAAGCACCTAGAGGAGCAGGAGGGACAACTGAAGCATCTGGAGCAGCAGCAGGGGCAGTTGGAGGTCCCAGAGCAGCAGGTGGGGCAGCCAAAGAACCTGGAGCAGGAGGAGAAGCAACTGGAGCTCCCAGAGCAGCAAGAGGGCCAGGTGAAGCACCTGGAGAAGCAGGAGGCACAGCTGGAGCTCCCAGAGCAGCAGGTAGGACAGCCAAAGCACCTGGAACAGCAGGAAAAGCACCTAGAGCACCCAGAGCAGCAGGACGGACAACTAAAACATCTGGAGCAGCAGGAGGGGCAGCTGAAGGACCTGGAGCAGCAGAAGGGGCAGCTGGAGCAGCCTGTGTTTGCCCCAGCTCCAGGCCAGGTCCAAGACATTCAACCAGCCCTGCCCACAAAGGGAGAAGTATTGCTTCCTGTAGAGCACCAGCAGCAGAAGCAGGAGGTGCAGTGGCCACCCAAACATAAATAACCACCCGCAGTGTCCAGAGGCCCTCAGATCGTCTCATACAAGGGAAGAGAGAGCCACTGGCTCCACTTATTTCGGGTCCGCTAGGTGGCCCGTCTCATCTGTGAACTTGACTCTGTCCCTCTACATGTCTCTTTAATGGGGTGAGGGTGGGGGAGAGAGGGAATTATTGTCCAGTGCCAACCCCAATGACCCCAATCCCAACCTCAGGTGAGCAGAGCCTCTACTTGAGGGACTATTGTTACTATAGGAATCCTTACTTCCCCAGTATTGAAGCTGAATCAGTGAGTGTGTACAATGATACATAATAAATCCTGGAAGTCTTGGGATCCTAGTTGACAGTAGCTTCTAAG ATG 55

상기 Involucrin 유전자의 메틸화된 5’-UTR은 Involucrin 유전자의 발현을 조절하는 5’-UTR의 CpG 섬 (Island)에 메틸화가 일어난 것을 의미하며, 상기 5’-UTR은 Involucrin 유전자 프로모터 기준으로 다운스트림(downstream) 또는 업스트림(upstream)에 존재할 수 있으며, 바람직하게는 Involucrin 유전자 프로모터의 다운스트림에 존재한다. 구체적으로 상기 Involucrin 유전자는 (Promoter)-(Transcription start site)-(5’UTR)-(start codon, ATG)-(stop codon, TGA)-(3’UTR)-(Transcription Terminal) 구조를 가지며, 메틸화 부위는 프로모터의 다운스트림의 Transcription start site와 시작코돈(ATG) 서열 사이에 위치할 수 있다. 본 발명의 일 예에 따르면, 상기 메틸화되는 Involucrin 유전자(Accession no. NP_005538.2.)의 5’-UTR 부분은 서열번호 1의 Involucrin 유전자의 시작 코돈(ATG) 서열을 기준으로 -1189 번째에 해당하는 뉴클레오타이드 서열로부터 시작 코돈인 ATG 서열까지 포함한다(서열번호 3).The methylated 5'-UTR of the Involucrin gene means that methylation has occurred in the CpG island of 5'-UTR that regulates the expression of the Involucrin gene, and the 5'-UTR is downstream based on the Involucrin gene promoter ( downstream) or upstream, preferably downstream of the Involucrin gene promoter. Specifically, the Involucrin gene has a (Promoter)-(Transcription start site)-(5'UTR)-(start codon, ATG)-(stop codon, TGA)-(3'UTR)-(Transcription Terminal) structure, The methylation site may be located between the transcription start site and the start codon (ATG) sequence downstream of the promoter. According to an example of the present invention, the 5'-UTR portion of the methylated Involucrin gene (Accession no. NP_005538.2.) corresponds to the -1189 th based on the start codon (ATG) sequence of the Involucrin gene of SEQ ID NO: 1. It includes from the nucleotide sequence to the start codon ATG sequence (SEQ ID NO: 3).

또 다른 본 발명의 일 예에 따르면, 상기 Involucrin 유전자의 메틸화된 5’-UTR 부위는 상기 서열번호 1의 폴리뉴클레오타이드 서열의 5’말단으로부터 673번째 내지 812번째 뉴클레오타이드로 이루어진 군(서열번호 4)에서 선택된 하나 이상의 염기가 메틸화된 것일 수 있다. 상기 범위는 하기 실시예에서 확인한 바와 같이, Meth primer tool을 통해 IVL 염기서열 중 CpG 부위를 선별한 것이다. 서열번호 4의 5’-UTR의 일부 폴리뉴클레오타이드에 CpG island가 집약되어 있으며, UV에 의한 피부노화가 발생할 경우, 상기 부위의 CpG island에서 Methylation이 일어날 수 있다. According to another example of the present invention, the methylated 5'-UTR region of the Involucrin gene is in the group consisting of 673 th to 812 th nucleotides from the 5'end of the polynucleotide sequence of SEQ ID NO: 1 (SEQ ID NO: 4). One or more of the bases selected may be methylated. The above range is the selection of the CpG site in the IVL nucleotide sequence through the Meth primer tool, as confirmed in the following examples. CpG islands are concentrated in some polynucleotides of the 5'-UTR of SEQ ID NO: 4, and when skin aging due to UV occurs, methylation may occur in the CpG islands at the site.

상기 UV에 의해 Involucrin 유전자(Accession no. NP_005538.2.)의 5’-UTR 부분에서 메틸화된 염기는 서열번호 1의 시작코돈(ATG)로부터 -1174, -1155, -1071번째에 해당되는 뉴클레오타이드에 존재하는 CpG 섬 (CpG island)의 시토신 (cytosine)일 수 있다. 바람직하게는 서열번호 1의 폴리뉴클레오타이드의 5’-말단으로부터 680번째, 699번째, 783번째 뉴클레오타이드에 존재하는 CpG 섬으로 이루어진 군에서 선택된 하나이상의 CpG 섬이 메틸화된 것일 수 있으며, 가장 바람직하게는 680번째, 699번째, 783번째 뉴클레오타이드에 존재하는 CpG 섬 모두가 메틸화된 것일 수 있다.The base methylated in the 5'-UTR portion of the Involucrin gene (Accession no. NP_005538.2.) by the UV is at -1174, -1155, -1071 nucleotides from the start codon (ATG) of SEQ ID NO: 1 It may be a cytosine of existing CpG islands. Preferably, one or more CpG islands selected from the group consisting of CpG islands present at 680, 699, and 783 nucleotides from the 5'-end of the polynucleotide of SEQ ID NO: 1 may be methylated, and most preferably 680. All of the CpG islands present at nucleotides of th, 699 th and 783 th may be methylated.

하기 실시예에서 밝힌 바와 같이, 피부의 노화 또는 피부 노화가 진행된 경우, 세포내의 Involucrin 유전자의 5’-UTR 부위의 CpG 섬 (Island)의 메틸화가 증가하게 되며, 세포 내의 Involucrin 유전자 또는 Involucrin 단백질의 발현이 증가한다. 따라서, Involucrin 유전자의 메틸화된 5’-UTR 부위를 피부노화 측적용 바이오마커로 사용할 수 있다.As shown in the following examples, when skin aging or skin aging progresses, the methylation of CpG islands at the 5'-UTR region of the Involucrin gene in the cell increases, and the expression of the Involucrin gene or Involucrin protein in the cell. Increases. Therefore, the methylated 5'-UTR region of the Involucrin gene can be used as a biomarker for measuring skin aging.

본 명세서에서 용어, “피부노화”는 흔히 주름, 처짐 및 늘어짐의 증가와 관련된 외적 및 내적 (자연적)인 과정에 의한 것으로서, 외적 노화는 반복되는 자외선 (ultraviolet rays, UV) 노출에 의해 주로 발생하기 때문에 이를 일반적으로 '광노화'라고 한다. 자연적으로 노화된 피부는 매끄럽고 창백하며 잔주름이 있으나, 광노화된 피부는 굵은 주름이 생기며 색소침착 및 모세혈관 확장증을 야기한다. 피부의 주요 구조적 구성요소인 콜라겐의 손상은 피부 노화의 주된 요인으로 여겨지고 있으며 자연적인 노화 및 광노화 피부 모두에서 확인된다. 콜라겐 손상은 부분적으로 메트릭스 메탈로프로테이나제 (matrix metalloproteinase; MMP)의 유도와 관련된다. MMP는 매트릭스-분해 효소와 구조적으로 연관된 패밀리로서, 염증, 종양 침습 및 피부 노화와 같은 다양한 분해 과정에 중요한 역할을 수행한다. MMP의 수준은 자외선 광, 산화적 스트레스 및 사이토카인 등과 같은 다양한 자극에 의해 증가하고, 자외선 조사는 활성 단백질(activator protein-1; AP-1)의 DNA 결합을 촉진시키고, 콜라게나제(MMP-1), 스트로멜리신(MMP-3), 및 젤라티나제(MMP-9)와 같은 MMP를 유도한다. 콜라겐이 MMP-1에 의해 일단 분해되면 MMP-3 및 MMP-9에 의해 추가로 분해된다.As used herein, the term “skin aging” is often caused by external and internal (natural) processes associated with an increase in wrinkles, sagging and sagging, and external aging is mainly caused by repeated exposure to ultraviolet rays (UV). Therefore, this is generally referred to as'photoaging'. Naturally aged skin is smooth, pale and has fine wrinkles, but photoaging skin has thick wrinkles, causing pigmentation and telangiectasia. Damage to collagen, a major structural component of the skin, is believed to be a major factor in skin aging and is found in both natural and photoaging skin. Collagen damage is in part associated with the induction of matrix metalloproteinase (MMP). MMPs are a structurally related family of matrix-degrading enzymes and play an important role in various degradation processes such as inflammation, tumor invasion and skin aging. The level of MMP increases by various stimuli such as ultraviolet light, oxidative stress and cytokines, and ultraviolet irradiation promotes DNA binding of activator protein-1 (AP-1), and collagenase (MMP- 1), induces MMPs such as stromelysin (MMP-3), and gelatinase (MMP-9). Once collagen is degraded by MMP-1, it is further degraded by MMP-3 and MMP-9.

본 발명에 있어서, 상기 피부노화는 광피부노화 또는 UV에 의한 피부노화를 의미할 수 있고, 상기 피부노화는 주름 형성이 증가하거나 피부 상피세포의 두께가 증가하는 특징을 갖는 것일 수 있으며, 바람직하게는 광피부노화를 의미할 수 있다.In the present invention, the skin aging may mean light skin aging or UV-induced skin aging, and the skin aging may have a feature of increasing wrinkle formation or increasing the thickness of skin epithelial cells, preferably May mean light skin aging.

상기 피부노화 단계는 외적 및 내적인 과정에 의한 피부노화가 일어나는 단계를 말하며, 구체적으로 하기와 같은 과정을 거쳐 일어난다. 표피의 경우 각질형성 세포의 케라틴 합성이 감소되며 필라그린, 케라토히알린 및 여러 효소의 감소로 탈수형상이 심해지고 죽은 각질세포들이 떨어져 나가지 못하고 정체되어 각질 세포층이 두터워 지며, 이 후 각질층의 수분 결핍 현상이 심화되고 기저층까지 수분 이동 현상이 둔화됨을 확인할 수 있다. 다음으로 피지 생산이 감소되며 멜라닌 색소의 분포가 불규칙해져 피부가 전체적으로 얼굴덜룩해 진다. 진피의 경우 콜라겐과 탄력섬유가 경화 및 불용성이 되며, 피부 탄성 관련 인자들의 가교화 과정을 거치게 된다. 다음으로 노화의 진행에 따라 기질 (ground substance)의 감소로 피부의 주름이 늘어나게 되며 히알루론산의 양이 점차로 감소하게 된다. 상기 피부노화 단계는 각질 세포층의 증가 및 피부 탄력의 저하 단계를 포함하는 모든 단계를 의미할 수 있으나, 이에 제한되는 것은 아니다.The skin aging step refers to a step in which skin aging occurs due to external and internal processes, and specifically occurs through the following processes. In the case of the epidermis, the keratin synthesis of keratinocytes is reduced, and the dehydration is severe due to the decrease of pilaggrin, keratohyalin and various enzymes, and the dead keratinocytes cannot fall off and stagnate, resulting in a thickened stratum corneum layer, after which the stratum corneum lacks water It can be seen that the phenomenon is intensified and the phenomenon of moisture transfer to the base layer is slowed. Next, the production of sebum is reduced, and the distribution of melanin pigments becomes irregular, making the skin look spotty as a whole. In the case of the dermis, collagen and elastic fibers become hardened and insoluble, and undergo a process of crosslinking factors related to skin elasticity. Next, as the aging progresses, the amount of hyaluronic acid gradually decreases, and the wrinkles of the skin increase due to the decrease of the ground substance. The skin aging step may refer to any step including an increase in a stratum corneum layer and a decrease in skin elasticity, but is not limited thereto.

본 발명의 또 다른 일 예는, Involucrin 유전자의 5’-UTR의 메틸화를 측정하는 제제를 포함하는 피부노화 또는 피부노화 진행단계의 탐지용 조성물 및 상기 조성물을 포함하는 키트를 제공한다.Another example of the present invention provides a composition for detecting the progression of skin aging or skin aging, including an agent for measuring the methylation of 5′-UTR of the Involucrin gene, and a kit comprising the composition.

상기 Involucrin 유전자의 5’-UTR의 메틸화를 측정하는 제제는 Involucrin 유전자의 메틸화 5’-UTR의 메틸화된 CpG 섬을 포함하는 서열번호 1의 폴리뉴클레오타이드를 증폭하기 위한 PCR 프라이머 세트일 수 있다.The agent for measuring the methylation of 5′-UTR of the Involucrin gene may be a PCR primer set for amplifying the polynucleotide of SEQ ID NO: 1 including the methylated CpG island of the methylated 5′-UTR of the Involucrin gene.

상기 PCR프라이머 세트는 프라이머 염기서열 내에 최소한 하나 이상의 CpG 서열을 포함하고, Bisulfite conversion 과정에서 비메틸화된 시토신이 우라실로 변형됨을 고려하여, 메틸화와 비메틸화 프라이머가 유사한 Tm 값을 갖도록 제작된 것으로, 상기 프라이머 세트를 사용해 PCR을 수행했을 때 DNA 메틸화를 정확히 측정할 수 있는 프라이머 세트를 의미한다. The PCR primer set contains at least one CpG sequence in the primer sequence, and in consideration of the modification of unmethylated cytosine to uracil during the Bisulfite conversion process, the methylated and non-methylated primers were constructed to have similar Tm values. It refers to a primer set that can accurately measure DNA methylation when PCR is performed using a primer set.

구체적으로, 상기 서열번호 1의 폴리뉴클레오타이드를 증폭하기 위한 PCR 프라이머 세트는 서열번호 6 의 염기서열 및 서열번호 7의 염기서열로 이루어진 제1 프라이머 쌍, 및 서열번호 8의 염기서열 및 서열번호 9의 염기서열로 이루어진 제2 프라이머 쌍을 포함하는 프라이머 세트일 수 있다.Specifically, the PCR primer set for amplifying the polynucleotide of SEQ ID NO: 1 is a first primer pair consisting of the nucleotide sequence of SEQ ID NO: 6 and the nucleotide sequence of SEQ ID NO: 7, and the nucleotide sequence of SEQ ID NO: 8 and SEQ ID NO: 9 It may be a primer set including a second primer pair consisting of a base sequence.

예를 들어, IVL 5'-UTR부위에 메틸화된 CpG 섬의 위치를 파악하기 위해, methylation specific PCR은 서열번호 6 의 염기서열 및 서열번호 7의 염기서열 로 이루어진 제1 프라이머쌍을 사용하고, unmethylation specific PCR은 서열번호 8의 염기서열 및 서열번호 9의 염기서열로 이루어진 제2 프라이머 쌍을 사용할 수 있다. For example, to determine the location of the methylated CpG island in the IVL 5'-UTR site, methylation specific PCR uses a first primer pair consisting of the nucleotide sequence of SEQ ID NO: 6 and the nucleotide sequence of SEQ ID NO: 7, and unmethylation For specific PCR, a second primer pair consisting of the nucleotide sequence of SEQ ID NO: 8 and the nucleotide sequence of SEQ ID NO: 9 may be used.

상기 Involucrin 유전자의 5'-UTR의 메틸화를 측정하는 제제의 검출은 PCR, 메틸화 특이 PCR (methylation specific PCR), 실시간 메틸화 특이 PCR(real time methylation specific PCR), 메틸화 DNA 특이적 결합 단백질을 이용한 PCR, 정량 PCR, DNA 칩, 파이로시퀀싱 및 바이설파이트시퀀싱으로 구성된 군에서 선택되는 방법에 의해 수행되는 것일 수 있으나, 이에 제한되는 것은 아니다.The detection of an agent measuring the methylation of 5'-UTR of the Involucrin gene is PCR, methylation specific PCR, real time methylation specific PCR, PCR using methylated DNA specific binding protein, It may be performed by a method selected from the group consisting of quantitative PCR, DNA chip, pyrosequencing, and bisulfite sequencing, but is not limited thereto.

본 발명의 용어, "프라이머"는 짧은 자유 3 말단 수산화기를 가지는 핵산 서열로 상보적인 템플레이트(template)와 염기쌍을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 중합효소 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성을 개시할 수 있다. 또한, 프라이머는, 7개 내지 50개의 뉴클레오타이드 서열을 가진 센스 및 안티센스 핵산으로서, DNA 합성의 개시점으로 작용하는 프라이머의 기본 성질을 변화시키지 않는 추가의 특징을 혼입할 수 있다. 프라이머의 서열은 반드시 주형의 서열과 정확히 동일할 필요는 없으며, 충분히 상보적이어서 주형과 혼성화될 수 있으면 된다. 프라이머의 위치 혹은 프라이머 결합부위는 프라이머가 혼성화하는 표적 DNA 절편을 말한다.As used herein, the term "primer" refers to a short nucleic acid sequence capable of forming a base pair with a complementary template with a nucleic acid sequence having a short free three-terminal hydroxyl group and serving as a starting point for template strand copying. Primers can initiate DNA synthesis in the presence of a reagent for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer and temperature. In addition, the primers are sense and antisense nucleic acids having a sequence of 7 to 50 nucleotides, and may incorporate additional features that do not change the basic properties of the primers serving as an initiation point for DNA synthesis. The sequence of the primer does not necessarily have to be exactly the same as the sequence of the template, and only needs to be sufficiently complementary so that it can be hybridized with the template. The position of a primer or a primer binding site refers to a fragment of the target DNA that the primer hybridizes.

본 발명의 키트는 피부노화에 따라 발현이 증가되는 Involucrin 유전자 5’-UTR 의 메틸화를 측정하는 제제가 포함될 수 있으며, 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성성분 조성물, 용액 또는 장치를 더 포함하여 구성될 수 있다. 또한, 상기 키트는 Involucrin 유전자 5’-UTR 부위의 메틸화를 측정함으로써 피부노화 마커를 탐지하고, 피부노화정도를 측정할 수 있다. The kit of the present invention may include an agent for measuring the methylation of Involucrin gene 5'-UTR whose expression is increased according to skin aging, and further includes one or more other constituent compositions, solutions, or devices suitable for the analysis method. It can be configured. In addition, the kit can detect the skin aging marker by measuring the methylation of the 5'-UTR region of the Involucrin gene and measure the degree of skin aging.

본 발명에 있어서, 상기 피부노화는 광피부노화 또는 UV에 의한 피부노화를 의미할 수 있고, 상기 피부노화는 주름 형성이 증가하거나 피부 상피세포의 두께가 증가하는 것일 수 있으며, 바람직하게는 광피부노화를 의미할 수 있다.In the present invention, the skin aging may mean light skin aging or UV-induced skin aging, and the skin aging may be an increase in wrinkle formation or an increase in the thickness of skin epithelial cells, preferably light skin It can mean aging.

본 발명의 또 다른 일예는 Involucrin 유전자의 5’-UTR의 메틸화를 측정하는 단계를 포함하는 피부노화 또는 피부노화 진행단계의 진단에 필요한 정보를 제공하는 방법을 제공한다. 상기 방법은 UV에 의한 피부 손상부위를 모니터링, 피부노화 진단 바이오마커 개발, 및 피부노화 방지 화장품 개발에 활용이 가능하다.Another example of the present invention provides a method of providing information necessary for diagnosis of skin aging or progression of skin aging, including the step of measuring the methylation of 5'-UTR of the Involucrin gene. The method can be used to monitor the skin damage area caused by UV, to develop a skin aging diagnostic biomarker, and to develop skin aging prevention cosmetics.

상기 Involucrin 유전자의 5’-UTR 메틸화부분은 서열번호 1의 폴리뉴클레오타이드 서열에서 680, 699, 783번째 뉴클레오타이드에 존재하는 CpG 섬 (CpG island)의 시토신 (cytosine)에서 메틸화가 된 것일 수 있으나, 이에 제한되는 것은 아니다.The 5'-UTR methylated portion of the Involucrin gene may be methylated in the cytosine of CpG islands present at nucleotides 680, 699, and 783 in the polynucleotide sequence of SEQ ID NO: 1, but is limited thereto. It does not become.

상기 메틸화의 측정은 PCR, 메틸화 특이 PCR (Methylation specific PCR), 실시간 메틸화 특이 PCR (Real time methylation specific PCR), 메틸화 DNA 특이적 결합 단백질을 이용한 PCR, 정량 PCR, DNA 칩, 파이로시퀀싱 및 바이설파이트 시퀀싱으로 구성된 군에서 선택되는 방법에 의해 수행되는 것일 수 있으나, 이에 제한되는 것은 아니다. Measurement of the methylation is PCR, methylation specific PCR, real time methylation specific PCR, PCR using methylated DNA specific binding protein, quantitative PCR, DNA chip, pyrosequencing and bisul It may be performed by a method selected from the group consisting of fight sequencing, but is not limited thereto.

상기 메틸화를 측정하는 단계는 Involucrin 유전자의 메틸화된 5’-UTR의 메틸화된 CpG 섬을 포함하는 서열번호 1의 폴리뉴클레오타이드를 증폭하기 위한 PCR 프라이머 세트를 사용하여 증폭한 결과물의 생성 유무 또는 서열분석으로 수행하는 것일 수 있으나, 이에 제한되는 것은 아니다.The step of measuring the methylation is whether or not the result of amplification using a PCR primer set for amplifying the polynucleotide of SEQ ID NO: 1 containing the methylated CpG island of the methylated 5'-UTR of the Involucrin gene or sequencing. It may be performed, but is not limited thereto.

구체적으로, 상기 서열번호 1의 폴리뉴클레오타이드를 증폭하기 위한 PCR 프라이머 세트는 서열번호 6 의 염기서열 및 서열번호 7의 염기서열로 이루어진 제1 프라이머 쌍, 및 서열번호 8의 염기서열 및 서열번호 9의 염기서열로 이루어진 제2 프라이머 쌍을 포함하는 프라이머 세트일 수 있다.Specifically, the PCR primer set for amplifying the polynucleotide of SEQ ID NO: 1 is a first primer pair consisting of the nucleotide sequence of SEQ ID NO: 6 and the nucleotide sequence of SEQ ID NO: 7, and the nucleotide sequence of SEQ ID NO: 8 and SEQ ID NO: 9 It may be a primer set including a second primer pair consisting of a base sequence.

본 발명은 인볼루크린(Involucrin) 유전자의 메틸화된 5’-UTR를 포함하는, 피부노화 특이적 바이오마커 및 상기 바이오마커의 수준을 측정하는 제제를 포함하는 피부노화 또는 피부노화 진행단계의 탐지용 조성물에 관한 것으로서, 이를 이용해 피부노화 특이적 피부노화 또는 피부노화 진행단계를 확인할 수 있고, 빛에 의한 피부의 환부부위 치료 과정의 모니터링에도 적용할 수 있다.The present invention is for detection of skin aging or skin aging progression stage comprising a skin aging-specific biomarker comprising methylated 5'-UTR of the Involucrin gene and a preparation for measuring the level of the biomarker As for the composition, it can be used to check the skin aging-specific skin aging or the progression of skin aging, and can also be applied to monitoring the treatment process of the affected area of the skin by light.

도 1은 본 발명의 실시예 2-1에 따라, 피부 광노화 모델에서 인볼루크린 (Involucrin) DNA 메틸화를 확인한 결과를 나타낸다.
도 2는 본 발명의 실시예 2-2에 따라, 피부 광노화 모델에서 인볼루크린 유전자 발현을 분석한 결과를 나타낸다.
도 3은 본 발명의 실시예 2-3에 따라, 피부 광노화 모델에서 DNA 메틸화와 인볼루크린 유전자 발현의 관계를 나타낸다.
도 4는 본 발명의 실시예 3에 따라, 피부 광노화 모델에서 인볼루크린 mRNA 발현 변화를 확인한 것을 나타낸다.
도 5a는 본 발명의 실시예 4-3에 따라, 인간유래 불멸화된 각질형성세포(HaCaT)의 IVL 유전자 methylation specific PCR 결과를 나타낸다.
　도 5b는 본 발명의 실시예 4-3에 따라, 인간유래 불멸화된 각질형성세포(HaCaT)에 UV만을 처리했을 때와, UV 처리 후 DHPV를 처리했을 때의 Methylation/Unmethylation(M/U) 비율 측정결과를 나타낸다.
도 5c는 인볼루크린 유전자의 5’-UTR 부위 DNA를 Meth Primer 툴에 삽입하고 이 툴을 이용하여 확보한 IVL 염기서열의 CpG부위와 최종 선발된 5개의 프라이머 세트를 나타낸다.
도 6은 본 발명의 실시예 4-5에 따라, 인간유래 불멸화된 각질형성세포(HaCaT)에 UV만을 처리했을 때와, UV 처리 후 DHPV를 처리했을 때의 상대적인 IVL mRNA 발현수치 측정 결과를 나타낸다.
도 7은 본 발명의 실시예 4-5에 따라, 인간유래 불멸화된 각질형성세포(HaCaT)에 UV만을 처리했을 때와, UV 처리 후 DHPV를 농도 0.5nM, 1nM로 처리했을 때의 IVL 단백질의 발현 변화를 측정한 결과이다.1 shows the results of confirming the methylation of Involucrin DNA in a skin photoaging model according to Example 2-1 of the present invention.
2 shows the results of analyzing involucrin gene expression in a skin photoaging model according to Example 2-2 of the present invention.
3 shows the relationship between DNA methylation and involucrine gene expression in a skin photoaging model according to Example 2-3 of the present invention.
4 shows the confirmation of the change in the expression of involucrin mRNA in the skin photoaging model according to Example 3 of the present invention.
Figure 5a shows the IVL gene methylation specific PCR results of human-derived immortalized keratinocytes (HaCaT) according to Example 4-3 of the present invention.
5B is a Methylation/Unmethylation (M/U) ratio when UV-only treatment was applied to human-derived immortalized keratinocytes (HaCaT) and DHPV-treated after UV treatment according to Example 4-3 of the present invention. Shows the measurement result.
5C shows the 5'-UTR site DNA of the involucrin gene inserted into the Meth Primer tool, and the CpG site of the IVL sequence obtained using this tool and the final selected 5 primer sets.
6 shows the results of measuring the relative IVL mRNA expression level when only UV treatment was applied to human-derived immortalized keratinocytes (HaCaT), and when DHPV was treated after UV treatment according to Example 4-5 of the present invention. .
7 is a diagram of IVL protein when UV-only treatment was applied to human-derived immortalized keratinocytes (HaCaT) and when DHPV was treated at a concentration of 0.5 nM and 1 nM after UV treatment according to Example 4-5 of the present invention. This is the result of measuring the expression change.

이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명이 하기 실시예에 의해 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the present invention is not limited by the following examples.

<실시예 1> 피부 광노화 마우스 모델의 제작<Example 1> Preparation of a skin photoaging mouse model

피부 광노화 모델에서 Involucrin 프로모터 메틸화를 확인하기 위해서, 하기와 같은 방법으로 피부 광노화 마우스 모델을 제작하였다.In order to confirm the methylation of the Involucrin promoter in the skin photoaging model, a skin photoaging mouse model was prepared in the following manner.

구체적으로, 6주령의 암컷 albino hairless mice (Skh-1)에 주 5회 156.25 mg/kg/day으로 카카오 파우더 (cacao powder, baba Callebaut, Lebbeke-Wieze, Belgium) 또는 주 5회 625 mg/kg/day으로 피크노제놀 (Pycnogenol, 이하 Pyc)을 섭취시키고, 주 3회 TL20W/12RS UV lamps (Philips, Eindhoven, The Netherlands)를 이용하여 100 ~ 200 mJ/cm2의 UV를 조사하여 광노화 마우스 모델을 만들었다. 대조군의 경우 8주에 걸쳐 동일 조건에서 마우스를 키우되, UVB조사와 카카오 파우더(이하, CP)는 섭취시키지 않았다. CP를 먹어지 않고 UVB만 조사한 마우스는 UV 마우스로서 실험군에 포함시켰다. UV는 1주차에 100 mJ/cm2, 2 ~ 3주차에 150 mJ/cm2, 4 ~ 8주차에 200 mJ/cm2로 점차 UV 의 강도를 올려 조사했다. 광노화 마우스 모델은 8주차에 생검 (Biopsy)을 통해 조직을 획득하였다.Specifically, cacao powder (cacao powder, baba Callebaut, Lebbeke-Wieze, Belgium) at 156.25 mg/kg/day 5 times a week or 625 mg/kg/ 5 times a week in 6-week-old female albino hairless mice (Skh-1) A photoaging mouse model was made by ingesting Pycnogenol (hereinafter Pyc) by day, and irradiating UV of 100 to 200 mJ/cm 2 using TL20W/12RS UV lamps (Philips, Eindhoven, The Netherlands) three times a week. In the case of the control group, mice were raised under the same conditions over 8 weeks, but UVB irradiation and cacao powder (hereinafter, CP) were not ingested. Mice that were irradiated with UVB without eating CP were included in the experimental group as UV mice. UV was irradiated by gradually increasing the intensity of UV to 100 mJ/cm 2 in week 1, 150 mJ/cm 2 in weeks 2 to 3, and 200 mJ/cm 2 in weeks 4 to 8. In the photo-aging mouse model, tissues were acquired through biopsy at 8 weeks.

피부 노화 마커 유전자를 선별하기 위해서, 상기 방법으로 제작한 광노화 마우스에서 조직을 채취하여 하기와 같은 실험을 수행하였다.In order to select a skin aging marker gene, tissues were collected from the photo-aging mice prepared by the above method, and the following experiment was performed.

구체적으로, 상기 제작한 광노화 마우스에서 마우스 조직을 생검하고 액체 질소를 이용해 급속 냉각시킨 뒤, G-spinTM Total DNA Extraction Kit (Intron, Gyeonggi-do, Korea)를 이용하여 유전체 DNA를 추출하거나, RNeasy Plus Mini Kit (Qiagen, Valencia, USA)를 이용하여 전체 RNA를 추출하였다. 추출한 전체 RNA는 1% (w/v) agarose gel에 전기영동하여 18S와 28S RNA 밴드를 확인하여 양질의 전체 RNA가 추출되었음을 확인했다.Specifically, after biopsy of mouse tissue from the prepared photoaging mouse and rapid cooling with liquid nitrogen, genomic DNA is extracted using G-spinTM Total DNA Extraction Kit (Intron, Gyeonggi-do, Korea), or RNeasy Plus Total RNA was extracted using Mini Kit (Qiagen, Valencia, USA). The extracted total RNA was electrophoresed on a 1% (w/v) agarose gel to confirm 18S and 28S RNA bands, confirming that good quality total RNA was extracted.

<실시예 2> 피부 광노화 모델에서 Involucrin DNA 메틸화와 Involucrin 유전자 발현의 관계<Example 2> Relationship between Involucrin DNA methylation and Involucrin gene expression in skin photoaging model

2-1. DNA메틸화 패턴 분석2-1. DNA methylation pattern analysis

피부 광노화 모델에서 Involucrin DNA 메틸화를 분석하기 위해서 실시예 1과 같은 방법으로 제작한 광노화 마우스에서 조직을 채취하여 유전체 DNA를 추출하고, Hiseq 2000 (illumina, USA)을 이용하여 유전자의 염기서열을 분석하였으며, bowtie2 프로그램을 이용하여 마우스 지놈 (genome) 지도 분석을 수행하였다. 다음으로 feng J의 논문을 참조하여 (geng J et al., Nat Protoc. 2012, 7, 1728-40) Mode-based analysis of Chip-seq (MACS)을 통한 유전자 전체 서열 중 메틸화 서열 분석을 진행하였다. 이 후 GeneSpring 7.3 (silicon. Genetics, USA)을 이용하여 메틸화된 유전자 서열의 표준화, 통계 분석 및 군집 분석을 시행하였으며 마지막으로 WashU genome browser를 통해 분석된 유전자 메틸화 결과를 도 1에 나타냈다. In order to analyze the methylation of Involucrin DNA in the skin photoaging model, tissue was extracted from the photoaging mouse prepared in the same manner as in Example 1 to extract genomic DNA, and the nucleotide sequence of the gene was analyzed using Hiseq 2000 (illumina, USA). , Using the bowtie2 program, mouse genome map analysis was performed. Next, referring to the paper of feng J (geng J et al., Nat Protoc. 2012, 7, 1728-40), methylation sequence analysis was performed among the entire gene sequence through Mode-based analysis of Chip-seq (MACS). . After that, using GeneSpring 7.3 (silicon. Genetics, USA), the methylated gene sequence was standardized, statistically analyzed, and clustered, and finally, the gene methylation results analyzed through the WashU genome browser are shown in FIG. 1.

도 1에 나타난 것과 같이, 피부 광노화 마우스의 경우 염색체 3번에 위치한 Involucrin의 프로모터를 포함하는 프로모터의 업스트림 부위, 즉 엑손 부위와 프로모터 부위의 특정 염기에서 메틸화가 일어나며 특히, 프로모터 부분에서 메틸화가 강하게 나타났다. 상기 메틸화는 UV 조사에 의해서 증가하지만, UV 조사 후 항노화 물질인 CP를 처리하면 메틸화가 감소하고, 또한 Pyc 처리에 따라 전체적으로 메틸화가 감소함을 확인할 수 있었다. As shown in Figure 1, in the case of skin photoaging mice, methylation occurs at a specific base of the promoter, that is, the exon region and the promoter region, including the promoter of Involucrin located on chromosome 3, and in particular, methylation is strongly observed in the promoter region. . The methylation was increased by UV irradiation, but it was confirmed that the methylation decreased when the anti-aging substance CP was treated after UV irradiation, and the methylation was reduced overall according to the Pyc treatment.

따라서, 이를 통해 마우스에 UV 조사시 염색체 3번에 위치한 Involucrin의 프로모터를 포함하는 프로모터의 업스트림 부위에서 메틸화가 증가됨을 알 수 있었다.Therefore, it was found that methylation was increased in the upstream region of the promoter including the promoter of Involucrin located on chromosome 3 when the mouse was irradiated with UV light.

2-2. Involucrin 유전자 발현 분석2-2. Involucrin gene expression analysis

마우스 피부 광노화 모델에서 Involucrin 유전자 발현을 분석하기 위해서 실시예 1과 같은 방법으로 제작한 광노화 마우스에서 조직을 채취하고, 전체 RNA를 추출하였으며, 상기 추출한 전체 RNA를 사용하여 RNA-sequencing 데이터 분석 (TheragenEtex, Korea)을 수행하였다. UV + CP 실험군 마우스는 UV 조사 후 156.3 mg/kg/day로 CP를 섭취하도록 하였다. In order to analyze the expression of Involucrin gene in the mouse skin photoaging model, tissue was collected from the photoaging mouse prepared in the same manner as in Example 1, total RNA was extracted, and RNA-sequencing data analysis (TheragenEtex, Korea) was performed. The mice in the UV + CP experimental group were allowed to ingest CP at 156.3 mg/kg/day after UV irradiation.

도 2에 나타난 것과 같이, UV 처리에 의해서 Involucrin mRNA의 발현이 약 1.5배 증가했고, 반대로 UV와 카카오 CP 처리군 또는 UV와 Pyc 처리시, UV에 의해서 증가된 mRNA의 양이 다시 회복됨을 확인하였다.As shown in Figure 2, the expression of Involucrin mRNA increased by about 1.5 times by UV treatment, on the contrary, UV and cacao CP treatment group Alternatively, when UV and Pyc treatment, it was confirmed that the amount of mRNA increased by UV was recovered again.

　

2-3. 마우스 피부 광노화 모델에서 Involucrin DNA 메틸화와 Involucrin 유전자 발현과의 관계2-3. Relationship between Involucrin DNA Methylation and Involucrin Gene Expression in Mouse Skin Photoaging Model

마우스 피부 광노화 모델에서 Involucrin(Ivl) DNA 메틸화와 Involucrin(Ivl) 유전자 발현의 관계를 분석하기 위해서, 실시예 2-1 및 2-2에서 얻은 결과를 이용하고 correlation plot을 통해 RNA 발현양과 유전자 메틸화의 상관관계를 파악하였으며, 이 결과를 도 3에 나타냈다. In order to analyze the relationship between Involucrin (Ivl) DNA methylation and Involucrin (Ivl) gene expression in a mouse skin photoaging model, the results obtained in Examples 2-1 and 2-2 were used, and the RNA expression amount and gene methylation were analyzed through a correlation plot. The correlation was determined, and the results are shown in FIG. 3.

도 3에 나타낸 것과 같이 x축의 상대적인 Ivl 유전자 메틸화가 증가할수록, y축에 해당하는 Ivl 유전자 발현이 정비례하여 증가함을 확인하였다.As shown in FIG. 3, it was confirmed that as the relative methylation of the Ivl gene along the x-axis increased, the expression of the Ivl gene corresponding to the y-axis increased in direct proportion.

<실시예 3> 마우스 피부 광노화 모델에서 Involucrin 유전자 발현 변화<Example 3> Involucrin gene expression change in mouse skin photoaging model

마우스 피부 광노화 모델에서 Involucrin 유전자 발현 변화를 확인하기 위해서, 실시예 2-1과 같은 방법으로 제작한 광노화 마우스에서 조직을 채취하고, 실시예 2-2와 같은 방법으로 전체 RNA를 추출하고, 하기와 같은 방법으로 q-PCR(quantitative PCR)을 수행하였다.In order to confirm the change of Involucrin gene expression in the mouse skin photoaging model, tissue was collected from the photoaging mouse prepared in the same manner as in Example 2-1, and total RNA was extracted in the same manner as in Example 2-2, as follows. In the same way, q-PCR (quantitative PCR) was performed.

구체적으로, 실시예 2-2와 같은 방법으로 추출한 전체 RNA를 miScript II RT Kit (Qiagen, Hilden, Germany)에 적용하여 cDNA를 합성하고, miScript SYBR Green PCR Kit(Qiagen, Hilden, Germany)와 miScript microRNA PCR Array(Qiagen, Hilden, Germany) 및 QuantStudio 6 Flex Real-Time PCR System(Applied Biosystems, Foster City, CA, USA)를 사용하였으며, 하기 표 2의 mIVL_F, mIVL_R 프라이머세트(F: 서열번호12 / R: 서열번호13)를 사용해 q-PCR을 수행하였다. 또한 하기 표2의 GAPDH_F와 GAPDH_R 프라이머세트(F: 서열번호14 / R: 서열번호15)는 유전자 발현의 house keeping 유전자 즉, 대조군으로 사용하였다. 모든 반응은 96-well plate에서 수행하였고, 평균값을 사용해 상대적인 mRNA 발현 수치를 계산하였다.Specifically, the total RNA extracted in the same manner as in Example 2-2 was applied to the miScript II RT Kit (Qiagen, Hilden, Germany) to synthesize cDNA, and the miScript SYBR Green PCR Kit (Qiagen, Hilden, Germany) and miScript microRNA PCR Array (Qiagen, Hilden, Germany) and QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) were used, and mIVL_F, mIVL_R primer set (F: SEQ ID NO: 12 / R) in Table 2 below. : Q-PCR was performed using SEQ ID NO: 13). In addition, the GAPDH_F and GAPDH_R primer sets (F: SEQ ID NO: 14 / R: SEQ ID NO: 15) in Table 2 were used as a house keeping gene for gene expression, that is, a control. All reactions were performed in a 96-well plate, and relative mRNA expression levels were calculated using the average value.

명명denomination 서열 (5’> 3’)Sequence (5’> 3’) Tm (℃)Tm (℃) 서열번호Sequence number IVL_MFIVL_MF GGATTCGGGATTTTTAATAGTATACGGGATTCGGGATTTTTAATAGTATACG 55.255.2 66 IVL_MRIVL_MR AACACTTTTCTCTCAATACTCTAACTCGAACACTTTTCTCTCAATACTCTAACTCG 58.558.5 77 IVL_UFIVL_UF TGGGATTTGGGATTTTTAATAGTATATTGGGATTTGGGATTTTTAATAGTATAT 5454 88 IVL_URIVL_UR AAAACACTTTTCTCTCAATACTCTAACTCAAAAACACTTTTCTCTCAATACTCTAACTCA 58.658.6 99 hIVL_FhIVL_F CCCATCAAAGCAAGAGGAAACCCATCAAAGCAAGAGGAAA 5454 1010 hIVL_RhIVL_R AGCTGCTGATCCCTTTGTGTAGCTGCTGATCCCTTTGTGT 53.553.5 1111 mIVL_FmIVL_F GTGAAGCCAAAACTAAAGCAACGTGAAGCCAAAACTAAAGCAAC 5656 1212 mIVL_RmIVL_R CATAGACAAGAGGATGGTCAGGCATAGACAAGAGGATGGTCAGG 56.756.7 1313 GAPDH_FGAPDH_F ACCACAGTCCATGCCATCACACCACAGTCCATGCCATCAC 59.359.3 1414 GAPDH_RGAPDH_R TCCACCACCCTGTTGCTGTATCCACCACCCTGTTGCTGTA 60.160.1 1515

도 4에 나타낸 것과 같이, UV 처리시 Involucrin mRNA의 발현이 대조군에 비해 약 3배 가량 증가했고, 반대로 UV처리 후 카카오 CP를 처리한 실험군에서는 UV에 의해서 증가된 mRNA의 양이 다시 감소함을 확인하였다.As shown in FIG. 4, it was confirmed that the expression of Involucrin mRNA increased by about 3 times compared to the control group during UV treatment, whereas in the experimental group treated with Kakao CP after UV treatment, the amount of mRNA increased by UV decreased again. I did.

<실시예 4> <Example 4> In vitro In vitro 피부 광노화 모델에서 Involucrin 유전자 5’-UTR부위 메틸화와 Involucrin 유전자 발현의 관계Relationship between Involucrin Gene 5'-UTR Methylation and Involucrin Gene Expression in Skin Photoaging Model

4-1. 인간 피부 광노화 세포 모델의 제작4-1. Construction of human skin photoaging cell model

인간 피부 광노화 세포 모델에서 Involucrin DNA에서 메틸화되는 부위를 확인하기 위해, 하기와 같은 방법으로 인간 피부 광노화 세포 모델을 제작하였다.In order to confirm the methylated site in Involucrin DNA in the human skin photoaging cell model, a human skin photoaging cell model was constructed in the following manner.

인간유래 불멸 상피세포주 (Immortalized human keratinocyte) HaCaT 세포 (ATCC, USA) 5 x 105 cell을 DMEM (5% FBS) 배지가 들어있는 100-mm dish에 분주하여 48시간 동안 37℃ CO2 incubator에서 배양하였다. 이후 incubator에서 세포를 꺼내어 serum free media로 배지를 교체하였으며, 교체 후 12시간이 지난 후 PBS로 washing하고, 다시 dish에 4 mL의 PBS를 넣고 UV crosslinker (UVP, CA, USA)를 이용하여 100 mJ/cm2의 UV를 쪼여주었다. 다음으로, Dish에서 PBS를 제거하고 8 mL의 DMEM (5 % FBS) 배지를 채워 24시간 동안 재배양하여 피부 광노화 세포 모델을 제작하였다. Immortalized human keratinocyte HaCaT cells (ATCC, USA) 5 x 10 5 cells were dispensed into a 100-mm dish containing DMEM (5% FBS) and cultured in a 37℃ CO 2 incubator for 48 hours. I did. After that, the cells were removed from the incubator and the medium was replaced with serum free media. After 12 hours after the replacement, the medium was washed with PBS, and 4 mL of PBS was added to the dish and 100 mJ using a UV crosslinker (UVP, CA, USA). UV of /cm 2 was applied. Next, PBS was removed from the dish, and cultured for 24 hours by filling 8 mL of DMEM (5% FBS) medium to prepare a skin photoaging cell model.

피부 광노화를 회복시킨 각질형성세포(HaCaT)를 제조하기 위해, UV 조사 이후에 DMEM 배지에 Cacao powder 4 ug/mL 및 Cacao의 대사산물인 DHPV [5-(3',4'-19 dihydroxyphenyl)-gamma-calerolactone] 를 10 ng/mL를 포함시켜 24시간 동안 배양했다. UV 조사 및 상기 DHPV를 처리하지 않은 세포를 대조군세포로 사용하였다.To prepare keratinocytes (HaCaT) that restored skin photoaging, Cacao powder 4 ug/mL in DMEM medium after UV irradiation and DHPV, a metabolite of Cacao, [5-(3',4'-19 dihydroxyphenyl)- gamma-calerolactone] was incubated for 24 hours with 10 ng/mL. Cells not treated with UV irradiation and the DHPV were used as control cells.

DHPV는 카카오 파우더에 대한 양성 대조군 (positive control)으로 사용한다. 쥐 또는 인간의 경우, 다양한 물질이 조합되어 있는 카카오 파우더를 섭취 또는 처리 하였을 때, 생체 내 대사 작용에 의해 카카오 파우더의 물성이 바뀌고 상기 바뀐 물성의 카카오파우더에 의해 실제 체내에서 효과가 나타난다. DHPV is used as a positive control for cacao powder. In the case of rats or humans, when ingesting or processing cacao powder, which is a combination of various substances, the physical properties of cacao powder are changed by metabolism in vivo, and the effect is actually in the body by the cacao powder of the changed physical properties.

HaCaT 세포는 생체 내에서 일어나는 대사 작용을 모식할 수 없다. 따라서 실제 생체 내에서 카카오 파우더가 대사되어 나오는 산물인 DHPV를 처리할 경우 보다 명확한 카카오 파우더의 효과를 측정할 수 있으며, 카카오 파우더의 대사산물 중 광노화 방지 효과를 나타내는 물질을 정확한 판단할 수 있다.HaCaT cells cannot model metabolic actions occurring in vivo. Therefore, when DHPV, a product from which cacao powder is metabolized in the body, is treated, the effect of cacao powder can be more clearly measured, and a substance that exhibits photoaging prevention effect among the metabolites of cacao powder can be accurately determined.

4-2. Involucrin DNA 메틸화 위치 분석4-2. Involucrin DNA methylation site analysis

실시예 4-1에서 제작한 인간 광노화 피부세포를 harvest하고, NucleoSin® Tissue Kit (Macherey-Nagel, Germany)를 이용하여 DNA를 추출하였다. 추출한 DNA를 Nano Drop을 이용하여 정량하고 Quality를 확인하였다. 다음으로 추출한 DNA의 메틸화 분석을 위해 EZ DNA Methylation-LightningTM Kit (Zymoresearch, CA, USA)를 이용하고 Bisulfite 를 처리하여 메틸화가 되지 않은 시토신 (Cytosine) 잔기를 우라실 (Uracil) 잔기로 변환하였다. The human photoaging skin cells prepared in Example 4-1 were harvested, and DNA was extracted using NucleoSin® Tissue Kit (Macherey-Nagel, Germany). The extracted DNA was quantified using Nano Drop and the quality was checked. Next, for methylation analysis of the extracted DNA, EZ DNA Methylation-Lightning TM Kit (Zymoresearch, CA, USA) was used and Bisulfite was treated to convert unmethylated cytosine residues into uracil residues.

상기 Bisulfited DNA 100ng, 프라이머 쌍(IVL_MF/IVL_MR) (20pmole)을 각각 1uL, TaKaRa EpiTaq HS (5U/㎕) 0.25uL, 10X EpiTaq PCR Buffer (Mg2+ free) 5uL, 25mM MgCl2 5uL, dNTP Mixture (2.5mM each) 6 uL 를 첨가하고 최종 볼륨이 50 uL가 되도록 증류수를 첨가한 후, 98℃에서 3분간 반응시킨 후, 40 주기로 98℃에서 10초, 55℃에서 1 분, 72℃에서 30초 과정을 반복하여 반응시켰다. 다음으로 72℃에서 5분간 신장(elongation)시킨 다음 2 % (w/v) 아가로오스 겔에서 결과를 분석하였다.The Bisulfited DNA 100ng, primer pair (IVL_MF/IVL_MR) (20pmole) each 1uL, TaKaRa EpiTaq HS (5U/μL) 0.25uL, 10X EpiTaq PCR Buffer (Mg 2+ free) 5uL, 25mM MgCl 2 5uL, dNTP Mixture ( 2.5mM each) 6 uL was added and distilled water was added so that the final volume became 50 uL, and then reacted at 98℃ for 3 minutes, followed by 40 cycles at 98℃ for 10 seconds, 55℃ for 1 minute, and 72℃ for 30 seconds The process was repeated to react. Next, the results were analyzed on a 2% (w/v) agarose gel after elongation at 72° C. for 5 minutes.

메틸화 특이 PCR 프라이머를 제작함에 있어서 프라이머 내에 최소한 하나 이상의 CpG 서열을 포함시키고, 메틸화와 비메틸화 프라이머가 유사한 Tm 값을 갖도록 제작하였으며, Bisulfite conversion 과정에 있어 비메틸화된 시토신은 우라실로 변형되므로 이를 고려하며 프라이머를 제작하였다. 한편, 상기 유전자의 메틸화는 전체 유전자 풀의 0~100% 일 수 있으며, 이에 발현될 수 있는 동일 유전자 서열 전체에서 비메틸화 대비 메틸화 유전자의 양을 측정함으로써 DNA의 메틸화를 정확히 측정하였다. 상기 사항을 고려하여 메틸화 특이 PCR을 수행하기 위해 IVL_MF/IVL_MR 프라이머 쌍 (F: 서열번호 6 / R: 서열번호 7)을 제작하여 사용하였다(표 2). In preparing the methylation specific PCR primer, at least one CpG sequence was included in the primer, and the methylated and unmethylated primers were prepared to have similar Tm values.In the bisulfite conversion process, the unmethylated cytosine is transformed into uracil, so take this into account. A primer was prepared. On the other hand, the methylation of the gene may be 0 to 100% of the total gene pool, and methylation of DNA was accurately measured by measuring the amount of methylated genes compared to unmethylated in all of the same gene sequences that can be expressed. Considering the above, an IVL_MF/IVL_MR primer pair (F: SEQ ID NO: 6 / R: SEQ ID NO: 7) was prepared and used to perform methylation specific PCR (Table 2).

구체적으로, transcription start site와 시작 코돈 사이에 위치하는 untranslated region 인 5’-UTR 부위, 즉 서열번호 1의 폴리뉴클레오타이드의 5' 말단으로부터 1번째 내지 1853번째 서열까지를 (ATG를 기준으로 -1bp ~ -1853bp에 해당) Meth Primer tool 프로그램에 삽입하였다. Meth Primer tool은 입력된 서열내의 CpG 부위를 선별하여 각 프라이머에 하나 이상의 CpG 부위를 포함하도록 메틸화 및 비메틸화 프라이머 서열을 제공한다. 상기 Meth primer tool을 통해 서열번호 1의 폴리뉴클레오타이드의 5'말단으로부터 673번째 내지 783번째에 해당하는 IVL 염기서열을 CpG 부위로 선별하였으며, 이 tool을 이용하여 총 5개의 프라이머 세트를 확보했다(도 5c). 이 중 상기 표 2의 서열번호 6 내지 서열번호 9번까지의 프라이머 염기서열을 이용하여 실험을 수행하였다. Involucrin 폴리뉴클레오타이드 염기서열(서열번호 1) 중 개시코돈인 ATG로부터 -1179 내지 -1065 부위는 IVL_MF(서열번호 6), IVL_MR(서열번호 7) 프라이머 세트를 사용해 methylation specific PCR을 수행하였으며, ATG로부터 -1181 내지 -1067 부위는 IVL_UF(서열번호 8) 및 IVL_UR(서열번호 9)을 사용하여 unmethylation specific PCR을 수행하였다. Specifically, the 5'-UTR region, which is an untranslated region located between the transcription start site and the start codon, that is, From the 5'end of the polynucleotide of SEQ ID NO: 1 to the 1st to 1853th sequences (corresponding to -1bp to -1853bp based on ATG) were inserted into the Meth Primer tool program. The Meth Primer tool provides methylated and unmethylated primer sequences to include one or more CpG sites in each primer by selecting CpG sites in the input sequence. Through the Meth primer tool, the IVL nucleotide sequence corresponding to the 673 th to 783 th from the 5'end of the polynucleotide of SEQ ID NO: 1 was selected as the CpG site, and a total of 5 primer sets were obtained using this tool (Fig. 5c). Among them, an experiment was performed using the primer sequences of SEQ ID NOs: 6 to 9 in Table 2. Involucrin polynucleotide nucleotide sequence (SEQ ID NO: 1), from the start codon ATG, -1179 to -1065 sites were methylation specific PCR using the IVL_MF (SEQ ID NO: 6) and IVL_MR (SEQ ID NO: 7) primer sets, and from ATG- For sites 1181 to -1067, unmethylation specific PCR was performed using IVL_UF (SEQ ID NO: 8) and IVL_UR (SEQ ID NO: 9).

Methylation specific PCR 수행결과, IVL의 메틸화가 된 부위가 IVL의 5’-UTR 부분이며, 서열번호 1의 폴리뉴클레오타이드의 5’ 말단으로부터 680. 699. 783번째 에 존재하는 CpG 섬에서 메틸화가 일어남을 확인하였다.As a result of performing methylation specific PCR, it was confirmed that the methylated site of IVL is the 5'-UTR part of IVL, and methylation occurs in the CpG island at 680. 699. 783 from the 5'end of the polynucleotide of SEQ ID NO: 1 I did.

4-3. Involucrin DNA 메틸화 수준 분석4-3. Involucrin DNA methylation level analysis

Involucrin DNA 메틸화 수준을 분석하기 위해, 상기 실시예 4-1에서 제조한 UV를 조사하여 광노화가 유도된 피부 세포 및 UV를 처리하고 DHPV를 처리하여 피부 노화를 회복시킨 세포 각각에 대해서, IVL_MF(서열번호 6), IVL_MR(서열번호 7) 프라이머를 사용해 상기 실시예 4-2에 기재한 PCR방법과 동일한 조건에서 methylation specific PCR을 수행하였으며, IVL_UF(서열번호 8) 및 IVL_UR(서열번호 9)을 사용하여 unmethylation specific PCR을 수행하였으며, 그 결과로부터 IVL 유전자 부위에 발생한 메틸화의 수준을 확인하였다(도 5a 및 도 5b).In order to analyze the level of Involucrin DNA methylation, for each of the skin cells in which photoaging was induced by irradiation with UV prepared in Example 4-1, and cells in which skin aging was restored by treatment with UV and DHPV, IVL_MF (sequence No. 6) and IVL_MR (SEQ ID No. 7) primers were used to perform methylation specific PCR under the same conditions as the PCR method described in Example 4-2, and IVL_UF (SEQ ID No. 8) and IVL_UR (SEQ ID No. 9) were used. Thus, unmethylation specific PCR was performed, and from the results, the level of methylation occurring in the IVL gene region was confirmed (FIGS. 5A and 5B ).

　도 5a 및 도 5b에 나타난 바와 같이, UV를 조사하여 광노화가 유도된 피부 세포에서 methylation specific PCR을 수행하였을 때(M line)가 unmethylation specific PCR을 수행했을 때(U line) 보다 IVL의 5-UTR에서 메틸화 (M)가 약 1.5배 증가하였고, 이러한 메틸화는 DHPV 처리에 의해 급격히 감소됨을 확인할 수 있었다.5A and 5B, IVL 5-UTR when methylation specific PCR was performed in skin cells induced photoaging by UV irradiation (M line) than when unmethylation specific PCR was performed (U line). The methylation (M) was increased by about 1.5 times, and it was confirmed that this methylation was rapidly reduced by DHPV treatment.

상기 결과로부터 UV 조사에 의한 피부 노화 세포에서 CpG 부위로 선별된 서열번호 1의 폴리뉴클레오타이드의 5' 말단으로부터 673번째 내지 783번째에 해당하는 IVL의 5’-UTR 부위 서열의 메틸화 수준이 증가하며, 특히, 680 번째. 699 번째 및 783번째 염기가 UV 조사에 의해 메틸화되고, 상기 IVL의 메틸화된 5’-UTR 부위의 피부 노화 특이적 마커로 사용 가능함을 확인했다.From the above results, the methylation level of the 5'-UTR site sequence of IVL corresponding to the 673 th to 783 th from the 5'end of the polynucleotide of SEQ ID NO: 1 selected as the CpG site in skin senescent cells by UV irradiation increased, In particular, the 680th. It was confirmed that the 699 th and 783 th bases were methylated by UV irradiation, and could be used as a skin aging specific marker of the methylated 5'-UTR region of the IVL.

4-4. Involucrin 유전자 발현 분석4-4. Involucrin gene expression analysis

광노화 유도 인간 피부 세포 모델에서 Involucrin 유전자 발현을 분석하기 위해서, 상기 실시예 4-1에서 제조한 광노화 유도 인간 피부 세포를 채취하고, 상기 실시예 2-2와 동일한 방법을 사용하여, Involucrin 유전자 발현 분석을 수행하였다. 이에 PCR 프라이머는 표 2의 hIVL_F(서열번호 10), hIVL_R(서열번호 11)프라이머를 사용하였다. GAPDH_F와 GAPDH_R 프라이머세트(F: 서열번호14 / R: 서열번호15)는 유전자 발현의 house keeping 유전자 즉, 대조군으로 사용하였다. In order to analyze the expression of Involucrin gene in the photo-aging-induced human skin cell model, the photo-aging-induced human skin cells prepared in Example 4-1 were collected, and Involucrin gene expression was analyzed using the same method as in Example 2-2. Was performed. Accordingly, as PCR primers, hIVL_F (SEQ ID NO: 10) and hIVL_R (SEQ ID NO: 11) primers of Table 2 were used. GAPDH_F and GAPDH_R primer sets (F: SEQ ID NO: 14 / R: SEQ ID NO: 15) were used as a house keeping gene for gene expression, that is, a control.

도 6에 나타난 것과 같이, UV에 의해서 Involucrin mRNA의 발현이 약 3배 증가하였으며, UV 처리 후 DHPV 처리시에 증가된 mRNA의 양이 다시 회복됨을 확인하였다.As shown in FIG. 6, it was confirmed that the expression of Involucrin mRNA was increased by about 3 times by UV, and the amount of mRNA increased upon DHPV treatment after UV treatment was recovered again.

4-5. 인간 피부 광노화 세포에서 Involucrin 단백질 발현 수준 분석4-5. Involucrin protein expression level analysis in human skin photoaging cells

실시예 4-1에서 제작한 광노화 유도 인간 피부 세포에서 IVL 단백질의 발현 변화를 분석하기 위해, 하기와 같은 방법으로 실험을 수행하였다.In order to analyze the change in the expression of the IVL protein in the photoaging-induced human skin cells prepared in Example 4-1, an experiment was performed in the following manner.

구체적으로, 인간 피부 광노화 세포에 대하여 면역블롯 분석을 수행하였으며, 세포를 protease inhibitor cocktail kit (P3100-005; GenDEPOT, Barker, TX), 및 phosphatase inhibitor (sc-45065; Santa Cruz Biotechnology, Santa Cruz, CA)를 포함한 세포 용해 버퍼를 사용하여 분해하였다 (#9803; Cell SignalingTechnology, Danvers, MA). 세포 용해물 20 ug을 포함하는 부분 표본을 SDS-polyacrylamide 젤 상에서 전기영동하여 분리한 후, transfer buffer (25 mM Tris, 192 mM glycine, 20% [v/v] methanol [pH8.3]), 75 V, 40℃ 조건에서 180분 동안 니트로셀룰로즈 막 (Amersham, Buckinghamshire, UK)으로 이동시켰다. 다음으로 막을 상온에서 60분 동안 0.1% (v/v) Tween-20를 포함하는 3% (w/v) BSA의 PBS로 블락킹한 후, 항-IVL(1:1000, sc-28557, Santa Cruz) 항체와 함께 배양하였다. 이차 항체는 HRP-결합된 염소 항-마우스 IgG (1:1000; sc 2005, SantaCruz)를 사용하였으며, ECL lumi Femto solution A/B(Dogen, Seoul, Korea)를 사용하여 블롯들을 현상하고 분석하였고 그 결과를 도 7에 나타냈다.Specifically, immunoblot analysis was performed on human skin photoaging cells, and the cells were subjected to protease inhibitor cocktail kit (P3100-005; GenDEPOT, Barker, TX), and phosphatase inhibitor (sc-45065; Santa Cruz Biotechnology, Santa Cruz, CA). ) Was digested using a cell lysis buffer containing (#9803; Cell Signaling Technology, Danvers, MA). Aliquots containing 20 ug of cell lysate were separated by electrophoresis on SDS-polyacrylamide gel, and then transfer buffer (25 mM Tris, 192 mM glycine, 20% [v/v] methanol [pH8.3]), 75 V was transferred to a nitrocellulose membrane (Amersham, Buckinghamshire, UK) for 180 minutes at 40°C. Next, the membrane was blocked with PBS of 3% (w/v) BSA containing 0.1% (v/v) Tween-20 for 60 minutes at room temperature, and then anti-IVL (1:1000, sc-28557, Santa Cruz) was incubated with the antibody. As a secondary antibody, HRP-conjugated goat anti-mouse IgG (1:1000; sc 2005, SantaCruz) was used, and blots were developed and analyzed using ECL lumi Femto solution A/B (Dogen, Seoul, Korea). The results are shown in FIG. 7.

도 7에 나타낸 것과 같이, 인간 피부 세포에 대하여 UV를 처리하여 광노화가 유도된 경우 IVL 단백질의 발현량이 UV를 처리하지 않았을 때에 비해서 β-actin 대비 약 3배 이상 증가함을 확인할 수 있었다. 다만, UV를 처리했을 때 증가했던 PFN1의 단백질의 양이 카카오의 대사 산물 DHPV를 처리한 경우, IVL 단백질의 양이 어느 정도 회복됨을 확인하였다.As shown in FIG. 7, when photoaging was induced by UV treatment on human skin cells, it was confirmed that the expression level of IVL protein increased by about 3 times or more compared to β-actin when UV was not treated. However, it was confirmed that the amount of IVL protein recovered to some extent when the amount of protein of PFN1 increased when UV treatment was treated with DHPV, a metabolite of cacao.

<110> SUNGKWANG MEDICAL FOUNDATION College of Medicine Pochon CHA University Industry-Academic Cooperation Foundation <120> Diagnosis for skin aging caused by increased formation of skin wrinkles <130> DPP20194155KR <160> 15 <170> KoPatentIn 3.0 <210> 1 <211> 4542 <212> DNA <213> Artificial Sequence <220> <223> Involucrin gene full sequence <400> 1 ctcctagaag ccttctactt gactctactt ggcctaaagt caaactccct ccaccaaaga 60 cagagtttat ttccacatag gatggagtta aaaaatatat tctgagagag gaagggcttg 120 tggcccaaga gaacacccca gaaataccac cccttcatgg gaagtgactc tatcttcaaa 180 catataaccc agcctggaca tccccgaaag acacataact ttccatttca tgcccttgaa 240 agtgaatctt ttggcctaat aatgagaaca aactcatttt gaaagtggaa aaattgagat 300 tcagagcaga agtttgacta aggtcacaaa acagtaggat gcctcactca gctccctgtg 360 cctaggtcag aaaagcatca caggaatagt tgagctacca gaatcctctg gccaggcagg 420 agctgtgtgt ccctgggaaa tggggcccta aagggtttgc tgcttaagat gcctgtggtg 480 agtcaggaag gggttagagg aagttgacca actagagtgg tgaaacctgt ccatcacctt 540 caacctggag ggaggccagg ctgcagaatg atataaagag tgccctgact cctgctcagc 600 tcagcactcc accaaagcct ctgcctcagc cttactgtga gtctggtaag tgtcggatgg 660 tagaaccagg gttgggactc gggacctcca acagcatacg atgtggtggg ggtgggcagc 720 ctgggtgggg gtgggcatta ctctggggct ggattcagct ggactttcat tctaggggga 780 ctcgagtcag agtactgaga gaaaagtgcc ttggcacaga agtgcagaac agagagtaat 840 catcctatgt cccatctttt cttgtgacca tatttttgga tttgtgtgtg agagagaatt 900 atggaaggga ggaggggaat agcattcaac ttctttccta aacctcttgg gttttgacag 960 accatcattt tgccttcttt atggagggag aggttcaggg aagagcttct accttttggc 1020 tatgctgcac agagggatgg cagaatgggg aaacctttct atttggagaa acctaggcag 1080 agctgggaca ggaaaactca acttagaagt ataagacttg gaagaacaac ctccaactct 1140 cagcaacctt ccagctcccg cagccccacc ccagacacaa ggactgcagc taaacctcag 1200 aaggtcagga gagaaagcag ccctggggtt gaataggcca acctgctggc tttacagggg 1260 ggaaaaccaa atcccaggag actaagtgac atgcccagaa acacacagca ttccaatggg 1320 agattcaggc ctagagcatg tcctgtggct ccagtctgga ggtcacacca tgacctctta 1380 ggtcctctct ggcacggcct attggttttc taggacttgg tgttctccaa gagacatttc 1440 attccctaag gccttactcc tcactgtgac ataatcccag aacgcatctc tgctccttgg 1500 tcagtgaagc gatgagggtg gacacaagga ctagacaaga gcagacagtg agctggcacc 1560 tgacccaccc ttgcagaaca gccctgcaga cagatctcct tgttggctct cacctgggaa 1620 caaggaggct cctaggagga cctttctctg cccctccaca tttccaccct tctctctctg 1680 ctgcttttgg gaaatgatag tccagaggtg gtagaacagt accctgccca agggaagagg 1740 ggatgctaaa aaaccagata cttctgcaga ttcccaaggt ttcatctatt tcctttgcct 1800 tcagcctgtg catcagacct cttctgtctt tcaggttgac agtagcttct aagatgtccc 1860 agcaacacac actgccagtg accctctccc ctgccctcag tcaggagctc ctcaagactg 1920 ttcctcctcc agtcaatacc catcaggagc aaatgaaaca gccaactcca ctgcctcccc 1980 catgccagaa ggtgcctgtc gagctcccag tggaggtccc atcaaagcaa gaggaaaagc 2040 acatgactgc tgtaaaggga ctgcctgagc aagaatgtga gcaacagcag aaggagccac 2100 aggagcagga gctgcagcaa cagcactggg aacagcatga ggaatatcag aaagcagaaa 2160 acccagagca gcagcttaag caggagaaaa cacaaaggga tcagcagcta aacaaacagc 2220 tggaagaaga gaagaagctc ttagaccagc aactggatca agagctagtc aagagagatg 2280 agcaactggg aatgaagaaa gagcaactgt tggagctccc agagcagcag gaggggcacc 2340 tgaagcacct agagcagcag gagggacagc tgaagcaccc ggagcagcag gaggggcagc 2400 tggagctccc agagcagcag gaggggcagc tggagctccc agagcagcag gaggggcagc 2460 tggagctccc agagcagcag gaggggcagc tggagctccc agagcagcag gaggggcagc 2520 tggagctccc agagcagcag gaggggcagc tggagctccc acagcagcag gaggggcagc 2580 tggagctctc tgagcagcag gaggggcagc tggagctctc tgagcagcag gagggacagc 2640 tgaagcacct ggagcaccag gaggggcagc tggaggtccc agaggagcag atggggcagc 2700 tgaagtacct ggaacagcag gaggggcagc tgaagcacct ggatcagcag gagaagcagc 2760 cagagctccc agagcagcag atggggcagc tgaagcacct ggagcagcag gaggggcagc 2820 ctaagcatct ggagcagcag gaggggcaac tggagcagct ggaggagcag gaggggcagc 2880 tgaagcacct ggagcagcag gaggggcagc tggagcacct ggagcaccag gaagggcagc 2940 tggggctccc agagcagcag gtgctgcagc tgaagcagct agagaagcag caggggcagc 3000 caaagcacct ggaggaggag gaggggcagc tgaagcacct ggtgcagcag gaggggcagc 3060 tgaagcatct ggtgcagcag gaggggcagc tggagcagca ggagaggcag gtggagcacc 3120 tggagcagca ggtggggcag ctgaagcacc tagaggagca ggagggacaa ctgaagcatc 3180 tggagcagca gcaggggcag ttggaggtcc cagagcagca ggtggggcag ccaaagaacc 3240 tggagcagga ggagaagcaa ctggagctcc cagagcagca agagggccag gtgaagcacc 3300 tggagaagca ggaggcacag ctggagctcc cagagcagca ggtaggacag ccaaagcacc 3360 tggaacagca ggaaaagcac ctagagcacc cagagcagca ggacggacaa ctaaaacatc 3420 tggagcagca ggaggggcag ctgaaggacc tggagcagca gaaggggcag ctggagcagc 3480 ctgtgtttgc cccagctcca ggccaggtcc aagacattca accagccctg cccacaaagg 3540 gagaagtatt gcttcctgta gagcaccagc agcagaagca ggaggtgcag tggccaccca 3600 aacataaata accacccgca gtgtccagag gccctcagat cgtctcatac aagggaagag 3660 agagccactg gctccactta tttcgggtcc gctaggtggc ccgtctcatc tgtgaacttg 3720 actctgtccc tctacatgtc tctttaatgg ggtgagggtg ggggagagag ggaattattg 3780 tccagtgcca accccaatga ccccaatccc aacctcaggt gagcagagcc tctacttgag 3840 ggactattgt tactatagga atccttactt ccccagtatt gaagctgaat cagtgagtgt 3900 gtacaatgat acataataaa tcctggaagt cttgggatcc tatattctct ttagcatttt 3960 cttctatcac accacataaa aacctgtgta tgggtcaatg gctgcaagag actcccacgg 4020 cccattctca aaggaggaca gactcttttt aaattttggt cctcaaacca ctcaatagat 4080 ctaacagttc ctgaaaaaga aacaaacccc cccccaaaaa aaatcagctt cacttgatgt 4140 acttgaaaac aacacttgcc agccatgaaa aggggatacg ttgttctggt tgcatctcag 4200 tccaacacta ccttccacca caacaccaca ctcaacccct ggcagagccc accctacact 4260 tctgctccag actcagctcc tctcaggagg gggactggga agatgctagg aaagcttggg 4320 ggctccatct gggttctagt cccttccctg gaaacatttc ctggctcttc ttcttgggtt 4380 ttctctctta gaaaatctca tgatttcaaa aagtcttatg gtctgcctac ttggctgagg 4440 aagactttag caaagcaata gaagtagaat tgggcaaggt gggaagagga ggtgttccag 4500 attgtctctg agggaaagtg acagcgttat taaagtaagt aa 4542 <210> 2 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Exon1 of Involucrin gene <400> 2 tcagcactcc accaaagcct ctgcctcagc cttactgtga gtctg 45 <210> 3 <211> 1192 <212> DNA <213> Artificial Sequence <220> <223> 5'-UTR of Involucrin gene <400> 3 accagggttg ggactcggga cctccaacag catacgatgt ggtgggggtg ggcagcctgg 60 gtgggggtgg gcattactct ggggctggat tcagctggac tttcattcta gggggactcg 120 agtcagagta ctgagagaaa agtgccttgg cacagaagtg cagaacagag agtaatcatc 180 ctatgtccca tcttttcttg tgaccatatt tttggatttg tgtgtgagag agaattatgg 240 aagggaggag gggaatagca ttcaacttct ttcctaaacc tcttgggttt tgacagacca 300 tcattttgcc ttctttatgg agggagaggt tcagggaaga gcttctacct tttggctatg 360 ctgcacagag ggatggcaga atggggaaac ctttctattt ggagaaacct aggcagagct 420 gggacaggaa aactcaactt agaagtataa gacttggaag aacaacctcc aactctcagc 480 aaccttccag ctcccgcagc cccaccccag acacaaggac tgcagctaaa cctcagaagg 540 tcaggagaga aagcagccct ggggttgaat aggccaacct gctggcttta caggggggaa 600 aaccaaatcc caggagacta agtgacatgc ccagaaacac acagcattcc aatgggagat 660 tcaggcctag agcatgtcct gtggctccag tctggaggtc acaccatgac ctcttaggtc 720 ctctctggca cggcctattg gttttctagg acttggtgtt ctccaagaga catttcattc 780 cctaaggcct tactcctcac tgtgacataa tcccagaacg catctctgct ccttggtcag 840 tgaagcgatg agggtggaca caaggactag acaagagcag acagtgagct ggcacctgac 900 ccacccttgc agaacagccc tgcagacaga tctccttgtt ggctctcacc tgggaacaag 960 gaggctccta ggaggacctt tctctgcccc tccacatttc cacccttctc tctctgctgc 1020 ttttgggaaa tgatagtcca gaggtggtag aacagtaccc tgcccaaggg aagaggggat 1080 gctaaaaaac cagatacttc tgcagattcc caaggtttca tctatttcct ttgccttcag 1140 cctgtgcatc agacctcttc tgtctttcag gttgacagta gcttctaaga tg 1192 <210> 4 <211> 140 <212> DNA <213> Artificial Sequence <220> <223> 5'-UTR portion to be methylated <400> 4 tgggactcgg gacctccaac agcatacgat gtggtggggg tgggcagcct gggtgggggt 60 gggcattact ctggggctgg attcagctgg actttcattc tagggggact cgagtcagag 120 tactgagaga aaagtgcctt 140 <210> 5 <211> 2108 <212> DNA <213> Artificial Sequence <220> <223> Exon2 of Involucrin gene <400> 5 gttgacagta gcttctaaga tgtcccagca acacacactg ccagtgaccc tctcccctgc 60 cctcagtcag gagctcctca agactgttcc tcctccagtc aatacccatc aggagcaaat 120 gaaacagcca actccactgc ctcccccatg ccagaaggtg cctgtcgagc tcccagtgga 180 ggtcccatca aagcaagagg aaaagcacat gactgctgta aagggactgc ctgagcaaga 240 atgtgagcaa cagcagaagg agccacagga gcaggagctg cagcaacagc actgggaaca 300 gcatgaggaa tatcagaaag cagaaaaccc agagcagcag cttaagcagg agaaaacaca 360 aagggatcag cagctaaaca aacagctgga agaagagaag aagctcttag accagcaact 420 ggatcaagag ctagtcaaga gagatgagca actgggaatg aagaaagagc aactgttgga 480 gctcccagag cagcaggagg ggcacctgaa gcacctagag cagcaggagg gacagctgaa 540 gcacccggag cagcaggagg ggcagctgga gctcccagag cagcaggagg ggcagctgga 600 gctcccagag cagcaggagg ggcagctgga gctcccagag cagcaggagg ggcagctgga 660 gctcccagag cagcaggagg ggcagctgga gctcccagag cagcaggagg ggcagctgga 720 gctcccacag cagcaggagg ggcagctgga gctctctgag cagcaggagg ggcagctgga 780 gctctctgag cagcaggagg gacagctgaa gcacctggag caccaggagg ggcagctgga 840 ggtcccagag gagcagatgg ggcagctgaa gtacctggaa cagcaggagg ggcagctgaa 900 gcacctggat cagcaggaga agcagccaga gctcccagag cagcagatgg ggcagctgaa 960 gcacctggag cagcaggagg ggcagcctaa gcatctggag cagcaggagg ggcaactgga 1020 gcagctggag gagcaggagg ggcagctgaa gcacctggag cagcaggagg ggcagctgga 1080 gcacctggag caccaggaag ggcagctggg gctcccagag cagcaggtgc tgcagctgaa 1140 gcagctagag aagcagcagg ggcagccaaa gcacctggag gaggaggagg ggcagctgaa 1200 gcacctggtg cagcaggagg ggcagctgaa gcatctggtg cagcaggagg ggcagctgga 1260 gcagcaggag aggcaggtgg agcacctgga gcagcaggtg gggcagctga agcacctaga 1320 ggagcaggag ggacaactga agcatctgga gcagcagcag gggcagttgg aggtcccaga 1380 gcagcaggtg gggcagccaa agaacctgga gcaggaggag aagcaactgg agctcccaga 1440 gcagcaagag ggccaggtga agcacctgga gaagcaggag gcacagctgg agctcccaga 1500 gcagcaggta ggacagccaa agcacctgga acagcaggaa aagcacctag agcacccaga 1560 gcagcaggac ggacaactaa aacatctgga gcagcaggag gggcagctga aggacctgga 1620 gcagcagaag gggcagctgg agcagcctgt gtttgcccca gctccaggcc aggtccaaga 1680 cattcaacca gccctgccca caaagggaga agtattgctt cctgtagagc accagcagca 1740 gaagcaggag gtgcagtggc cacccaaaca taaataacca cccgcagtgt ccagaggccc 1800 tcagatcgtc tcatacaagg gaagagagag ccactggctc cacttatttc gggtccgcta 1860 ggtggcccgt ctcatctgtg aacttgactc tgtccctcta catgtctctt taatggggtg 1920 agggtggggg agagagggaa ttattgtcca gtgccaaccc caatgacccc aatcccaacc 1980 tcaggtgagc agagcctcta cttgagggac tattgttact ataggaatcc ttacttcccc 2040 agtattgaag ctgaatcagt gagtgtgtac aatgatacat aataaatcct ggaagtcttg 2100 ggatccta 2108 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> IVL_MF <400> 6 ggattcggga tttttaatag tatacg 26 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> IVL_MR <400> 7 aacacttttc tctcaatact ctaactcg 28 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> IVL_UF <400> 8 tgggatttgg gatttttaat agtatat 27 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> IVL_UR <400> 9 aaaacacttt tctctcaata ctctaactca 30 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> hIVL_F <400> 10 cccatcaaag caagaggaaa 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> hIVL_R <400> 11 agctgctgat ccctttgtgt 20 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> mIVL_F <400> 12 gtgaagccaa aactaaagca ac 22 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> mIVL_R <400> 13 catagacaag aggatggtca gg 22 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_F <400> 14 accacagtcc atgccatcac 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_R <400> 15 tccaccaccc tgttgctgta 20 <110> SUNGKWANG MEDICAL FOUNDATION College of Medicine Pochon CHA University Industry-Academic Cooperation Foundation <120> Diagnosis for skin aging caused by increased formation of skin wrinkles <130> DPP20194155KR <160> 15 <170> KoPatentIn 3.0 <210> 1 <211> 4542 <212> DNA <213> Artificial Sequence <220> <223> Involucrin gene full sequence <400> 1 ctcctagaag ccttctactt gactctactt ggcctaaagt caaactccct ccaccaaaga 60 cagagtttat ttccacatag gatggagtta aaaaatatat tctgagagag gaagggcttg 120 tggcccaaga gaacacccca gaaataccac cccttcatgg gaagtgactc tatcttcaaa 180 catataaccc agcctggaca tccccgaaag acacataact ttccatttca tgcccttgaa 240 agtgaatctt ttggcctaat aatgagaaca aactcatttt gaaagtggaa aaattgagat 300 tcagagcaga agtttgacta aggtcacaaa acagtaggat gcctcactca gctccctgtg 360 cctaggtcag aaaagcatca caggaatagt tgagctacca gaatcctctg gccaggcagg 420 agctgtgtgt ccctgggaaa tggggcccta aagggtttgc tgcttaagat gcctgtggtg 480 agtcaggaag gggttagagg aagttgacca actagagtgg tgaaacctgt ccatcacctt 540 caacctggag ggaggccagg ctgcagaatg atataaagag tgccctgact cctgctcagc 600 tcagcactcc accaaagcct ctgcctcagc cttactgtga gtctggtaag tgtcggatgg 660 tagaaccagg gttgggactc gggacctcca acagcatacg atgtggtggg ggtgggcagc 720 ctgggtgggg gtgggcatta ctctggggct ggattcagct ggactttcat tctaggggga 780 ctcgagtcag agtactgaga gaaaagtgcc ttggcacaga agtgcagaac agagagtaat 840 catcctatgt cccatctttt cttgtgacca tatttttgga tttgtgtgtg agagagaatt 900 atggaaggga ggaggggaat agcattcaac ttctttccta aacctcttgg gttttgacag 960 accatcattt tgccttcttt atggagggag aggttcaggg aagagcttct accttttggc 1020 tatgctgcac agagggatgg cagaatgggg aaacctttct atttggagaa acctaggcag 1080 agctgggaca ggaaaactca acttagaagt ataagacttg gaagaacaac ctccaactct 1140 cagcaacctt ccagctcccg cagccccacc ccagacacaa ggactgcagc taaacctcag 1200 aaggtcagga gagaaagcag ccctggggtt gaataggcca acctgctggc tttacagggg 1260 ggaaaaccaa atcccaggag actaagtgac atgcccagaa acacacagca ttccaatggg 1320 agattcaggc ctagagcatg tcctgtggct ccagtctgga ggtcacacca tgacctctta 1380 ggtcctctct ggcacggcct attggttttc taggacttgg tgttctccaa gagacatttc 1440 attccctaag gccttactcc tcactgtgac ataatcccag aacgcatctc tgctccttgg 1500 tcagtgaagc gatgagggtg gacacaagga ctagacaaga gcagacagtg agctggcacc 1560 tgacccaccc ttgcagaaca gccctgcaga cagatctcct tgttggctct cacctgggaa 1620 caaggaggct cctaggagga cctttctctg cccctccaca tttccaccct tctctctctg 1680 ctgcttttgg gaaatgatag tccagaggtg gtagaacagt accctgccca agggaagagg 1740 ggatgctaaa aaaccagata cttctgcaga ttcccaaggt ttcatctatt tcctttgcct 1800 tcagcctgtg catcagacct cttctgtctt tcaggttgac agtagcttct aagatgtccc 1860 agcaacacac actgccagtg accctctccc ctgccctcag tcaggagctc ctcaagactg 1920 ttcctcctcc agtcaatacc catcaggagc aaatgaaaca gccaactcca ctgcctcccc 1980 catgccagaa ggtgcctgtc gagctcccag tggaggtccc atcaaagcaa gaggaaaagc 2040 acatgactgc tgtaaaggga ctgcctgagc aagaatgtga gcaacagcag aaggagccac 2100 aggagcagga gctgcagcaa cagcactggg aacagcatga ggaatatcag aaagcagaaa 2160 acccagagca gcagcttaag caggagaaaa cacaaaggga tcagcagcta aacaaacagc 2220 tggaagaaga gaagaagctc ttagaccagc aactggatca agagctagtc aagagagatg 2280 agcaactggg aatgaagaaa gagcaactgt tggagctccc agagcagcag gaggggcacc 2340 tgaagcacct agagcagcag gagggacagc tgaagcaccc ggagcagcag gaggggcagc 2400 tggagctccc agagcagcag gaggggcagc tggagctccc agagcagcag gaggggcagc 2460 tggagctccc agagcagcag gaggggcagc tggagctccc agagcagcag gaggggcagc 2520 tggagctccc agagcagcag gaggggcagc tggagctccc acagcagcag gaggggcagc 2580 tggagctctc tgagcagcag gaggggcagc tggagctctc tgagcagcag gagggacagc 2640 tgaagcacct ggagcaccag gaggggcagc tggaggtccc agaggagcag atggggcagc 2700 tgaagtacct ggaacagcag gaggggcagc tgaagcacct ggatcagcag gagaagcagc 2760 cagagctccc agagcagcag atggggcagc tgaagcacct ggagcagcag gaggggcagc 2820 ctaagcatct ggagcagcag gaggggcaac tggagcagct ggaggagcag gaggggcagc 2880 tgaagcacct ggagcagcag gaggggcagc tggagcacct ggagcaccag gaagggcagc 2940 tggggctccc agagcagcag gtgctgcagc tgaagcagct agagaagcag caggggcagc 3000 caaagcacct ggaggaggag gaggggcagc tgaagcacct ggtgcagcag gaggggcagc 3060 tgaagcatct ggtgcagcag gaggggcagc tggagcagca ggagaggcag gtggagcacc 3120 tggagcagca ggtggggcag ctgaagcacc tagaggagca ggagggacaa ctgaagcatc 3180 tggagcagca gcaggggcag ttggaggtcc cagagcagca ggtggggcag ccaaagaacc 3240 tggagcagga ggagaagcaa ctggagctcc cagagcagca agagggccag gtgaagcacc 3300 tggagaagca ggaggcacag ctggagctcc cagagcagca ggtaggacag ccaaagcacc 3360 tggaacagca ggaaaagcac ctagagcacc cagagcagca ggacggacaa ctaaaacatc 3420 tggagcagca ggaggggcag ctgaaggacc tggagcagca gaaggggcag ctggagcagc 3480 ctgtgtttgc cccagctcca ggccaggtcc aagacattca accagccctg cccacaaagg 3540 gagaagtatt gcttcctgta gagcaccagc agcagaagca ggaggtgcag tggccaccca 3600 aacataaata accacccgca gtgtccagag gccctcagat cgtctcatac aagggaagag 3660 agagccactg gctccactta tttcgggtcc gctaggtggc ccgtctcatc tgtgaacttg 3720 actctgtccc tctacatgtc tctttaatgg ggtgagggtg ggggagagag ggaattattg 3780 tccagtgcca accccaatga ccccaatccc aacctcaggt gagcagagcc tctacttgag 3840 ggactattgt tactatagga atccttactt ccccagtatt gaagctgaat cagtgagtgt 3900 gtacaatgat acataataaa tcctggaagt cttgggatcc tatattctct ttagcatttt 3960 cttctatcac accacataaa aacctgtgta tgggtcaatg gctgcaagag actcccacgg 4020 cccattctca aaggaggaca gactcttttt aaattttggt cctcaaacca ctcaatagat 4080 ctaacagttc ctgaaaaaga aacaaacccc cccccaaaaa aaatcagctt cacttgatgt 4140 acttgaaaac aacacttgcc agccatgaaa aggggatacg ttgttctggt tgcatctcag 4200 tccaacacta ccttccacca caacaccaca ctcaacccct ggcagagccc accctacact 4260 tctgctccag actcagctcc tctcaggagg gggactggga agatgctagg aaagcttggg 4320 ggctccatct gggttctagt cccttccctg gaaacatttc ctggctcttc ttcttgggtt 4380 ttctctctta gaaaatctca tgatttcaaa aagtcttatg gtctgcctac ttggctgagg 4440 aagactttag caaagcaata gaagtagaat tgggcaaggt gggaagagga ggtgttccag 4500 attgtctctg agggaaagtg acagcgttat taaagtaagt aa 4542 <210> 2 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Exon1 of Involucrin gene <400> 2 tcagcactcc accaaagcct ctgcctcagc cttactgtga gtctg 45 <210> 3 <211> 1192 <212> DNA <213> Artificial Sequence <220> <223> 5'-UTR of Involucrin gene <400> 3 accagggttg ggactcggga cctccaacag catacgatgt ggtgggggtg ggcagcctgg 60 gtgggggtgg gcattactct ggggctggat tcagctggac tttcattcta gggggactcg 120 agtcagagta ctgagagaaa agtgccttgg cacagaagtg cagaacagag agtaatcatc 180 ctatgtccca tcttttcttg tgaccatatt tttggatttg tgtgtgagag agaattatgg 240 aagggaggag gggaatagca ttcaacttct ttcctaaacc tcttgggttt tgacagacca 300 tcattttgcc ttctttatgg agggagaggt tcagggaaga gcttctacct tttggctatg 360 ctgcacagag ggatggcaga atggggaaac ctttctattt ggagaaacct aggcagagct 420 gggacaggaa aactcaactt agaagtataa gacttggaag aacaacctcc aactctcagc 480 aaccttccag ctcccgcagc cccaccccag acacaaggac tgcagctaaa cctcagaagg 540 tcaggagaga aagcagccct ggggttgaat aggccaacct gctggcttta caggggggaa 600 aaccaaatcc caggagacta agtgacatgc ccagaaacac acagcattcc aatgggagat 660 tcaggcctag agcatgtcct gtggctccag tctggaggtc acaccatgac ctcttaggtc 720 ctctctggca cggcctattg gttttctagg acttggtgtt ctccaagaga catttcattc 780 cctaaggcct tactcctcac tgtgacataa tcccagaacg catctctgct ccttggtcag 840 tgaagcgatg agggtggaca caaggactag acaagagcag acagtgagct ggcacctgac 900 ccacccttgc agaacagccc tgcagacaga tctccttgtt ggctctcacc tgggaacaag 960 gaggctccta ggaggacctt tctctgcccc tccacatttc cacccttctc tctctgctgc 1020 ttttgggaaa tgatagtcca gaggtggtag aacagtaccc tgcccaaggg aagaggggat 1080 gctaaaaaac cagatacttc tgcagattcc caaggtttca tctatttcct ttgccttcag 1140 cctgtgcatc agacctcttc tgtctttcag gttgacagta gcttctaaga tg 1192 <210> 4 <211> 140 <212> DNA <213> Artificial Sequence <220> <223> 5'-UTR portion to be methylated <400> 4 tgggactcgg gacctccaac agcatacgat gtggtggggg tgggcagcct gggtgggggt 60 gggcattact ctggggctgg attcagctgg actttcattc tagggggact cgagtcagag 120 tactgagaga aaagtgcctt 140 <210> 5 <211> 2108 <212> DNA <213> Artificial Sequence <220> <223> Exon2 of Involucrin gene <400> 5 gttgacagta gcttctaaga tgtcccagca acacacactg ccagtgaccc tctcccctgc 60 cctcagtcag gagctcctca agactgttcc tcctccagtc aatacccatc aggagcaaat 120 gaaacagcca actccactgc ctcccccatg ccagaaggtg cctgtcgagc tcccagtgga 180 ggtcccatca aagcaagagg aaaagcacat gactgctgta aagggactgc ctgagcaaga 240 atgtgagcaa cagcagaagg agccacagga gcaggagctg cagcaacagc actgggaaca 300 gcatgaggaa tatcagaaag cagaaaaccc agagcagcag cttaagcagg agaaaacaca 360 aagggatcag cagctaaaca aacagctgga agaagagaag aagctcttag accagcaact 420 ggatcaagag ctagtcaaga gagatgagca actgggaatg aagaaagagc aactgttgga 480 gctcccagag cagcaggagg ggcacctgaa gcacctagag cagcaggagg gacagctgaa 540 gcacccggag cagcaggagg ggcagctgga gctcccagag cagcaggagg ggcagctgga 600 gctcccagag cagcaggagg ggcagctgga gctcccagag cagcaggagg ggcagctgga 660 gctcccagag cagcaggagg ggcagctgga gctcccagag cagcaggagg ggcagctgga 720 gctcccacag cagcaggagg ggcagctgga gctctctgag cagcaggagg ggcagctgga 780 gctctctgag cagcaggagg gacagctgaa gcacctggag caccaggagg ggcagctgga 840 ggtcccagag gagcagatgg ggcagctgaa gtacctggaa cagcaggagg ggcagctgaa 900 gcacctggat cagcaggaga agcagccaga gctcccagag cagcagatgg ggcagctgaa 960 gcacctggag cagcaggagg ggcagcctaa gcatctggag cagcaggagg ggcaactgga 1020 gcagctggag gagcaggagg ggcagctgaa gcacctggag cagcaggagg ggcagctgga 1080 gcacctggag caccaggaag ggcagctggg gctcccagag cagcaggtgc tgcagctgaa 1140 gcagctagag aagcagcagg ggcagccaaa gcacctggag gaggaggagg ggcagctgaa 1200 gcacctggtg cagcaggagg ggcagctgaa gcatctggtg cagcaggagg ggcagctgga 1260 gcagcaggag aggcaggtgg agcacctgga gcagcaggtg gggcagctga agcacctaga 1320 ggagcaggag ggacaactga agcatctgga gcagcagcag gggcagttgg aggtcccaga 1380 gcagcaggtg gggcagccaa agaacctgga gcaggaggag aagcaactgg agctcccaga 1440 gcagcaagag ggccaggtga agcacctgga gaagcaggag gcacagctgg agctcccaga 1500 gcagcaggta ggacagccaa agcacctgga acagcaggaa aagcacctag agcacccaga 1560 gcagcaggac ggacaactaa aacatctgga gcagcaggag gggcagctga aggacctgga 1620 gcagcagaag gggcagctgg agcagcctgt gtttgcccca gctccaggcc aggtccaaga 1680 cattcaacca gccctgccca caaagggaga agtattgctt cctgtagagc accagcagca 1740 gaagcaggag gtgcagtggc cacccaaaca taaataacca cccgcagtgt ccagaggccc 1800 tcagatcgtc tcatacaagg gaagagagag ccactggctc cacttatttc gggtccgcta 1860 ggtggcccgt ctcatctgtg aacttgactc tgtccctcta catgtctctt taatggggtg 1920 agggtggggg agagagggaa ttattgtcca gtgccaaccc caatgacccc aatcccaacc 1980 tcaggtgagc agagcctcta cttgagggac tattgttact ataggaatcc ttacttcccc 2040 agtattgaag ctgaatcagt gagtgtgtac aatgatacat aataaatcct ggaagtcttg 2100 ggatccta 2108 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> IVL_MF <400> 6 ggattcggga tttttaatag tatacg 26 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> IVL_MR <400> 7 aacacttttc tctcaatact ctaactcg 28 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> IVL_UF <400> 8 tgggatttgg gatttttaat agtatat 27 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> IVL_UR <400> 9 aaaacacttt tctctcaata ctctaactca 30 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> hIVL_F <400> 10 cccatcaaag caagaggaaa 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> hIVL_R <400> 11 agctgctgat ccctttgtgt 20 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> mIVL_F <400> 12 gtgaagccaa aactaaagca ac 22 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> mIVL_R <400> 13 catagacaag aggatggtca gg 22 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_F <400> 14 accacagtcc atgccatcac 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_R <400> 15 tccaccaccc tgttgctgta 20

Claims (1)

인볼루크린(Involucrin) 유전자의 5'-UTR(Untranslated region)의 메틸화를 측정하는 단계를 포함하고,
상기 5'-UTR의 메틸화는 서열번호 1의 폴리뉴클레오타이드 서열의 5' 말단으로부터 680번째, 699번째, 및 783번째 뉴클레오타이드에 존재하는 CpG 섬 메틸화이며,
상기 메틸화를 측정하는 단계는 서열번호 6의 염기서열과 서열번호 7의 염기서열로 이루어진 제1 프라이머 쌍, 및 서열번호 8의 염기서열과 서열번호 9의 염기서열로 이루어진 제2 프라이머 쌍을 포함하는 PCR 프라이머 세트를 사용하여 PCR을 수행하여 증폭한 결과물의 생성 유무 또는 서열분석으로 수행하는 것인,
피부주름 형성 증가에 의한 피부노화의 진단에 필요한 정보를 제공하는 방법.Measuring the methylation of the 5'-UTR (Untranslated region) of the Involucrin gene,
Methylation of said 5'-UTR is CpG island methylation present at 680th, 699th, and 783th nucleotides from the 5 'end of the polynucleotide sequence of SEQ ID NO: 1,
Measuring the methylation may include a first primer pair consisting of a nucleotide sequence of SEQ ID NO: 6 and a nucleotide sequence of SEQ ID NO: 7, and a second primer pair consisting of a nucleotide sequence of SEQ ID NO: 8 and a nucleotide sequence of SEQ ID NO: 9 By performing PCR using a PCR primer set, whether amplified results are generated or performed by sequencing,
A method of providing information necessary for the diagnosis of skin aging due to increased skin wrinkle formation.
KR1020190124080A 2019-10-07 2019-10-07 Diagnosis for skin aging caused by increased formation of skin wrinkles KR102039176B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020190124080A KR102039176B1 (en) 2019-10-07 2019-10-07 Diagnosis for skin aging caused by increased formation of skin wrinkles

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020190124080A KR102039176B1 (en) 2019-10-07 2019-10-07 Diagnosis for skin aging caused by increased formation of skin wrinkles

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
KR1020180000887A Division KR102032540B1 (en) 2018-01-03 2018-01-03 Skin aging-specific Epigenetic gene markers and detection method of skin aging using them

Publications (2)

Publication Number Publication Date
KR20190116231A KR20190116231A (en) 2019-10-14
KR102039176B1 true KR102039176B1 (en) 2019-10-31

Family

ID=68171938

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190124080A KR102039176B1 (en) 2019-10-07 2019-10-07 Diagnosis for skin aging caused by increased formation of skin wrinkles

Country Status (1)

Country Link
KR (1) KR102039176B1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2013091632A (en) 2011-10-27 2013-05-16 Kao Corp Involucrin expression promoter

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101021804B1 (en) * 2007-11-27 2011-03-17 (주)아모레퍼시픽 Oral composition for beauty culture of skin with moisturizing effect

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2013091632A (en) 2011-10-27 2013-05-16 Kao Corp Involucrin expression promoter

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
Acta Dermatoven APA (2002) 11(3):71-94
Biochemical Journal (1998) 331:61-68
Human Gene Therapy (2012) 23:83-90
Investigative Ophthalmology & Visual Science (2006) 47:1938-1946
Journal of Cellular Biochemistry (2016) 117:1092-1098
Journal of Investigative Dermatology (2012) 132(11):2505-2521
Kim 등, "Preventive effect of Cacao extract on UVB-induced skin wrinkle formation via inhibition of DNA", The 27th Annual Meeting of The Korean Society for Investigative Dermatology (2017.03.24.-25.)
Maturitas (2011) 69(3):249-256
NCBI Reference Sequence: NG_033018.1 (2017.09.15.)
Toxicology and Applied Pharmacology (2010) 243:275-282

Also Published As

Publication number Publication date
KR20190116231A (en) 2019-10-14

Similar Documents

Publication Publication Date Title
EP2542691B1 (en) Gene sets for detection ultraviolet a exposure and methods of use thereof
AU2008286361B2 (en) IVIG modulation of chemokines for treatment of multiple sclerosis, Alzheimer&#39;s disease, and Parkinson&#39;s disease
EP2647724B1 (en) Method for screening a substance for preventing skin aging
JP2016019531A (en) Methods of determining age ranges of skin samples
JP2012504426A (en) Compositions, kits and methods for cancer diagnosis, prognosis and monitoring using GOLPH3
Ljubimova et al. Gene expression abnormalities in human glial tumors identified by gene array
JP2004526410A (en) Screening method for detecting compounds that modulate the response of cells to UV exposure
CN106999592A (en) The method that the purposes of general FGFR inhibitor and identification suffer from the patient for being suitable to the cancer with general FGFR inhibitor for treating
KR102032540B1 (en) Skin aging-specific Epigenetic gene markers and detection method of skin aging using them
KR102039176B1 (en) Diagnosis for skin aging caused by increased formation of skin wrinkles
KR102039177B1 (en) Diagnosis for skin aging caused by increased thickness of skin epithelial cells
KR102039175B1 (en) Diagnosis for skin aging caused by skin photoaging
KR102039174B1 (en) PCR primer set for detecting skin aging-specific Epigenetic gene markers
KR101889529B1 (en) Skin aging-specific Epigenetic gene markers and detection of skin aging using them
KR20080096026A (en) Method and kit for prediction of chloasma
KR102108299B1 (en) MicroRNA Biomarker for Predicting Lymph Node Metastasis of Gastric Cancer
KR101850065B1 (en) Information providing method for drug treatment decisions of hypothyroidism patients by TSHR mutations and DIO2 T92A single nucleotide polymorphism detection
KR101122415B1 (en) Method of predicting spot formation on the skin with the use of spot site-accelerating genes as indication and method of screening inhibitor for spot formation on the skin
KR20180033719A (en) Use of homeoboxA9 as a melasma or seborrheic keratosis distinguishing marker
AU2013276991B2 (en) IVIG Modulations of Chemokines for Treatment of Multiple Sclerosis, Alzheimer&#39;s Disease, and Parkinson&#39;s Disease
Albretsen Depigmentation-Possible causes of change in phenotype, potential genetic mechanisms, and methods for investigating the cause of depigmentation
KR20180034256A (en) Use of guanine deaminase as a seborrheic keratosis diagnostic marker

Legal Events

Date Code Title Description
A107 Divisional application of patent
A201 Request for examination
E701 Decision to grant or registration of patent right