KR101897444B1 - Composition for screening skin irritant containing IL-1ra and method for screening skin irritant using the same - Google Patents

Abstract

The present invention relates to a composition for screening skin irritants and a method for screening skin irritants using the composition. In the case of treating hydroquinone, retinoic acid, SLS, or uriciol, which are general skin stimulants, By increasing or decreasing the expression level, harmful skin irritants can be screened using the gene.

Description

TECHNICAL FIELD The present invention relates to a composition for screening skin irritants containing IL-1ra and a method for screening skin irritants using the same.

The present invention relates to a composition for screening a skin irritant containing IL-1ra and a method for screening a skin irritant using the same.

Local phenolic materials including hydroquinone (HQ) and non-phenolic materials including retinoids are used for hyperpigmentation therapy. Topical hydroquinone is the best known treatment, and has been used in combination with topical retinoids, including all trans-retinoic acid, and combination therapies such as corticosteroids.

In addition, HQ has been used for whitening skin pigmentation, but skin irritation is one of its side effects. In localized retinoic acid (RA), the most common side effects are in the stimulation response to various strength stimuli such as drying, scaling, erythema, burning, and / or scarring. Since skin irritation can cause post-inflammatory hyperpigmentation, efforts are being made to reduce the potential for irritation without losing efficiency as a retinoic acid drug.

Skin irritation is one of the common side effects of harmful environmental hazards to humans. A repetitive, ongoing stimulant causes irritant dermatitis. The most common of these stimulants are compounds. Every substance has some sort of stimulant character. Skin irritation can be induced through various mechanisms associated with skin barrier wall destruction, induction of cytokinin cascade, and oxidative stress networks. Other classes of substances cause skin irritation through other mechanisms. Potential stimulants are associated with decreased cell viability. However, cytotoxicity experiments do not necessarily predict stimulants or non-stimulants. In extracellular experiments, there is no standardized experimental protocol for assessing irritation, and it is necessary to observe molecular responses and cellular responses induced by irritants (see Korean Patent No. 10-1134088).

Disclosure of Invention Technical Problem [8] Accordingly, the present invention has been made to solve the above problems occurring in the prior art, and it is an object of the present invention to provide a method of treating horny cells with hydroquinone (HQ), retinoic acid (RA) and sodium lauryl sulfate receptor antagonist (IL-1ra) gene expression in the cells of the present invention.

Accordingly, an object of the present invention is to provide a method for treating a skin-stimulating candidate substance, 2) measuring the level of mRNA or protein expression of the IL-1ra gene from the cells of step 1); And 3) comparing the expression level of the mRNA or protein of the gene with the expression level of the mRNA or protein of the control group treated with hydroquinone (HQ), retinoic acid (RA), SLS or uriciol to keratinocytes And a method for screening a skin irritant.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In order to accomplish the above object, the present invention provides a method for treating skin cancer, comprising the steps of: 1) treating a keratinocyte with a skin stimulating candidate substance; 2) measuring the level of mRNA or protein expression of the IL-1ra gene from the cells of step 1); And 3) comparing the expression level of the mRNA or protein of the gene with the expression level of the mRNA or protein of the control group treated with hydroquinone (HQ), retinoic acid (RA), SLS or uriciol to keratinocytes A method for screening a skin stimulating substance.

In one embodiment of the present invention, when the expression level of mRNA or protein of the IL-1ra gene in the step 3) is similar to or higher than that of at least one of the control group, it can be judged to be a skin irritant.

In another embodiment of the present invention, the method for measuring the mRNA expression level comprises the steps of RT-PCR, competitive RT-PCR, real-time RT-PCR, , RNase protection assay (RPA), Northern blotting, and DNA chips.

In another embodiment of the present invention, the method for measuring the expression level of the protein may be Western blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Immunoprecipitation Assay, Complement Fixation Assay, Fluorescence Activated Cell Sorter (FACS), and Protein Chip (FACS) were performed using the Ouchterlony immunodiffusion method, rocket immunoelectrophoresis, tissue immunostaining, protein chips). < / RTI >

In addition, the present invention provides a composition for screening a skin irritant, which comprises an agent for measuring the level of expression of an IL-1ra gene mRNA or protein.

The present invention also provides a skin irritant substance screening kit comprising the composition.

The present invention relates to a composition for screening a skin irritant containing IL-1ra and a method for screening a skin irritant using the same, wherein the IL-1ra gene is a skin irritant such as hydroquinone (HQ), retinoic acid In the case of treating SLS, the expression amount is increased, so that harmful skin stimulating substances can be screened using the gene. Therefore, it can be usefully used as a method for screening a skin irritant substance which can be substituted for an animal test of a raw material for cosmetics.

Figure 1 shows the effect of real time-PCR of IL-l [alpha], IL-l [beta] and IL-lra when treated with keratinocytes with hydroquinone (a), retinoic acid (b), SLS Fig.
FIGS. 2A to 2C show the results of Western blot analysis (a and b) and ELISA (c) after hydroquinone, retinoic acid or SLS was applied to keratinocytes and the results of confirming the expression pattern of IL-1ra protein .
FIGS. 3A to 3D are graphs showing cell death by performing hydrolysis of hydroquinone, retinoic acid, or SLS to keratinocytes, followed by TUNEL test (c) for cell viability according to MTT test (a and b) Blot analysis (d) was performed to confirm cleaved caspase-3 expression.
Figures 4a-4d show the effect of intracellular / extracellular IL-1 [alpha] and IL-1 [alpha] on the production of endothelial cells by treatment of hydroquinone, retinoic acid or SLS with keratinocytes followed by Western blot analysis (a and b) 1 < / RTI >

Based on the fact that the mRNA or protein expression level of the IL-1ra gene is increased when general keratinocyte (HQ), retinoic acid (RA) or SLS is treated as skin irritant substance in the keratinocytes in the Examples IL-lra mRNA expression and intracellular / extracellular IL-lra protein expression, and the like.

Hereinafter, the present invention will be described in detail.

The present invention provides a method for treating skin cancer, comprising: 1) treating a keratinocyte with a skin stimulating candidate substance; 2) measuring the level of mRNA or protein expression of the IL-1ra gene from the cells of step 1); And 3) comparing the expression level of the mRNA or protein of the gene with the expression level of the mRNA or protein of the control group treated with hydroquinone (HQ), retinoic acid (RA), SLS or uriciol to keratinocytes A method for screening a skin stimulating substance.

As a specific example, when the expression level of mRNA or protein of the IL-1ra gene in the step 3) of the present invention is similar to or higher than that of at least one of the control group, it can be judged to be a skin irritant.

In the present invention, " IL-1ra gene " is an antagonist of IL-1α and IL-1β, whereas IL-1α is increased by a single exposure to stimulation upon stimulation, IL- It is possible to use it more effectively reflecting repeated irritation in long-term use. In addition, in the skin stimulation, the role of endogenous antagonist to IL-1? And IL-1? Of IL-1ra is hardly observed, but antagonism of IL-1? It is possible to reduce the killing of keratinocytes induced by chemicals.

In the present invention, "measurement of mRNA expression level" is a process of confirming the presence or absence of mRNA and the expression level of the gene in keratinocytes and measuring the amount of mRNA. For example, RT-PCR, competitive RT-PCR, real-time RT-PCR, and RNase protection assay (RPA). RNase protection assay, Northern blotting, DNA chip, and the like.

The agent for measuring the mRNA level of a gene in the present invention is preferably an antisense oligonucleotide, a primer pair or a probe. In the present invention, "antisense" means that the antisense oligomer is hybridized with the target sequence in the RNA by Watson-Crick base pairing to form the sequence of the nucleotide base, typically within the target sequence, And an oligomer having a backbone between subunits. Oligomers may have an exact sequence complement or approximate complementarity to the target sequence. This antisense oligomer can alter the processing of mRNA that blocks or inhibits translation of mRNA and produces splice variants of mRNA.

The term "primer" in the present invention means a short nucleic acid sequence capable of forming a base pair with a complementary template with a short free 3-terminal hydroxyl group and functioning as a starting point for template strand copying. The primer can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures.

The term "probe" in the present invention means a nucleic acid fragment such as RNA or DNA corresponding to a few nucleotides or hundreds of nucleotides that can specifically bind to mRNA and is labeled so that presence or absence of a specific mRNA Can be confirmed. The probe can be produced in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, or an RNA probe. Selection of suitable probes and hybridization conditions can be modified based on what is known in the art.

Since the nucleic acid sequence of the present invention is registered in the gene bank, a person skilled in the art can design an antisense oligonucleotide, a primer pair or a probe which specifically amplifies a specific region of these genes based on the above sequence.

The antisense oligonucleotides, primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, capping, substitution with one or more of the natural nucleotide analogs, and modifications between nucleotides, such as uncharged linkers (e.g., methylphosphonate, phosphotriester, Amidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

In the present invention, "measurement of protein expression level" is a process of confirming the presence and expression level of a protein expressed from the gene of the present invention in keratinocytes to screen skin pricking candidates, and measuring the amount of protein. Examples of the assay methods include Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis But are not limited to, tissue immuno staining, immunoprecipitation assays, complement fixation assays, fluorescence activated cell sorters (FACS), protein chips, and the like. The agent for measuring the protein expression level in the present invention is preferably an antibody.

In the present invention, "antibody" means a specific protein molecule directed against an antigenic site. For purposes of the present invention, an antibody refers to an antibody that specifically binds to a marker protein and includes both polyclonal antibodies, monoclonal antibodies, and recombinant antibodies.

In one embodiment of the present invention, in order to confirm the expression of the IL-1ra gene by the skin irritant, keratinocytes were treated with a skin irritant to confirm that the keratinocyte had a general hydroquinone HRA), retinoic acid (RA), SLS, or uriciol, the mRNA expression level of the IL-1ra gene was increased (see Example 3).

Therefore, the IL-1ra gene according to the present invention increases expression of the IL-1ra gene upon treatment of a skin irritant, and thus can be used for various purposes and applications requiring screening of a harmful skin irritant using the gene.

Accordingly, the present invention provides a composition for screening a skin irritant, which comprises an agent for measuring an expression level of mRNA or protein of IL-1ra gene.

The present invention also provides a skin irritant substance screening kit comprising the composition.

The kits of the present invention can screen skin irritants by identifying the level of IL-1ra gene mRNA or protein expression. The kit of the present invention may further include one or more other component compositions, solutions, or devices suitable for the analysis method as well as primers, probes, antibodies, etc. for screening skin irritants, preferably RT-PCR A kit, a microarray chip kit, a DNA chip kit, and a protein chip kit.

As a specific example, in the present invention, a kit for measuring the mRNA expression level of the gene may be a kit containing essential elements necessary for performing RT-PCR. RT-PCR kits contain enzymes such as test tubes or other appropriate containers, reaction buffers, deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC- Water (DEPC-water), sterile water, and the like.

In addition, the kit of the present invention may be a kit including essential elements necessary for performing the microarray. The microarray kit may include a substrate to which a cDNA corresponding to a gene or a fragment thereof is attached as a probe, and the substrate may include cDNA corresponding to a quantitative control gene or a fragment thereof, Can be easily produced by a production method commonly used in the art. In order to fabricate a microarray, a micropipetting method using a piezo electric method or a micropipetting method using a pin-shaped method to immobilize the detected marker on a substrate of a DNA chip using the probe as a probe DNA molecule A method using a spotter or the like is preferably used, but the present invention is not limited thereto. The substrate of the microarray chip is preferably coated with an activator selected from the group consisting of amino-silane, poly-L-lysine and aldehyde, but is not limited thereto. In addition, the substrate is preferably selected from the group consisting of slide glass, plastic, metal, silicon, nylon film, and nitrocellulose membrane, but is not limited thereto.

In addition, the kit of the present invention may be a kit containing essential elements necessary for performing a DNA chip. The DNA chip kit may include a substrate to which a cDNA or oligonucleotide corresponding to a gene or a fragment thereof is attached, and reagents, preparations, enzymes, and the like for producing a fluorescent-labeled probe. The substrate may also comprise a cDNA or oligonucleotide corresponding to a control gene or fragment thereof.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[Example]

Example 1. Experimental Preparation and Experimental Method

1-1. Cell culture

Adult skin samples obtained during the cesarean section and circumcision were used for cell culture. For epidermal keratinocyte culture, individual epidermal cells were suspended in EpiLife medium (Invitrogen, Carlsbad, Calif.) Supplemented with bovine pituitary extract, bovine insulin, hydrocortisone, human epidermal growth factor and small transferrin (Invitrogen) . The harvested cells were resuspended at 7.5 × 10 ⁴ cells / mL in each medium and inoculated at 1.5 × 10 ⁵ cells per well on a 6-well plate. After one day of inoculation, each concentration of chemicals was added, and one day later, the appropriate concentration of each chemical was added. Two days later, keratinocytes were harvested and applied to cell viability assay, TUNEL assay, real-time PCR, Western blot analysis and ELISA.

1-2. mouse

8-week-old female C57BL / 6 mice purchased from Orient Bio (Gyeonggi-do, Korea) were kept under normal air conditions not controlled by the experimental animal breeding room of Dongguk University School of Medicine. The Regional Animal Experimental Ethics Committee approved all described protocols. The hair was removed from the back of the mice using an electric razor, treated with a skin remover (Ildong Pharmaceutical), and after 1 day, the patch was applied using a 2 cm diameter gauze patch, The dorsal skin was imbibed with each appropriate concentration of chemicals. The procedure was repeated twice for 48 hours. The chemically treated full thickness skin samples were biopsied and stored at -80 DEG C until used for immunohistochemistry.

1-3. reagent

For in vitro studies, hydroquinone (HQ, Sigma Aldrich, St Louis, MO, USA) and retinoic acid (RA, Sigma Aldrich) were prepared as stock solutions using DMSO (Sigma Aldrich) Sodium lauryl sulfate (SLS, Sigma Aldrich) was dissolved in distilled water to make a stock solution. For in vivo studies, creams were prepared by adding 10% and 2% HQ to the petrolatum base and 0.1% and 0.5% RA, respectively. Recombinant human interleukin-1 receptor antagonist (rhIL-1ra) was purchased from R & D Systems (Minneapolis, MA).

1-4. MTT analysis

Cells were stained with MTT for 4 hours and the precipitated formazan was dissolved in distilled water and DMSO and optical density was measured at 570 nm (630 nm background subtraction) using a spectrophotometer. The effect of HQ, RA, SLS and urshiol (Sigma Aldrich) on cell growth was estimated from the ratio of cell viability to cell viability in the presence of DW and DMSO as solvents, and the stimulation concentration was within 2 days of cell viability ≪ / RTI > and about 70% to about 80% of the ratio.

1-5. TUNEL test

TUNEL assays for detecting apoptotic cells were performed using the Apo-BrdU TUNEL test kit (A23210, Invitrogen) fabricated according to the manufacturer's instructions. Cells were fixed in 2% paraformaldehyde and 70% ice-cold ethanol, and the stained cells were observed under a fluorescence microscope. Four random fields were taken from the apoptotic cells for quantitative analysis of apoptosis and total cells were counted.

1-6. RT-PCR

CDNA was synthesized from total RNA using First Strand cDNA Synthesis Kit for RT-PCR (AMV, Boehringer Mannheim, Germany), and the amount of target mRNA was quantified using a Light Cycler RT-PCR instrument (Roche, Penzberg, Germany) . The relative amount of the mRNA was calculated as the ratio of each target to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Primer sequences for real-time PCR are shown in Table 1 below.

division The primer sequence (5'-3 ') IL-1? Forward GGTTGAGTTTAAGCCAATCCA Reverse TGCTGACCTAGGCTTGATGA IL-1? Forward CCGGGACTCACAGCAAAA Reverse GGACATGGAGAACACCACTTG IL-1ra Forward TGGCTTTAGCTGACTTGTATGAAG Reverse TTGCTGGATTTTCTCCCAGA GAPDH Forward TCCACTGGCGTCTTCACC Reverse GGCAGAGATGATGACCCTTT

1-7. Western blot analysis

The same amount of extracted protein was dissolved and transferred to nitrocellulose membrane. The membrane was incubated with antibodies against IL-l [alpha] and IL-l [beta] (Santa Cruz Biotechnology, Santa Cruz, CA), IL-lra and Cleaved caspase-3 (Cell Signaling Technology, Beverly, MA). (LAS-3000, Fuji Photo Film, Tokyo, Japan) after incubation with appropriate anti-mouse or anti-rabbit horseradish peroxidase-conjugated antibody (Thermo) and enhanced chemiluminescent solution (Thermo) . To monitor the amount of protein loaded in each lane, the membrane was re-probed with mouse monoclonal anti-beta-actin antibody (Sigma) and processed as described above. Protein bands were then analyzed by density measurement.

1-8. ELISA

The supernatants of cultured keratinocytes were collected at all stages of the previous experiment and the concentration of human IL-1ra, IL-1 alpha and IL-1 beta in the supernatant was measured using an ELISA kit (R & D Systems) Respectively.

1-9. Immunohistochemical analysis

For immunofluorescence staining of IL-lra, decolorized and normally colored fixed skin samples were embedded in paraffin wax and sectioned at 4 mm. After paraffin removal and rehydration, the sections were heated in a citrate solution (100 mM, pH 6.0) for 10 minutes on a hot plate. The sections were cultivated with 3% bovine serum albumin for 1 hour at room temperature, then reacted with 1: 100 anti-IL-1ra antibody overnight at 4 ° C and successively incubated for 1 hour at room temperature with Alexa Fluor- Were reacted with anti-rabbit IgG (488, Molecular Probes, Eugene, OR). The nuclei were contrast dyed with Hoechst 33258 (Sigma Aldrich). The dyed samples were observed using a Dp Manager 2.1 fluorescence microscope (Olympus Optical Co., Tokyo, Japan).

Example 2. Cytotoxic effect of chemicals

In order to confirm the cytotoxicity of chemicals such as HQ, RA, SLS and urushiol, which is a representative photosensitizer, the above-mentioned drugs were treated at different doses to normal human keratinocytes cultured in Example 1-2, Respectively.

As a result, the stimulation concentrations were 20-40 μM HQ, 0.5-1.5 μM RA, 8-12 μM SLS, 70-80% and 40-50% cell survival in the range of 1-2 μM uriciol Respectively.

Example 3. Expression of IL-1ra mRNA in keratinocytes

IL-lra mRNA expression and further IL-1 alpha and IL-1 beta mRNA expression were examined in the same manner as in Examples 1-6.

As a result, IL-lra mRNA expression was shown to increase in these chemical agents in a time and dose dependent manner, as shown in Fig. Although the absolute level of IL-lra mRNA expression is lower than that of IL-l [alpha] and IL-l [beta], the fold increase of IL-lra by each chemical is usually compared with the corresponding solvent, -1β. This multiple increase in IL-1ra mRNA was more consistent as compared to the positive control groups IL-l [alpha] and IL-l [beta] mRNA, which was more pronounced in uriciol treated cells (D).

Example 4: Confirmation of IL-1ra protein expression in keratinocytes

Based on the mRNA expression results of Example 3 above, western blot analysis of intracellular IL-1ra protein expression (Example 1-7) and ELISA analysis of the IL-lra protein released into the extracellular medium (Examples 1-8 ) Were performed after 48 hours of treatment with HQ, RA and SLS at the same cytotoxic dose (70-80% and 40-50% cell viability). Immunofluorescent staining (Example 1-9) was also performed on murine skin samples that were treated with different concentrations of HQ or RA to induce erythema.

As a result, as shown in Figs. 2A to 2C, the expression of the intracellular IL-1ra protein was dose-dependently increased (Fig. 2A). In addition, the expression of secreted IL-lra protein increased dose-dependently in the culture supernatant (Figure 2b). Furthermore, according to immunofluorescence staining, the intensity of IL-1ra staining in the epidermis including the horny layer with a more severe skin irritation was larger (FIG. 2C).

Example 5: Induction of apoptosis of keratinocytes by treatment with rhIL-1ra (Recombinant human IL-1ra)

The expression of IL-1ra protein in keratinocytes and mouse skin was increased by the cytotoxic dose of the chemical agent in Example 4 (FIGS. 2A to 2C) Based on the action of IL-1ra by binding, the experiment was carried out as in Example 1-5 to confirm the effect of rhIL-1ra on the survival of keratinocytes.

As a result, as shown in FIGS. 3A-3D, rhIL-1ra in a wide concentration range of up to 500 ng / ml (Conti et al., 1997) did not decrease the number of viable cells in primary cultured human keratinocytes (FIG. 3A), and the rhIL-1ra dose-dependently increased the number of viable cells that had been reduced by the cytotoxic dose of the chemical (FIG. 3B). On the other hand, the number of TUNEL positive keratinocytes increased by the cytotoxic dose of the chemical was decreased by rhIL-1ra (Fig. 3c), and the expression level of Cleaved caspase-3 decreased in the presence of rhIL- (Fig. 3d).

Example 6 Confirmation of Decreasing Effect of Chemical Stimulation-Induced IL-1α and IL-1β Expression by Treatment with rhIL-1ra (Recombinant human IL-1ra)

IL-1ra is known to inhibit IL-1α and IL-1β activity by competitively inhibiting cell surface IL-1 receptor binding (Arend et al., 1998). Western blot analysis (Examples 1-7) and ELISA (Examples 1-8) were performed to confirm the effect of rhIL-1ra on intracellular / extracellular IL-1? And IL-1? Expression.

As a result, as shown in Figs. 4a to 4d, according to Western blot analysis, 500 ng / ml of rhIL-1ra was found to have an intracellular level of IL-1? And IL-1? Increased by the cytotoxic dose of the chemical (Figs. 4a and 4b). According to the ELISA analysis, even though the level of RA-treated IL-1? Was somewhat higher, the level of IL-1? Increased by the cytotoxic dose of the chemical And intracellular levels of IL-1 [beta] were found to be decreased by rhIL-lra (Figures 4c and 4d).

As a result of synthesis of the results of Examples 5 and 6, IL-1ra released from cells can reduce the killing of keratinocytes induced by chemicals by antagonistic action against IL-1α and IL-1β it means.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

Claims (3)

1) treating keratinocytes with a skin stimulating candidate substance;
2) measuring the level of mRNA or protein expression of the IL-1ra gene from the cells of step 1); And
3) comparing the expression level of the mRNA or protein of the gene with the expression level of mRNA or protein of the control group treated with uriciol in the keratinocyte,
The method of screening a skin stimulating substance according to claim 3, wherein the expression level of the mRNA or protein of the IL-1ra gene is similar to or higher than that of the control.
The method according to claim 1,
Methods for measuring mRNA expression levels include RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA; RNaseprotection assay, Northern blotting, and DNA chip. < RTI ID = 0.0 > 8. < / RTI >
The method according to claim 1,
Methods for measuring the expression level of the protein include Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, (1) selected from the group consisting of immunoprecipitation assays, complement fixation assays, fluorescence activated cell sorters (FACS), and protein chips. Or more of the skin irritant material.

Images