KR101922598B1 - Composition for diagnosing diseases caused by mutation of RNF213 gene using Real-Time PCR, and use thereof - Google Patents

Abstract

A kit for diagnosing diseases caused by mutation of c.14429G > A of RNF213 gene including primers and probes for mutation detection of RNF213 gene and a kit for diagnosing diseases caused by mutation of c.14429G >Gt; A < / RTI > mutation. Using a composition for diagnosing a disease caused by the mutation of c.14429G > A of the RNF213 gene, mutation of the cause of the related disease can be detected simply and accurately as compared with a general base sequence analysis technique.

Description

[0001] The present invention relates to a composition for diagnosing a disease caused by a mutation of RNF213 gene using real-time PCR, and to a use thereof,

A kit for diagnosing diseases caused by mutation of RNF213 gene including primers and probes for detecting mutation of RNF213 gene, and a kit for diagnosing diseases caused by mutation of RNF213 gene by real-time PCR And a method for providing information necessary for diagnosis.

Moyamoya disease is a chronic progressive cerebrovascular disease in which a specific blood vessel in the brain, that is, the end of the internal carotid artery, is occluded for no particular reason, referred to as bilateral carotid artery anomalies. According to the cerebral angiogram, It was named as "Moyamoya disease" with the meaning of "the shape of the marmalade rising." In Japan, the number of patients collected by 1990 is about 3,300, and the number of patients newly discovered every year is about 200. In Japan, the disease is more common in Korea and China than in the world.

Although the exact cause of the disease and its cause have not been elucidated, the recent mutation in the RNF213 gene c.14429G> A (p.Arg4810Lys) has been identified as an important genetic factor (J Hum Genet 2011; 56: 34-40). About 95% of Japanese patients with familial moyamoya disease and 73% of sporadic patients had this mutation. This mutation was found in approximately 1.4% of normal Japanese subjects, and therefore the odds ratio of moyamoya disease was approximately 190.8 (95% Confidence Interval 71.7-507.9) in patients with RNF213 c.14429G> A (p.Arg4810Lys) mutation Respectively. In a follow-up study, this mutation was also found to be an important genetic cause of moyamoya disease in Chinese and Korean patients with Moyamoya disease (PLoS One 2011; 6: e22542; PLoS One 2015; 10: e0130663; J Neurosurg 2016; 124: 1221- 1227).

In addition, recently, the mutant c.14429G> A (p.Arg4810Lys) of the RNF213 gene has not only moyamoya disease but also intracranial stenosis, intracranial atherosclerosis, renal artery stenosis, (PLoS One 2015; 10: e0130663; PLoS One 2016; 11: e0156607; Am J Med Genet 2016; 170: 2453-2456).

Therefore, the present inventors completed the present invention by carrying out studies on a method for effectively detecting the mutation of RNF213 gene as a genetic factor of Moyamoya disease and related diseases.

 J Hum Genet 2011; 56: 34-40.  PLoS One 2011; 6: e22542.  PLoS One 2015; 10: e0130663.  J Neurosurg 2016; 124: 1221-1227.  PLoS One 2016; 11: e0156607.  Am J Med Genet 2016; 170: 2453-2456.

One aspect provides a composition for diagnosing a disease caused by a c.14429G > A mutation of the RNF213 gene including primers and probes for detecting c.14429G > A mutation of the RNF213 gene.

Another aspect provides a kit for diagnosing a disease caused by the c.14429G > A mutation of the RNF213 gene comprising the composition.

Another aspect provides a method of providing information necessary for the diagnosis of a disease caused by the c.14429G > A mutation of the RNF213 gene by real-time PCR.

One aspect is a composition for diagnosing a disease caused by a mutation c.14429G > A of RNF213 gene including primers and probes for detecting c.14429G > A mutation of RNF213 gene,

The primers are the primer pairs of SEQ ID NOS: 1 and 2,

Wherein said probe is a probe pair of SEQ ID NOS: 3 and 4,

The probe is labeled with a fluorescent substance at the 5'-end, a small mineral substance at the 3'-end,

Wherein the probe pair comprises a wild type detecting probe which binds to the wild type of the RNF213 gene and a mutation detecting probe which binds to the mutation of the RNF213 gene.

The mutation of the RNF213 gene is defined as follows:

The mutation of the RNF213 (Ring finger protein 213) gene is expressed based on the coding sequence (CDS) in the RNF213 gene (NCBI Accession No. NM_001256071) shown in SEQ ID NO: 5. The nucleotide sequence from position 151 to position 15774 in SEQ ID NO: 5 corresponds to the coding sequence (CDS) of the RNF213 gene. The translation initiation codon represents ATG A at nucleotide +1 and A at position 151 in SEQ ID NO: 5 is represented by nucleotide +1.

The substitution mutation is indicated by the symbol ">", the letter preceding the ">" is the nucleotide of the normal RNF213 gene, and the letter after ">" is the nucleotide of the mutant RNF213 gene.

The mutation " c.14429G > A " means that G at position 14429 was substituted with A in the coding sequence (CDS) of the nucleotide sequence of SEQ ID NO:

Diseases caused by the c.14429G > A mutation of the RNF213 gene include, for example, diseases such as Moyamoya disease, intracranial stenosis, intracranial atherosclerosis, renal artery stenosis, (PLoS One 2015; 10: e0130663; PLoS One 2016; 11: e0156607; Am J Med Genet 2016; 170: 2453-2456).

The term " primer " refers to a nucleic acid sequence complementary to the 5 ' end or the 3 ' end sequence of a target nucleic acid region amplified in a polymerase chain reaction, Strand < / RTI > oligonucleotide that can serve as the starting point of the reaction. The suitable length of the primer is determined depending on factors such as the reaction temperature and the use of the primer, but is generally 15 to 30 nucleotides.

The term " probe " refers to a single-stranded nucleic acid molecule comprising a sequence complementary to a target sequence. Probes can be modified to the extent that the hybridization specificity is not impaired. For example, a reporter fluorescent substance or a quencher may be attached to the end of the probe.

The probe may be labeled at the 5'-end with a fluorescent substance and at the 3'-end with a small mineral substance and used in a real-time PCR.

The fluorescent material may be 6-Carboxyfluorescein, VIC, TET (2 ', 7'-dichloro-6-carboxy-4,7-dichlorofluorescein), 6-JOE (6-carboxy- dichloro-2 ', 7'-dimethoxyfluorescein, HEX (2', 4 ', 5', 7'- tetrachloro-6-carboxy-4,7-dichlorofluorescein), Cy3 (Cyanine 3) But is not limited thereto.

Since the intensity of VIC is about two to three times higher than that of JOE or HEX of similar wavelength, detection sensitivity can be more excellent when VIC is used as a fluorescent material.

The minerals may be MGB-NFQ, 6-carboxytetramethylrhodamine, BHQ-2, BH3-3 or ROX (carboxy-X-rhodamine) Do not.

The MGB-NFQ is composed of two units, MGB (Minor Groove Binder) and NFQ (Non-Fluorescent Quencher). MGB can increase the melting temperature of the probe and improve the bonding strength between the template and the probe. Therefore, it is possible to manufacture a probe having a short length and high specificity. Also, unlike TAMRA or ROX, which generates background fluorescence, NFQ has the advantage of not generating background fluorescence since it does not fluoresce.

The probe of SEQ ID NO: 3 is a mutation detection probe that binds to a mutation of RNF213 gene.

The probe of SEQ ID NO: 4 is a wild type detection probe that binds to the wild type of RNF213 gene.

The wild type detecting probe and the mutation detecting probe may be labeled with different fluorescent materials. Since the signal by the fluorescent substance of the wild type detection probe and the signal by the fluorescent substance of the probe for mutation detection are distinguished, if the signal of the wild type detection probe is positive, the wild type, if the signal of the mutation detection probe is positive, If the signal is positive, it can be judged to be a heterozygous type of wild type and mutation.

Mutations of the RNF213 gene are detected by real-time PCR.

The composition for diagnosing a disease caused by the mutation of c.14429G> A of the RNF213 gene comprises a dNTP mixture (dATP, dCTP, dGTP, dTTP), a DNA polymerase, and a buffer solution As shown in FIG.

Real-time polymerase chain reaction simultaneously amplifies and measures the target nucleic acid. Since the intensity of fluorescence generated from amplification products by polymerase chain reaction is measured in real time, the results can be confirmed more quickly than conventional polymerase chain reaction. It also does not require additional steps such as electrophoresis or sequencing for the analysis of amplification products.

The real-time PCR can be performed under the conventional conditions known in the art, and the fluorescence from the probe with the fluorescent substance can be measured in the annealing and extension steps during the progress of the real-time PCR have.

Illustratively, the wild type detecting probe may be labeled with FAM at the 5 'end, and the mutation detecting probe may be labeled with VIC. When the probe is hybridized to the target sequence, the fluorescent substance at the 5 'end does not emit fluorescence due to the action of the minerals present at the 3' end. However, in the prolongation of the polymerase chain reaction, the probe hybridized to the template is degraded by the 5 'to 3' exonuclease activity of the thermostable DNA polymerase such as Taq polymerase, and the fluorescent substance at the 5 ' It separates from the probe and emits fluorescence away from the fluorescence inhibition by the minerals. Therefore, the fluorescence signal by FAM means a wild type genotype, and the fluorescence signal by VIC can mean a mutant genotype. When two signals are detected at the same time, it may mean a heterozygous type in which wild type and mutation are joined.

Another aspect provides a kit for diagnosing a disease caused by the c.14429G > A mutation of the RNF213 gene comprising the composition.

Specifically, the kit is a kit for diagnosing a disease caused by mutation c.14429G> A of the RNF213 gene including a primer and a probe for detecting c.14429G> A mutation of the RNF213 gene,

The primers are the primer pairs of SEQ ID NOS: 1 and 2,

Wherein said probe is a probe pair of SEQ ID NOS: 3 and 4,

The probe is labeled with a fluorescent substance at the 5'-end, a small mineral substance at the 3'-end,

The probe pair may be a kit comprising a wild type detecting probe which binds to the wild type of the RNF213 gene and a mutation detecting probe which binds to the mutation of the RNF213 gene.

The disease causing the c.14429G > A mutation of the RNF213 gene may be, for example, Moyamoya disease, cerebrovascular stenosis, cerebrovascular arteriosclerosis, renal artery stenosis, pulmonary vascular disease, and the like.

The kit may be a real-time polymerase chain reaction kit.

The kit may comprise one or more other component compositions, solutions or devices needed for the performance of a real-time polymerase chain reaction. Specifically, the kit may further comprise a dNTP mixture (dATP, dCTP, dGTP, dTTP), a DNA polymerase, a buffer solution and the like. In addition, the kit may further comprise a test tube or other suitable container or the like.

Another aspect is a method for providing information necessary for diagnosis of diseases caused by mutation of c.14429G > A of RNF213 gene by real-time PCR,

Performing a real-time PCR using the DNA isolated from the sample as a template, the pair of primers of SEQ ID NOS: 1 and 2, and the pairs of probes of SEQ ID NOS: 3 and 4; And

Confirming the genotype of the c.14429G > A mutation site of the RNF213 gene,

The probe is labeled with a fluorescent substance at the 5'-end, a small mineral substance at the 3'-end,

Wherein the probe pair comprises a wild type detecting probe which binds to the wild type of the RNF213 gene and a mutation detecting probe which binds to the mutation of the RNF213 gene.

The disease causing the c.14429G > A mutation of the RNF213 gene may be, for example, Moyamoya disease, cerebrovascular stenosis, cerebrovascular arteriosclerosis, renal artery stenosis, pulmonary vascular disease, and the like.

Simultaneous detection of the wild type detection probe signal and the mutation detection probe signal for the RNF213 mutation site in the step of identifying the genotype of the RNF213 mutation site may indicate that the specimen is a heterozygote.

The fluorescent material may be 6-FAM, VIC, TET, 6-JOE, HEX, Cy3, or Cy5, but is not limited thereto.

The minerals may be, but not limited to, MGB-NFQ, 6-TAMRA, BHQ-1, BHQ-2, BH3-3 or ROX.

A method for providing information necessary for diagnosis of a disease caused by the c.14429G > A mutation of the RNF213 gene by the real-time PCR is as follows: a DNA isolated from a specimen is used as a template, a pair of primers of SEQ ID NOS: 1 and 2, And performing a real-time PCR using the probe pairs of SEQ ID NOS: 3 and 4.

Said " diagnosis " means identifying the presence or characteristic of a pathological condition. Therefore, the above-mentioned " diagnosis of a disease caused by mutation c.14429G > of the RNF213 gene " refers to the diagnosis of the disease or the possibility of the disease caused by mutation c.14429G> A of the RNF213 gene, It can mean to do.

The term " sample " means a living organism or substance used for inspection, analysis, and the like, and it is possible to confirm whether or not the disease caused by mutation c.14429G> A of RNF213 gene is present or not, May be a sample separated from an object to be identified. The sample may include, but is not limited to, tissues, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine separated from an individual.

Real-time polymerase chain reaction can be carried out under conventional conditions known in the art. The fluorescence from the probe with the fluorescent material is measured in the annealing and extension steps during the course of the real-time PCR. Measurement and analysis of fluorescence can be easily performed using software for analyzing fluorescence generated in real-time PCR.

A method for providing information necessary for diagnosis of a disease caused by the c.14429G > A mutation of the RNF213 gene by the real-time PCR reaction includes a step of confirming the genotype of the c.14429G > A mutation site of the RNF213 gene can do.

In the step of confirming the genotype of the RNF213 mutation site, the real-time PCR may include a wild type gene and a mutant type gene having a confirmed genotype for each RNF213 mutation site as a control group.

The wild type detecting probe and the mutation detecting probe may be labeled with different fluorescent materials. The genotype of the RNF213 mutation site is determined by the detection of the fluorescent signal of the wild-type detection probe and the mutation detection probe. When only the fluorescent signal of the wild type detecting probe is detected, it means that the specimen is a wild type having no mutation at its mutation site, that is, normal. When only the fluorescent signal of the mutation detecting probe is detected, It means that there is a high possibility that the presence of the junction type, that is, the patient with moyamoya disease or related disease, and when both the wild type detection probe and the mutation detection probe fluorescence signal are detected, this means that the wild type and heterozygous type . ≪ / RTI >

The use of a composition for diagnosing a disease caused by a mutation of c.14429G > A of the RNF213 gene according to one aspect of the present invention can detect a causative mutation of a disease caused by the mutation simply and accurately as compared with a general base sequence analysis technique have.

Further, by using a method of providing information necessary for diagnosis of a disease caused by mutation of c.14429G > A of RNF213 gene according to one aspect, it is possible to easily identify wild type, mutant type or heterozygous type for the causative gene of the disease .

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a diagram showing the principle of operation of primer and allele-specific probe system for detecting mutation c.14429G> A of RNF213 gene.
FIG. 2 shows results of real-time PCR for the wild-type control using primer pair and probe pair for detecting c.14429G> A mutation of RNF213 gene.
FIG. 3 shows results of real-time PCR for the mutant control group using primer pairs and probe pairs for detecting c.14429G> A mutation of RNF213 gene.
FIG. 4 shows the result of real-time PCR for the heterozygous control group using primer pair and probe pair for detecting c.14429G> A mutation of RNF213 gene.
FIG. 5 is a result of genotyping analysis of RNF213 c.14429G > A mutation site determined by real-time PCR and nucleotide sequence analysis for 105 healthy individuals.
FIG. 6 shows the result of confirming four heterozygosity by performing real-time PCR on 105 normal subjects.
FIG. 7 shows real-time PCR and nucleotide sequence analysis results for four heterozygous samples of # 105, that is, # 16, # 19, # 23 and # 43.
Fig. 8 shows results of real-time PCR using F1 primer, R1 primer and ZEN probe to detect RNF213 c.14429G > A mutation.
Fig. 9 shows results of real-time PCR using F2 primer, R1 primer and ZEN probe for detecting RNF213 c.14429G > A mutation.
FIG. 10 shows results of real-time PCR using F2 primer, R1 primer and ZEN probe for detecting RNF213 c.14429G> A mutation.
Figure 11 shows the result of real-time PCR using F3 primer, R1 primer and ZEN probe to detect RNF213 c.14429G > A mutation.
FIG. 12 shows results of real-time PCR using F4 primer, R1 primer and ZEN probe for detecting RNF213 c.14429G> A mutation.
Fig. 13 shows results of real-time PCR using F5 primer, R1 primer and ZEN probe for detecting RNF213 c.14429G > A mutation.
Fig. 14 shows the result of real-time PCR using F6 primer, R1 primer and ZEN probe to detect RNF213 c.14429G > A mutation.
Fig. 15 shows the result of real-time PCR using F6 primer, R1 primer and ZEN probe for detecting RNF213 c.14429G > A mutation.
16 is a result of performing a real-time PCR on negative samples using various combinations of primers and probes having different sequences.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example 1. Preparation of primers and probes for RNF213 gene mutation detection

Mutations in the RNF213 gene (NCBI accession number: NM_001256071) of SEQ ID NO: 5 are known to cause Moyamoya disease, cerebrovascular stenosis, cerebrovascular atherosclerosis, renal artery stenosis, pulmonary vascular disease and the like. Therefore, primers and probes that can be used to detect the mutation c.14429G > A (p.R4810K) of the RNF213 gene were prepared.

Based on the sequence of the RNF213 gene, Primer Expres 3.0.1 was used to design a primer pair capable of amplifying the c.14429G> A mutation site. In addition, probes were prepared which perfectly bound to the wild type and mutant forms of the c.14429G > A mutant site. A fluorescent substance was labeled at the 5 'end of each probe, and a quencher was labeled at the 3' end to prevent fluorescence. At this time, the probe binding to the mutated gene fragment was labeled with VIC as a fluorescent substance, and the probe binding with the wild type gene fragment without mutation was labeled with FAM as a fluorescent substance . Production of the primer was commissioned by Cosmojin Tech (Korea), and production of the probe was commissioned by Life Technologies (USA). The primer pair amplifying the RNF213 c.14429G > A mutation site and the probe for detecting the wild type and the mutant type are shown in Table 1 below. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a diagram showing the principle of operation of primer and allele-specific probe system for detecting mutation c.14429G> A of RNF213 gene.

type SEQ ID NO: designation order Forward primer One RNF_MGB F1 5 'AGAACGTCCAGCAAGTTGAATACA 3' Reverse primer 2 RNF_MGB R1 5 'TTTCGAACCGCCAAATGC 3' The mutation detection probe 3 RNF213 (A) probe (VIC) 5'CTCCATCAAAGGCT 3 '(MGB-NFQ) Wild type detection probe 4 RNF213 (G) probe (FAM) 5 'CTCCATCAGAGGC 3' (MGB-NFQ)

Example 2. Detection of mutation of RNF213 gene by real-time polymerase chain reaction

Genomic DNA was extracted from the blood samples taken from the samples using QIAamp DNA Mini Kit (Qiagen, Germany). For the real-time PCR reaction, primer pairs and probe pairs prepared in Example 1 were used. Table 2 shows the master mixture used in the real-time PCR reaction. Specifically, 2 μl of the extracted DNA, 12.5 μl of a 2 × PCR reaction mixture (BioSewoom, Seoul, Korea), 5 nM of a primer, 3 nM of a wild type probe and 3 nM of a mutant probe, ) Without distilled water and a total volume of 25 μl. Table 3 shows real-time PCR reaction conditions. Specifically, the PCR reaction was carried out at 50 캜 for 2 minutes. 95 ° C for 10 minutes; Real-time PCR equipment (Bio-Rad) under conditions of 40 cycles of 95 ° C for 15 seconds and 60 ° C for 40 seconds. Fluorescence by VIC and FAM was measured for each cycle.

ingredient Capacity (μl) 2x PCR reaction mixture 12.5 Primer and probe mixture 3 Distilled water 7.5 Template DNA 2 Total volume 25

Temperature time cycle Data collection 50 ℃ 2 minutes 1 cycle 95 ℃ 10 minutes 1 cycle 95 ℃ 15 seconds 40 cycles 60 ° C 40 seconds Fluorescence detection (VIC, FAM)

As a control group of real-time PCR, wild type and mutant type genes were prepared and used by polymerase chain reaction and sequencing using the primer combination shown in Table 1. That is, the product obtained by polymerase chain reaction using a combination of primers according to Table 1 was cloned into a plasmid vector, and the resulting product was transformed into Escherichia coli to prepare a large number of wild-type genes. By sequencing, , And a mutant gene was prepared using a site-specific mutagenesis kit for the wild-type gene and confirmed by sequencing. Table 4 shows the components of the kit for determining the genotype of the c.14429G > A mutation site of the RNF213 gene using real-time PCR.

Kit Components 2x PCR reaction mixture Primer and probe mixture Positive control 1 (wild type) Positive control 2 (mutant) Positive control group 3 (heterozygous) Distilled water

The sample showing positive for the FAM dye was a sample with a wild-type gene and the sample showing positive for the VIC dye was diagnosed as a sample having a mutant gene. Samples showing positive for both VIC and FAM were diagnosed as heterozygous mutations (hetero) with both wild type and mutant genes.

FIG. 2 shows results of real-time PCR for the wild-type control using primer pair and probe pair for detecting c.14429G> A mutation of RNF213 gene.

FIG. 3 shows results of real-time PCR for the mutant control group using primer pairs and probe pairs for detecting c.14429G> A mutation of RNF213 gene.

FIG. 4 shows the result of real-time PCR for the heterozygous control group using primer pair and probe pair for detecting c.14429G> A mutation of RNF213 gene.

As shown in FIGS. 2 to 4, it was confirmed that RNF213 wild type, RNF213 mutant homozygosity, and RNF213 mutant heterozygosity can be clearly distinguished by using the primer pair and the probe pair shown in Table 1.

Example 3. Analysis of genotypes of clinical specimens

Genetic tests were performed on actual clinical specimens using primers and probes for detecting RNF213 gene mutation prepared in Example 1.

We first recruited 105 healthy controls with no symptoms associated with moyamoya disease but no mutations in the RNF213 gene. Genomic DNA was extracted from blood samples collected from 105 normal subjects using QIAamp DNA Mini Kit (Qiagen, Germany). For the real-time PCR reaction, primer pairs and probe pairs prepared in Example 1 were used. Table 5 shows the master mixture used in the real-time PCR reaction. Specifically, 5 μl of the extracted DNA, 12.5 μl of a 2 × PCR reaction mixture (BioSewoom, Seoul, Korea), 5 nM of a primer, 3 nM of a wild type probe and 3 nM of a mutant probe, ) Without distilled water and a total volume of 25 μl. The real-time PCR reaction conditions were the same as in Example 2. Fluorescence by VIC and FAM was measured for each cycle.

ingredient Capacity (μl) 2x PCR reaction mixture 12.5 Primer and probe mixture 3 Distilled water 4.5 Template DNA 5 Total volume 25

On the other hand, in order to verify whether the real-time PCR result was correct, 105 normal individuals were subjected to sequencing analysis.

Specifically, DNA was extracted from a blood sample collected from 105 normal persons. For DNA extraction, QIAamp DNA Mini Kit (Qiagen, Germany) was used and DNA was extracted according to the instruction manual of the kit. 12.5 ㎕ of the extracted DNA, 2 PCR of the 2x PCR mixture (BioSewoom, Seoul, Korea), and RNF213-CF and -CR primer (10 nM) of the following Table 6 were mixed with distilled water having no nuclease Lt; / RTI > in the reaction solution. The PCR reaction was carried out at 95 캜 for 10 minutes; 45 cycles of 30 sec at 95 캜, 30 sec at 60 캜, and 30 sec at 72 캜; Gt; 72 C < / RTI > for 5 minutes in an AB 2720 PCR instrument (Applied Biosystems). After the reaction, the PCR products were electrophoresed on 1.5% agarose gel and PCR products were confirmed by UV spectrophotometer (Thermo Scientific, USA). Then, 0.2 μl of exonuclease I (20 U / μl, NEB, UK), 0.8 μl of Shrimp alkaline phosphatase (1 U / μl, NEB, UK), 10 × Exo buffer (NEB, UK) After addition of 4.25 μl of distilled water without nuclease, the mixture was treated at 37 ° C for 30 minutes and at 85 ° C for 15 minutes.

1 to 2.5 μl of a reaction mixture containing 40 μl of nuclease-free distilled water was added to the purified PCR product, 2 nM of RNF213-CR nucleotide sequencing analysis primer and 5 × sequencing analysis buffer (Applied Biosystems, USA ) 3.2 ㎕, BigDye Terminator v3.1 Cycle Sequencing Sequencing analysis was performed by adding 0.8 ㎕ of RR-100 (Applied Biosystems, USA) and distilled water with no nuclease in total volume of 10 ㎕. Sequencing reactions were performed at 96 ° C for 1 min; (Applied Biosystems) with 25 cycles of 96 ° C for 10 seconds, 50 ° C for 5 seconds, and 60 ° C for 4 minutes. After the reaction was completed, purification was carried out according to the method of using Magbesil®GREEN (Promega, USA), and the purified DNA was completely dried using a vacuum concentrator. Then, 30 μl of elution buffer And completely dissolved. 15 μl of the resulting solution was added to a nucleotide sequencing plate and reacted with a 3730 × 1 DNA analyzer (Applied Biosystems, USA). Sequencing analysis was performed using Sequencing Analysis 5.1.1 software (Applied biosystems, USA). The mutated nucleotide sequence was analyzed to confirm the mutation of RNF213 p.R4810K (c.14429G> A).

SEQ ID NO: designation order Amplification product size (bp) 6 RNF213-CF primer 5 'actgggtggtcttcccttct 3' (forward) 388 bp 7 RNF213-CR primer 5 'gaaggagtgagccgagtttg 3' (reverse direction)

FIG. 5 is a result of genotyping analysis of RNF213 c.14429G > A mutation site determined by real-time PCR and nucleotide sequence analysis for 105 healthy individuals.

FIG. 6 shows the result of confirming four heterozygosity by performing real-time PCR on 105 normal subjects.

FIG. 7 shows real-time PCR and nucleotide sequence analysis results for four heterozygous samples of # 105, that is, # 16, # 19, # 23 and # 43.

As shown in FIGS. 5 to 7, it was confirmed that the genotype confirmed by real-time PCR coincided with the genotype obtained by base sequence analysis. That is, using the diagnostic composition comprising the primer and the probe for RNF213 mutation detection, each mutation of the mutant carriers could be detected with 100% accuracy.

Comparative Example  One. primer  And Of the probe  According to sequence RNF213  Identification of mutation detection specificity

RNF213 c.14429G> Real-time PCR was performed using various primers and probes capable of detecting the A mutation site, and then experiments were carried out to confirm detection specificity.

Specifically, real-time PCR was carried out in the same manner as in Example 2, using various combinations of the forward primer, reverse primer and mutant type detection probe described in Table 7 below. The combinations of the forward primer, reverse primer and mutation detection probe used in the experiment are as follows:

(1) F1 primer, R1 primer, and ZEN probe

(2) F2 primer, R1 primer, and ZEN probe

(3) F3 primer, R1 primer, and ZEN probe

(4) F4 primer, R1 primer, and ZEN probe

(5) F5 primer, R1 primer, and ZEN probe

(6) F6 primer, R1 primer, and ZEN probe

type SEQ ID NO: designation order Forward primer 8 F1 primer 5'-AGCAAGTTGAATACAGCTCCATTAA-3 ' Forward primer 9 F2 primer 5'-AGCAAGTTGAATACAGCTCCATTAAA-3 ' Forward primer 10 F3 primer 5'-GCAAGTTGAATACAGCTCCATGAA-3 ' Forward primer 11 F4 primer 5'-CAAGTTGAATACAGCTCCAACAA-3 ' Forward primer 12 F5 primer 5'-CAAGTTGAATACAGCTCCACCAA-3 ' Forward primer 13 F6 primer 5'-CAAGTTGAATACAGCTCCAGCAA-3 ' Reverse primer 14 R1 primer 5'-CCCTATGCAGTGATCCTTTCG-3 ' The mutation detection probe 15 ZEN probe 5 '- / 6-FAM / ACCAGGACT / ZEN / GTCCCGCATTTGGC / IABkFQ / -3'

Fig. 8 shows results of real-time PCR using F1 primer, R1 primer and ZEN probe to detect RNF213 c.14429G > A mutation. As shown in Fig. 8, the amplified signal was observed in the wild type as well as the amplified signal was observed in the NTC (Non-template control) not containing the template. Therefore, the combination of the primer and the probe showed detection specificity for the mutation by nonspecific amplification Respectively.

FIGS. 9 and 10 show results of real-time PCR using F2 primer, R1 primer and ZEN probe for detecting RNF213 c.14429G> A mutation. As shown in FIGS. 9 and 10, the amplified signal was observed in the wild type as well, and the amplified signal was also observed in the negative specimen identified as RNF213 c.14429G > A mutant negative by the sequencing analysis. Therefore, the primer and the probe combination were non- It was judged that amplification resulted in low detection specificity for the mutation.

Figure 11 shows the result of real-time PCR using F3 primer, R1 primer and ZEN probe to detect RNF213 c.14429G > A mutation. As shown in Fig. 11, the amplified signal was observed in the wild type as well as the amplified signal was observed in the non-template NTC. Therefore, it was judged that the combination of the primer and the probe had a low detection specificity for the mutation by nonspecific amplification.

FIG. 12 shows results of real-time PCR using F4 primer, R1 primer and ZEN probe for detecting RNF213 c.14429G> A mutation. As shown in Fig. 12, since the amplified signal was observed also in the wild type, it was judged that the combination of the primer and the probe had a low detection specificity for the mutation by nonspecific amplification.

Fig. 13 shows results of real-time PCR using F5 primer, R1 primer and ZEN probe for detecting RNF213 c.14429G > A mutation. As shown in Fig. 13, the amplified signal was observed in the wild type as well as the amplified signal was observed in the non-template NTC. Therefore, the combination of the primer and the probe was judged to have low detection specificity for the mutation by nonspecific amplification.

FIGS. 14 and 15 are results of real-time PCR using F6 primer, R1 primer and ZEN probe to detect RNF213 c.14429G> A mutation. As shown in FIGS. 14 and 15, the amplified signal was observed in the wild type as well, and the amplified signal was also observed in the negative specimen identified as RNF213 c.14429G> A mutant negative by the sequencing analysis. Therefore, the primer and the probe combination were non- It was judged that amplification resulted in low detection specificity for the mutation.

Unlike the case of using various combinations of primers and probes having different sequences as described above, the primers and probes prepared in Example 1 have a very high detection specificity, so that the detection specificity is low. Therefore, the genotype of the RNF213 c.14429G > A mutation site Which is the most suitable for analyzing.

Comparative Example  2. primer  And Of the probe  According to sequence RNF213  Wild type or Mutant type  Identification of detection specificity

RNF213 c.14429G> Real-time PCR was performed on the negative samples using various types of primers and probes capable of analyzing the genotype of the A mutant site, and then each of the wild type detection probes or the mutant type detection probes To confirm whether nonspecific amplification occurs.

Specifically, with respect to the sample DNA identified as RNF213 c.14429G > A mutant negative by the base sequence analysis test using various combinations of the forward primer, reverse primer, mutant type detection probe and wild type detection probe described in Table 8 below Real-time polymerase chain reaction was performed in the same manner as in Example 2.

type SEQ ID NO: designation order Forward primer 16 RNF213_Zen F1 primer 5 'CAGTTCCAGAACGTCCAGCAA 3' Forward primer 17 RNF213_Zen F2 primer 5 'GTTCCAGAACGTCCAGCAA 3' Reverse primer 18 RNF213_Zen R1 primer 5'TTTCGAACCGCCAAATGC 3 ' The mutation detection probe 19 RNF213 (ZEN-A1) probe (FAM) 5'AATACAGCTCCATCAAAGGCTTCCTCA 3 '(IABkFQ) The mutation detection probe 20 RNF213 (ZEN-A2) probe (FAM) 5'CAGCTCCATCAAAGGCTTCCTCA 3 '(IABkFQ) Wild type detection probe 21 RNF213 (ZEN-G1) probe (HEX) 5 'TTGAATACAGCTCCATCAGAGGCTTCC 3' (IABkFQ) Wild type detection probe 22 RNF213 (ZEN-G2) probe (HEX) 5 'CAGCTCCATCAGAGGCTTCC 3' (IABkFQ)

16 is a result of performing a real-time PCR on negative samples using various combinations of primers and probes having different sequences. As shown in Fig. 16, amplification signals were also observed for the negative specimens. Therefore, it was judged that the combination of the primers and probes had a low detection specificity for wild type or mutation by nonspecific amplification.

In contrast, the primers and probes prepared in Example 1 were found to be most suitable for analyzing the genotype of RNF213 c.14429G > A mutant site because the detection specificity was very high.

<110> Samsung Life Public Welfare Foundation          BIOSEWOOM, INC. <120> Composition for diagnosing diseases caused by mutation of RNF213          gene using Real-Time PCR, and use thereof <130> PN115412KR <160> 22 <170> KoPatentin 3.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> RNF-MGB F1 primer <400> 1 agaacgtcca gcaagttgaa taca 24 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> RNF-MGB R1 primer <400> 2 tttcgaaccg ccaaatgc 18 <210> 3 <211> 14 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > RNF213 (A) probe <400> 3 ctccatcaaa ggct 14 <210> 4 <211> 13 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > RNF213 (G) probe <400> 4 ctccatcaga ggc 13 <210> 5 <211> 21062 <212> DNA <213> Homo sapiens <400> 5 ggggcgacag cgcgcggcag gcggcgagct cgggggccgc agaaaatgaa actgaagccg 60 tggtcacgtg acaggacatg tagtatatag caggctgcca gcgactcctg ctcttgcttc 120 tggatctgca gggcagtccc agcaggaccc atggagtgtc cttcgtgcca gcatgtctcc 180 aaggaggaaa cccccaagtt ctgcagccag tgcggagaga ggctgcctcc tgcagccccc 240 atagcagatt ctgagaacaa taactccaca atggcgtcgg cctcggaggg tgaaatggag 300 tgtgggcagg agctgaagga ggaagggggc ccgtgcttgt tcccgggctc agacagttgg 360 caagaaaacc ccgaggagcc ctgttccaaa gcctcctgga ccgtccaaga aagcaaaaag 420 aagaaaagga agaagaaaaa gaaggggaac aagtccgctt cctcagagct ggcttccttg 480 cccctttctc ctgccagccc ctgtcacctg actttgcttt caaacccgtg gcctcaggac 540 acagccctgc cccacagcca agcccagcag agtggcccca ctggccagcc gagccagccc 600 ccaggcacag ccaccacgcc actggagggt gacggcctct ccgcgcccac cgaggttggc 660 gacagccccc tgcaggccca ggctttggga gaggcaggag tggccacagg aagtgaggct 720 cagagcagcc cgcaattcca ggaccacacg gaaggggagg accaggacgc ttccatcccc 780 tctgggggca gaggcctgtc ccaggagggg accggtcccc ccacctctgc tggtgaaggc 840 cattctagga ctgaagatgc tgcccaggag ctcctgttgc ctgagtcaaa aggaggcagc 900 tctgagcccg ggacagaact gcagaccacc gagcaacagg caggggcctc agcctctatg 960 gcagttgatg ctgtagctga gccagccaat gcagttaaag gggccgggaa ggaaatgaaa 1020 gagaagaccc agagaatgaa acagccacca gcaaccactc ctcctttcaa aacacactgc 1080 caggaagctg agaccaagac caaggacgag atggctgctg ctgaagaaaa agtcggtaag 1140 aatgaacaag gggagcctga agacctcaag aagccagagg ggaagaacag aagtgcagct 1200 gctgtgaaaa acgagaagga gcaaaaaaac caggaagcag atgtccagga agtgaaggca 1260 agcacgctga gcccgggtgg aggagtcacc gtgttcttcc acgccatcat ctctcttcat 1320 ttcccattca atcctgacct ccataaagtc ttcatcagag gaggagaaga atttggggag 1380 tcaaaatggg acagcaatat ctgtgagctg cactacacca gagacttggg tcatgaccgc 1440 gttcttgttg aaggcattgt ctgcatttcc aagaagcacc tagataaata cattccttac 1500 aagtacgtca tttataatgg ggaatctttt gagtatgagt tcatttacaa gcaccagcag 1560 aagaagggcg agtacgtcaa ccgctgtctg ttcataaaat cttcacttct gggctcagga 1620 gactggcatc agtactatga catagtttat atgaagcctc atgggagact ccagaaagtc 1680 atgaaccaca tcacagacgg gccgaggaag gacctggtga aggggaagca gattgccgct 1740 gcgctcatgc tggacagcac cttcagcatc ctgcagacct gggacaccat caacctgaac 1800 agcttcttca cccagttcga gcagttttgc tttgtcctgc aacagcctat gatttatgaa 1860 ggacaggcac agctgtggac cgatttgcag tacagggaga aagaggtgaa gagatacctg 1920 tggcaacatc tgaaaaaaca cgtggtacca ttgccggacg gaaaaagcac ggactttttg 1980 cctgtggact gcccagtgag gagtaaactg aaaacaggcc tgattgtcct ttttgtagtg 2040 gaaaaaattg agcttttatt agaaggcagc ctggactggt tgtgtcacct cctaacctca 2100 gatgccagct caccagatga gtttcaccgt gacctaagcc acatccttgg gatacctcag 2160 agctggcggc tgtacctggt gaacctgtgc caaagatgca tggacacaag gacgtacacc 2220 tggctgggcg ccctgcctgt cctgcactgc tgtatggagc tggccccgcg gcacaaggat 2280 gcctggagac agcctgagga cacctgggcc gctctggagg gactctcctt ctcaccgttc 2340 cgggaacaaa tgctagatac gagttcccta cttcagttta tgagagagaa gcagcatttg 2400 ctgagcatag acgagcctct cttccggtcc tggtttagtc tgctacctct gagtcacctg 2460 gttatgtata tggaaaactt cattgagcac ctgggtcgtt ttcctgctca tatcctggac 2520 tgtctttcag ggatttacta ccggcttccg ggacttgagc aagtcttgaa tacgcaggat 2580 gttcaggatg ttcagaacgt tcagaacatt ttagaaatgc tgttgcgact cctggacact 2640 taccgggaca agattcccga ggaggccttg tcaccatcct acctgactgt gtgtctgaaa 2700 ctgcatgaag ccatctgcag cagcacaaag ctacttaagt tttacgagct gccagcctta 2760 tctgccgaga ttgtctgcag aatgattaga cttctatctc tggtggattc tgcaggacag 2820 agagatgaaa ctggaaataa ttcagtccaa acagtcttcc aagggaccct tgctgctacg 2880 aaaaggtggc tccgagaagt ttttacaaag aacatgctca catcttcagg tgcctcattc 2940 acatacgtca aggaaattga ggtctggagg cggctggtgg aaatccaatt ccccgcggag 3000 catggctgga aggagtcgtt gctgggagac atggaatgga ggctcacaaa ggaggaaccc 3060 ctctcccaga tcactgccta ctgcaatagt tgctgggaca ccaaaggctt agaggacagt 3120 gtggccaaga ccttcgagaa atgcatcatt gaagccgtga gctcagcctg ccagtctcag 3180 accagtatcc ttcaggggtt ctcttactct gatttgcgga aatttggcat cgtcttgtct 3240 gctgtgatca ctaagtcctg gcctaggacc gcggacaact tcgatgacat tttaaagcat 3300 ctgctcacgt tggcagatgt caagcacgtc ttcagattgt gtggaaccga cgagaaaata 3360 ctagcaaatg tcacagagga tgccaagagg ctgatagctg ttgccgactc tgtgttgacg 3420 aaagttgttg gtgacctcct aagtggcacg attttagttg gacaactgga gctgattata 3480 aagcacaaga atcagtttct tgacatctgg caactgaggg aaaaaagtct ttcaccccag 3540 gatgaacaat gtgctgtgga ggaagcactg gattggagaa gggaggaact gttacttcta 3600 aagaaagaga aaagatgtgt tgatagtctc ctgaagatgt gtgggaacgt gaaacatctg 3660 atacaagtgg actttggagt gcttgcagta agacactcac aagacctcag cagtaaaaga 3720 ttaaatgaca ccgtgacagt gagactgtcc acctcctcga actcgcagag ggcaacgcat 3780 taccacctga gctcccaggt ccaagaaatg gctgggaaga tagacttgct cagagacagc 3840 cacatcttcc agctcttctg gcgggaagcc gcagagccgc tgagtgagcc taaggaggac 3900 caggaagccg cagagttgct gagtgagccc gaagaagaat cagaaaggca catccttgag 3960 cttgaagagg tgtatgacta tttgtatcag ccttcttaca gaaagttcat taagttgcac 4020 caggatctaa agtcaggaga ggtcaccctt gcagagattg atgtcatctt caaggacttt 4080 gtgaataaat acacggacct ggattcagaa cttaagatca tgtgcaccgt ggaccaccag 4140 gaccaaagag attggatcaa ggaccgagtc gaacagatca aggaatacca tcacctgcac 4200 caggctgtcc acgcagccaa ggtcatcttg caggtcaaag agagcctggg actgaacggt 4260 gacttcagtg ttctcaacac tttactaaat tttactgata acttcgacga ctttcgccgt 4320 gaaacactgg accagatcaa ccaggagctc atccaggcca aaaagctgct ccaggacatc 4380 agcgaggccc ggtgcaaggg gctgcaggct ctgtccctga gaaaggagtt catctgctgg 4440 gtccgggagg ctcttggagg catcaatgag ctgaaggtgt ttgtggacct ggcctccatc 4500 tcagcggggg agaatgacat tgatgtggac cgggtggcct gcttccatga cgctgtgcag 4560 ggctacgcat ccctgctatt taagctggac cccagcgtgg acttcagtgc attcatgaag 4620 catctgaaaa agctgtggaa ggctctggat aaggaccagt acctgcccag gaaactgtgt 4680 gactccgcca ggaacttgga atggctgaag actgtgaatg agagtcatgg gtctgtggaa 4740 cgctcatccc tgaccctggc cacggccatc aaccaaagag gcatctatgt gatccaggcg 4800 cccaaaggtg gccaaaagat ttccccagac acggttctgc acttgatcct tcctgagagc 4860 cctggcagcc acgaggagtc acgagagtac tctttagagg aggtgaagga gcttttgaac 4920 aagttgatgc tgatgtctgg caagaaggat cgtaacaaca cggaagtgga gaggttttca 4980 gaggtcttct gcagtgtgca gaggctcagc caggccttca tcgacctgca ctctgctggg 5040 aatatgctgt tcaggacgtg gatcgccatg gcctactgct cccccaagca gggtgtgtcc 5100 ctccaaatgg actttggctt ggacctggtg acggagctta aagaaggtgg agatgtcact 5160 gagctgctgg cagccctctg caggcagatg gagcacttcc ttgacagctg gagagattt 5220 gtgacccaga agcgaatgga gcacttttac ctgaacttct acacggcaga gcagctggtt 5280 tacctgagca ctgagctcag gaagcagccc ccgagtgatg ccgccctaac gatgctatcc 5340 ttcatcaaaa gcaactgcac cctgagggat gtcttaaggg cctctgtggg gtgtgggagt 5400 gaggccgcca ggtaccgcat gaggagagtc atggaagagc tcccgctgat gctcttatca 5460 gagttcagcc tggtggacaa gctgaggatc atcatggagc agtccatgag gtgccttcct 5520 gccttcctgc ccgactgcct cgacctagag acccttggcc actgtctggc tcacctggca 5580 gggatgggtg ggtctcccgt ggagcgttgt ctcccgagag gtctgcaggt cggccagccc 5640 aacctcgtcg tctgtggcca ctccgaggtg ttgccagccg ccctggctgt ctacatgcaa 5700 accccaagcc agcccctgcc cacttacgat gaggtgctgc tctgcacccc ggcaaccacc 5760 tttgaggagg tggcactgtt gctgcgccgc tgcctgaccc tgggctccct ggggcacaag 5820 gtctacagcc tgctgttcgc agatcagctg agctacgagg tggcacgcca agcggaggag 5880 cttttccaca atctgtgcac gcagcagcac cgagaagact accagctcgt catggtctgt 5940 gatggggact gggagcactg ctacctcccc tctgccttca gccagcacaa ggtcttcgtc 6000 accccccagg cacccctcga ggccatccaa gcctacctgg caggtcacta ccgggtcccg 6060 aagcagaccc tgtcggcggc agccgtgttc aatgaccggc tgtgtgttgg gatcgtggcc 6120 tcggagcgag caggtgttgg aaagtctctg tacgtgaaga ggttgcacga caaaatgaag 6180 atgcagttaa acgtgaaaaa tgtgcctctg aaaacaattc gactgatcga ccctcaggtg 6240 gatgagagcc gagtcctggg cgccctgctg cccttcctgg atgcgcagta tcagaaggtc 6300 cccgtgctct ttcacctgga cgtgacctcc tcagtgcaga ctggaatttg ggtgtttctt 6360 ttcaagctcc tcattttaca atacttaatg gatataaatg ggaaaatgtg gcttcggaac 6420 ccctgccatt tgtatatcgt tgaaatcctg gaaaggagga cgtcagtgcc gtcgaggagc 6480 tcttcagcgc tgcgtacacg tgtaccccag ttcagttttc ttgacatctt cccaaaagtc 6540 acctgcaggc ctcccaaaga ggtgatagac atggagctga gtgccctgag gagtgacaca 6600 gagcctggga tggatctgtg ggagttctgc agcgaaactt tccaaagacc ttaccagtat 6660 ttaagacgat tcaatcaaaa ccaagaccta gacacgtttc agtatcaaga aggctctgtc 6720 gaaggcaccc cggaggaatg cctccagcat ttcctgtttc actgcggggt aataaaccca 6780 tcctggtcag agcttcggaa ctttgctcgg ttcctgaatt atcagctcag agattgtgag 6840 gcctctctct tctgcaatcc gagttttatt ggcgacacac tgaggggctt caagaagttc 6900 gtggtgacct tcatgatctt tatggcaaga gattttgcca caccatcact ccacacctct 6960 gccaaagcc cggggaagca catggtcacc atggatgggg ttagggaaga agatctagcg 7020 cccttctccc tccggaagag gtgggagtcg gagcctcacc catacgtttt cttcaatgac 7080 gaccacacaa ccatgacatt catcggcttc catctgcagc ccaacatcaa cggcagtgtc 7140 gatgccatca gtcacttgac tgggaaggtc atcaagagag acgtcatgac cagggacctg 7200 taccagggcc tgctgctcca gagggtgccc ttcaatgtcg actttgataa actgcccaga 7260 ccaagaaac ttgagaggct ctgcctgacc ttagggatcc cccaggccac cgaccccgac 7320 aaaacgtatg agctcacaac cgacaatatg cttaaaatcc ttgccatcga gatgcggttc 7380 cggtgtggga tcccggttat catcatggga gaaactggct gtgggaaaac caggcttatt 7440 aaattcctta gcgacctgcg gcgtggtggt accaatgctg acaccataaa gctggtcaag 7500 gtgcacggag gaacaactgc agacatgatc tactccagag tcagggaggc tgaaaatgtg 7560 gccttcgcca ataaggacca acatcagttg gacaccatct tgttttttga tgaagccaac 7620 acaacggaag ctataagctg tatcaaagaa gtcctgtgtg atcatatggt ggatggccag 7680 cctctggctg aggactctgg cctgcatatt atagctgcct gcaatccata ccggaagcac 7740 tctgaggaga tgatctgccg tttggagtca gctggtttgg gctacagggt tagtatggag 7800 gagacggccg acaggctggg ctccattcct ctgaggcagc tggtataccg ggtccatgct 7860 ctgcccccga gcctgattcc tctggtgtgg gactttggac aactgagtga cgttgctgaa 7920 aagctctaca tccagcagat tgtccagaga ctggttgagt ccatcagcct agatgaaaac 7980 gggactcgcg tgatcacaga agtcctctgc gcctctcagg gtttcatgag gaaaacagaa 8040 gatgagtgca gctttgtcag cctcagggac gtggagcgct gtgtgaaagt tttcaggtgg 8100 ttccacgagc acagcgcgat gctcttagcg cagctgaatg cctttctctc caagtccagc 8160 gtcagcaaaa atcacaccga gagagatccc gtcctctggt cgttgatgct ggccatcggg 8220 gtgtgttacc atgcctcttt agaaaagaaa gactcatatc ggaaagccat cgccaggttc 8280 tttccgaaac cgtatgacga cagcaggctg cttctggatg aaataacacg ggcacaggat 8340 ctttttctgg acggcgtacc tctgaggaaa accatcgcca agaacttggc cttgaaggag 8400 aacgtcttca tgatggtcgt ctgcatcgag ctgaagattc ccctcttcct ggtggggaag 8460 cccggcagct ccaagtctct cgccaagacc atcgtggcag acgccatgca gggcccggct 8520 gcctactcag atctcttccg cagcctgaag caggtccacc tggtgtcctt ccagtgcagc 8580 ccgcactcca ccccacaggg catcatcagc accttccggc agtgcgcccg ctttcagcag 8640 gggaaggacc tgcagcagta cgtctctgtg gtggtgttag atgaggtggg gctggcggaa 8700 gactcaccca aaatgcccct gaagactctg cacccgctgc tggaagacgg atgcattgaa 8760 gacgatcccg ccccccacaa aaaggtcggc ttcgtgggca tctccaactg ggcccttgac 8820 cctgccaaga tgaaccgggg catttttgtg tcacgtggca gccccaacga gacagagctc 8880 atagagagcg ccaagggcat ctgctcctca gacatcctcg tccaggaccg agtccaaggg 8940 tactttgcgt cctttgccaa agcctacgaa acggtgtgta agcgccagga caaggaattc 9000 ttcgggcttc gtgactacta cagcctcatc aaaatggtct ttgctgcagc aaaggcttca 9060 aatagaaagc cttccccgca agacattgca caggctgtcc ttaggaactt cagtggcaag 9120 gatgacatcc aagctttgga catctttctg gccaatttgc ccgaggccaa gtgctcagag 9180 gaagtcagcc ccatgcagct gatcaaacag aacatctttg ggccttctca gaaggtgccg 9240 ggtggagagc aggaagatgc tgagtcccgc tacttactcg tgctgaccaa aaactacgtg 9300 gcactgcaga tcctgcagca gacattcttc gagggggacc agcagccgga gattattttt 9360 ggttctggtt tccccaagga ccaagagtac acccagctct gcagaaacat caatcgtgtg 9420 aagatctgca tggaaacagg caagatggtg ttgcttctca acctgcagaa cctctacgag 9480 agcctctacg acgcactcaa ccagtactac gtccacctcg gcggccagaa gtacgtggac 9540 ctcggtctgg ggacccaccg cgtcaaatgt cgggttccc ccaacttccg cctgattgtc 9600 attgaagaga aagacgtcgt gtacaaacac tttcccatcc ccctcattaa ccggctggag 9660 aagcactatc tggatatcaa cacggtgctg gagaaatggc agaagagcat cgtggaggag 9720 ctctgtgcgt gggtggagaa gttcatcaat gtcaaagcac atcatttcca gaagaggcac 9780 aaatacagcc cctctgacgt cttcatcggc taccactcgg acgcctgcgc gtctgtggtg 9840 ctgcaggtca tagagagca gggtccccgg gccttgacgg aggaacttca ccagaaggtg 9900 tctgaggagg ccaaatcgat cctgctgaac tgcgctacgc ccgatgccgt ggtccggctg 9960 agcgcctact cgctgggcgg gttcgcagcg gagtggctgt cgcaggagta ctttcacaga 10020 cagaggcaca actcctttgc agatttcctt caggcacacc tgcacacggc agacctggag 10080 cgccacgcca tcttcacaga gatcaccact ttctccaggc tgctaacaag tcacgactgt 10140 gaaattttag aatcagaggt cacaggcagg gctccgaaac ccacactcct gtggctgcag 10200 cagtttgaca ccgagtactc attcctcaaa gaagtccgaa actgtttaac gaatacagcc 10260 aaatgtaaaa tcctcatttt tcagacagat tttgaagatg gaatccgtag cgcccagctc 10320 attgcctcag ctaagtattc tgttataaat gaaatcaaca aaatacgaga aaatgaggac 10380 cgtatcttcg tctatttcat cacaaaactg tcccgggtgg gaagaggaac agcctatgtg 10440 ggcttccacg gagggctgtg gcagtctgtc cacatcgatg acctccggag atccaccctc 10500 atggtttctg atgtgaccag gctgcagcat gtcaccatca gccagctgtt cgcgcccgga 10560 gacttgcctg agctgggctt ggaacaccgg gcggaagacg gccatgagga ggcgatggag 10620 acggaggcca gcacatcagg ggaggtggca gaggtggcag aggaggccat ggaaacagaa 10680 agttctgaga aggtgggaaa ggaaacctct gaactcggag gcagtgatgt gtcgatcctg 10740 gacaccacca ggctgctgag aagctgtgtg cagagcgccg tgggcatgct cagagaccag 10800 aacgagagct gcacgcgcaa tatgcggagg gtggtgctcc tcctgggcct cttgaatgag 10860 gatgacgcgt gccacgcctc tttcttgcgg gtatccaaga tgcgcctcag tgtcttttta 10920 aagaagcaag aagagagcca gtttcaccct ctggagtggt tggcaaggga agcctgcaac 10980 caggacgctc tccaggaggc gggcacattc aggcacaccc tctggaagcg ggtccaaggt 11040 gctgtcaccc ctctgctggc gagcatgata tcattcatcg acagagacgg caacctagag 11100 ttactgacca ggccagatac tccgccctgg gcaagagatc tttggatgtt tattttcagt 11160 gacacgatgc ttctgaacat tcctcttgtg atgaataatg aaagacataa aggtgagatg 11220 gcctacatcg tggtgcagaa ccacatgaac ctttccgaga acgcttccaa caacgtccct 11280 ttcagctgga aaatcaagga ctatctggag gagctgtggg tccaggctca gtacatcaca 11340 gacgcagaag gactgcccaa gaagttcgtg gacatctttc agcagactcc tctgggcagg 11400 tttcttgccc agctccatgg agagccgcag caggaacttc ttcagtgtta cttgaaggat 11460 ttcattctct tgaccatgcg tgtgtcaacg gaggaggaat taaagtttct gcagatggct 11520 ctgtggtcct gcactaggaa actgaaagcg gcgtcagaag cgcccgagga agaggtttcc 11580 ttaccgtggg tgcaccttgc ctaccagcgt ttcagaagcc gtctgcagaa cttttccaga 11640 atcctgacca tctaccctca ggttctccac agcctgatgg aagcccgttg gaaccatgag 11700 ctggctggat gtgagatgac cctggacgca tttgccgcaa tggcctgcac ggagatgctg 11760 acaagaaaca ccctgaagcc cagtccccag gcgtggctac agttggtgaa gaatctttcc 11820 atgccgctgg agctcatctg ctccgatgag cacatgcaag gcagcgggag cctggcccag 11880 gctgtcatca gggaagtcag agcccagtgg agtcggattt tctccaccgc actcttcgtg 11940 gagcacgtgc tcctaggaac cgagagccgc gtccccgagt tacaggggct ggtgaccgag 12000 cacgtcttct tactagacaa gtgtcttcga gagaactctg acgtgaagac gcacgggcct 12060 tttgaggccg tgatgcgcac tctctgtgaa tgcaaggaga cagccagcaa gaccctcagc 12120 aggtttggga ttcagccgtg ctccatctgc ctgggagatg caaaggaccc cgtctgtctg 12180 ccctgcgacc acgtgcactg cctgcgctgc ctcagggcct ggtttgcctc agagcagatg 12240 atatgcccct actgtttaac tgccttgcca gacgaattct ctccagctgt ttcccaagcg 12300 cacagggaag ccattgaaaa gcatgcccgc ttccggcaga tgtgcaacag tttcttcgta 12360 gacctggtgt ccaccatttg cttcaaggac aacgctccgc ctgagaagga agtgattgag 12420 agcctgctct ctctcctctt cgtccaaaag gggcgcttaa gagatgctgc ccagagacac 12480 tgtgaacaca caaaatctct ctctccattc aatgatgttg tggataagac tcctgtcatc 12540 cgctcagtga tactgaaact gcttttgaag tacagctttc atgatgtaaa agattatatt 12600 caggaatatt tgaccctgtt aaaaaagaaa gcattcataa ctgaagataa aactgaactg 12660 tacatgctct tcatcaactg cctggaggat tcaatacttg agaagaccag tgcttactcc 12720 agaaatgatg aactgaacca cctagaagag gaaggtcgtt tccttaaggc atattctcca 12780 gcaagccggg gccgagagcc tgccaacgag gcctcggttg aatacctgca agaggtggcc 12840 cggatccgcc tctgcctcga cagagctgca gatttcctct cggagcctga gggaggccca 12900 gagatggcca aggagaagca gtgctacctg cagcaagtca agcagttctg tatccgggtg 12960 gagaacgact ggcaccgggt gtacctggtg cggaagctca gcagccagcg ggggatggag 13020 ttcgtgcagg gcctctccaa gcccggccgc ccgcaccagt gggtgtttcc caaggacgtt 13080 gtcaagcagc aggggctgcg gcaggaccac ccaggccaga tggataggta cctggtgtac 13140 ggcgatgaat acaaggctct ccgtgatgct gtggccaaag ctgtcctcga gtgcaagcca 13200 ctgggcatta agactgctct gaaggcctgc aagacccccc aaagccagca gtcagcctac 13260 ttcctgttaa cactgtttag agaggtggct attttgtaca gatcccacaa tgcaagcctc 13320 caccccacgc cagagcaatg tgaagctgtg agcaaattca ttggcgaatg caagatcctt 13380 tcacctcctg atatcagccg ttttgcaaca tcgctcgtgg acaattctgt gccattgttg 13440 agggcggggc ctagtgacag caaccttgat ggaacggtga cagaaatggc cattcatgct 13500 gcagccgtcc ttctgtgtgg acagaatgaa ctcttggagc ccctaaagaa tctggccttc 13560 tccccagcca ccatggcgca tgcttttctt ccaaccatgc ctgaagactt gctggctcaa 13620 gctcggaggt ggaagggtct ggagcgagtc cactggtaca cttgtcccaa cggccatcct 13680 tgctccgtgg gagagtgtgg caggccgatg gaacagagca tctgcattga ctgccatgcg 13740 ccgattggag gcattgacca caaacctcgg gacggctttc atctggtcaa agacaaggca 13800 gaccaacgc agaccggcca cgtgctgggc aacccgcagc ggagagacgt ggtgacatgt 13860 gaccgagggc tgcccccagt ggtcttcctc cttatccggc tactcactca cttggctctg 13920 cttctgggag cgtcccagag ttcccaggct ctgataaaca tcattaagcc tccagtgagg 13980 gatccaaaag gctttctgca gcagcacatc ctgaaggacc tggagcagtt ggccaagatg 14040 ctgggacaca gtgccgacga gaccatcggc gtggtccacc tcgtcctgcg caggcttctc 14100 caagagcagc accagctctc tagcagaagg cttttaaatt ttgacacaga attgtcaact 14160 aaagaaatga ggaacaactg ggaaaaggaa atcgcagctg tgatttctcc tgaactggag 14220 catctagata aaacccttcc caccatgaat aatctcatca gccaagataa gcgtatcagc 14280 tctaaccctg tggccaaaat aatatatggt gacccagtga ccttcctgcc ccacctgccc 14340 cggaaaagtg tggtccattg ctctaagatt tggagctgca ggaaaagaat tacagttgag 14400 tacctccagc acattgtgga acagaaaaat ggcaaagaaa gagtgcccat cctctggcat 14460 ttcctgcaga aggaagcaga gctgaggctg gtaaagttcc tgcctgagat tttggccttg 14520 caaagggatc tagtgaagca gttccagaac gtccagcaag ttgaatacag ctccatcaga 14580 ggcttcctca gcaagcacag ctcagatggg ttgaggcagc tgcttcacaa caggatcaca 14640 gtctttctgt ccacatggaa caaactgagg agatcgcttg agacgaacgg tgagatcaac 14700 ctacccaaag actactgcag cactgacttg gatctggaca ctgagtttga gatcctcttg 14760 ccacgccgac ggggcctggg cctctgtgct accgctctcg tcagctactt gattcgccta 14820 cacaatgaaa ttgtctacgc cgtggaaaaa ctctccaagg aaaacaacag ctattccgtg 14880 gatgccgccg aggtcactga actgcatgtc atcagttatg aagtggagcg ggacctgact 14940 ccactgattc tctccaactg ccagtaccag gtggaggagg gcagagagac cgtgcaggag 15000 ttcgatctgg agaagattca gcggcagatc gtcagccgct tcctccaggg caagccccgg 15060 ctgagcctca agggaatacc cactctggtg tacagacacg actggaacta tgaacatctc 15120 tttatggaca tcaagaacaa aatggcacag gactccctcc ccagctcggt cattagtgcc 15180 atcagtggac agctgcagtc ctacagcgat gcctgtgaag tgctgtctgt cgtagaagtc 15240 actctggggt ttctgagcac agctggtggg gatccaaaca tgcagctgaa tgtgtatact 15300 caagacatcc tgcaaatggg tgatcagacg attcacgtgt taaaggcctt aaacagatgc 15360 cagttaaaac acaccattgc cctctggcag ttcctgtctg ctcataagtc tgaacagctg 15420 ctgcggctgc acaaagagcc atttggggaa atcagttcaa ggtacaaagc ggatctgagc 15480 ccggaaaatg ctaagctcct cagcacattc ctaaatcaga ctggcctaga cgccttcctg 15540 ctagagctgc acgaaatgat aatcttgaaa ctaaagaacc cccaaaccca aaccgaggag 15600 cgcttccgcc ctcagtggag cctgagagac actctcgtaa gttacatgca aactaaagaa 15660 agtgaaattc ttcctgaaat ggcatctcag ttcccagaag agatactgct cgccagctgt 15720 gtctcagtgt ggaaaacagc tgctgtgctg aaatggaatc gagaaatgag atagaattat 15780 ttcctcagct atctttggat gactttggag agaagactcc tctctcctcg tctgcggcgt 15840 ggacttgatc atggactggt gcctttgcat tcagaaggag agctgtcagc gtagcaccga 15900 attcaagacc aaggcgtgct acctgagctg acagcttttt gaaagccgag ctgtttctga 15960 accatgtaca tacatgttct gaaactttct catcatttta tgagtactgt tcattgagag 16020 atgacaatga agattagatg aaattggaaa taaaccaaca ttgtttacat tccaggagac 16080 ttgtagctca gccacacacg cagtaatgac ctgtgcccgt tcgcctctgg cactgcccac 16140 ccctcttttt ttttttcttc taattctgta ctcacaaaag agaatctcat tttcttcttt 16200 cttccattcc cttaaattct gagtactgta catatatttc tgggttccca cgatgatgtg 16260 aaaaactacc agactgtttt ttgtcttctc acaaagacaa gaaaaatcag ggcattttgt 16320 gagtgcctta agatcaaact aacaagatct gaccctctcc cctcacagtg agccactgcc 16380 ccacttcaga gggtaagagc caaaagcctc attgtgaaag gcactggact tggaccaggg 16440 acaccatcag ggccttggtt ttctcacgca taaaatggag agtggattaa tcgccaaaga 16500 ttcttctgat ctgacatttt gaaattgtga gagaaactag atgactgtaa acttggtcac 16560 aggcctggtt ctggcagttc tttgcggact tttttctagc attatgccaa ataaacatgc 16620 agtctcagtg tgctctcgca tgtatgaata tctagtcctt tctgtggttc tcagccaaga 16680 cataaaaact aggactcaga gcacatacaa aaccagttat gtttcggaaa gagggaaaag 16740 agtccccgag cccggatctt gtgctgcttt tctcactgac gtgttgcctt ttttctttac 16800 aaaatctgct ttgatactta ggacctctct ggactaattt ctcttcctag acagctcagc 16860 acagctattg atatgttaga ggcagtatcc ttaatattca ttctaaatga gttaacgact 16920 taacttgaaa ttgggcctaa ggagtgagaa ctacaaaaat acaaaatgct tgtccaggac 16980 tcagccatgc acaccttgag cagcgccggc aggaggcacg gaaggaactg tgctccgttc 17040 tcctcactgt catggtgcca ccagtgtctg atgaagggca gagtgaccca gactgcaggc 17100 agtaactgac ttcacacagt ccctggcatt tagtcatctg tgattgtttt atcactctgg 17160 actgtgcaga gccacctgcc accgagatct gcattccgac tgcctatgaa cgggtgtggg 17220 ggccgggggc tggcttgctg aagtcttcaa cttgcactcg gagctccttt gatacctcag 17280 agctggctgt caggtggcag ctcacaccca gactcactgg ccacacctca gcaggggggg 17340 agtcgagtgt cagtctcttt ctgtgaaggc tttttttttc ctttggcctg ggaatttttc 17400 ccatttttat gaaggggttt taaattgttt cattttgtgt gctgtgcttc aaagccttaa 17460 ctgtcaaatc ttgcattatc ttgtttgtac agaaatatac tggcctagca gaggcaaaaa 17520 aaaaaaaaat gaattttatt ttacttgtca cacctgtctt aataaactgg agttttgctg 17580 ctaaagaact cttctctctg ggggcagagc ttctatttat ggcacataga catcagctag 17640 gcttttggga atcgtttgtg ttctttgtgg aaatgtcctt tagaagcacc catgaagtag 17700 tgtgttcaga ctgtgcacac agaaaacagg ctctgccttc acatgtgaga cggtggactt 17760 ttcctctgga caaaatgaca gcatcctggc gactccacag tggagctgag cgccactccc 17820 tgtagccgat ctgggactga aacgcttaca cctctgcctc agaaggagtc ccccatgccc 17880 tgcctgaaat gacttcactg gacacagcgg ggctgcagct aacggggtac aggtaggagc 17940 taactaactt cacccctgag tccacttgcg gggtaagaga taaacagtaa cccttccagg 18000 agcccactga cgttggagtg ctaaaaatgc cccttcaggg ggaaaactgc attttctctt 18060 ccaaaaagga aaggttcttc caggcgagaa acctgtggtc tagaaccaca gcaagaagag 18120 gaggcatgct ggcctgcacc ggaagactca ctttgtctgc cctgcgccag cctcacctca 18180 ccctgcagtt cccgtttccg ccatggatgc ctcatcacca accctgacct tccccctccc 18240 aaccctttat tcatcctcac tcccactcat acccgcctcc ctggacagtt ccctgctgca 18300 gagttctttc tgctttcagc cctaccttgg tggtgattta cctgaaaatc ttcacaactg 18360 atcattatct ccttctcttt gagacctgac tgaaaaaatt aggtgtgcac acctgtaatc 18420 ccagctacct gggaggctga ggtatgagga ttgcttgagc ctgggagttt gaggctgcag 18480 tgagctatga ttgcaccact gcactccaac ctgggtgaca gagtgagacc ctgtctcaaa 18540 aaaaaataaa ataaggacct tattgtgtgt gcaaattatt tgcctttcat gaatagttat 18600 gagactttgt gcatgtgtta accgagacgg ccctgagcta tttcagttac tcctgtatgt 18660 tcaggcaatt ccaatttaga aacaaacttc cagtgataaa tattgggaag aaaatgtcag 18720 ctcagggcca agtaggtaaa gccacccaag tctagccatg cacacaggca ctagtgtgct 18780 gaaggaaaac acctctgatt tgatacataa agtgtgaagg ttgcataact ggggaggtgg 18840 ctggagaaaa cctgagcctc gagctgagta acaatccaag ccatgattag catttatatt 18900 gcattctgca ttattctcat cctatcacgt tcattaagtt caaccattac cattacgaat 18960 cccgtttcca gctggaaaaa caagcgccag gaaagtgcat ttccccccca cccccccccc 19020 ccaaccagag caactttggt cagaagtcac acctaatcac cctctctgca ggatatgctg 19080 gggatagccc ttttgaggag gtgggggtgt atgcgaaagc aacctggggc caaagcaggg 19140 ggaagcagga gagactggag gggccctggg tccagcaagt gctccaccag gctgcccctg 19200 ctcaggtgct ccacagccca taaaaaacgc cttcagccct gctgtgcttc ccctcacacc 19260 taaacttact ataagggtcc taccttcccc agtattcctt catgatcact gctacctgtg 19320 ccctgaagcg caacagaacc tcaacccaga ggacagccac ttcctcagaa cccacgatct 19380 ttgccccatc gccacaggtc catgagtgac tcctaattac caaatccaag ggctccttca 19440 ccctgaccac tctggaaccc aacaaagctg acacacagcc cagcccagac aggcctgaat 19500 gtgggtcctg gctctcccat ttgccagttc tacagccatg ggcaagtggc tcgacctctc 19560 taagcttcag tttcctcgtc tgtgaaatat ctgtcagtgc tcttaaggga ggagaccacc 19620 ccacatattg tcttacgccc aatttctgcc tccaaagaga gaagtaaaaa ctaaaaggca 19680 gaaatgaaat ccacaagcag acagcctgca ccacaccctg ggcctggtag ttaaagatcg 19740 acgcctgacc taatcagtga tgctatctat agattacaga cattatatag aaaagcaccg 19800 tgaaaatccc tgtcctgttc tgttccgttc taattacggg tgcatgcagc ccccagtcac 19860 gtaccccctg cttgctcaat caatcacgac cctctcacgc agacccctta agagttgtga 19920 gcccttaaaa gggacaggaa ttgctcactc ggggagctca gttgttggag acatgagtct 19980 tgccgaagcg cccggctgaa taaagccctt ctttaactcg tgtctgaggg gttttctctg 20040 cagcttgtcc tgctacattt cttggttccc tgaccaggaa tctaggtgat taatggatgg 20100 ttgaggcagc ccctcagacg gcttaggcct gccctgtgga gcatccctgt ggaggactcc 20160 agccagcttg agcgacatgg atcctgagag cgctctcagg caggcaattg ccccagtgga 20220 atgcctggcc agagcagtgt gtagcaggcc cccgaggagg atcaacgcag tggctgaaca 20280 ccgggaagga actgccactt ggagtccaga catctgaaac ttggtaagac tggtctttgg 20340 aacttgccca ctccatttga ggggaagcgt ggcctgatca cccacggcgt gcctgtactg 20400 gcactctggt ttttgttttt gacttgactt ggattgcttg atactttggt tttggttttg 20460 acctgacttg gatatcctga tactctgatt ttggttttga ttttggtttg gtgtaaactg 20520 taaaagtgtg tgtgtgccct ttttacctgt tctttgtttt gtggtatgcg tgtagggtga 20580 gcgtaatgtt ttgtcttgaa gaagcatggg tcaagcacaa agtaagacca ccccactagg 20640 aactatgctg aaaaatttca ggaaaggatt taagggagac tatggagtac tatgacacca 20700 ggaaaactta aaactttgtg taagatagac tggccagcat tagaggtagg ttggccatca 20760 gagtgaagcc tggacaggtc ccttgtttca aaggtatggc acaaggtaac ctgtaagcca 20820 gt; cccgcccgcc ccaacagtgg ttgagagaac agcagcataa gtggctggca gaggcaagga 20940 aagaccagca gagagagaaa gaggaagaga cagacaaaga gggagtcaga gagagagaga 21000 gaaagagaca gaggcaaaag gaaagtcaaa gagaaagaga cagaaaatca agaggaaaaa 21060 aa 21062 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RNF213-CF primer <400> 6 actgggtggt cttcccttct 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RNF213-CR primer <400> 7 gaaggagtga gccgagtttg 20 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> F1 primer <400> 8 agcaagttga atacagctcc attaa 25 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> F2 primer <400> 9 agcaagttga atacagctcc attaaa 26 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> F3 primer <400> 10 gcaagttgaa tacagctcca tgaa 24 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> F4 primer <400> 11 caagttgaat acagctccaa caa 23 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> F5 primer <400> 12 caagttgaat acagctccac caa 23 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> F6 primer <400> 13 caagttgaat acagctccag caa 23 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> R1 primer <400> 14 ccctatgcag tgatcctttc g 21 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> ZEN probe <400> 15 accaggactg tcccgcattt ggc 23 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> RNF213_Zen F1 primer <400> 16 cagttccaga acgtccagca a 21 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> RNF213_Zen F2 primer <400> 17 gttccagaac gtccagcaa 19 <210> 18 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> RNF213_Zen R1 primer <400> 18 tttcgaaccg ccaaatgc 18 <210> 19 <211> 27 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > RNF213 (ZEN-A1) probe <400> 19 aatacagctc catcaaaggc ttcctca 27 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > RNF213 (ZEN-A2) probe <400> 20 cagctccatc aaaggcttcc tca 23 <210> 21 <211> 27 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > RNF213 (ZEN-G1) probe <400> 21 ttgaatacag ctccatcaga ggcttcc 27 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > RNF213 (ZEN-G2) probe <400> 22 cagctccatc agaggcttcc 20

Claims (14)

A composition for diagnosing a disease caused by mutation c.14429G > A of RNF213 gene, comprising a primer and a probe for detecting c.14429G > A mutation of RNF213 (Ring finger protein 213) gene,
The primers are the primer pairs of SEQ ID NOS: 1 and 2,
Wherein said probe is a probe pair of SEQ ID NOS: 3 and 4,
The probe is labeled with a fluorescent substance at the 5'-end, a small mineral substance at the 3'-end,
The probe pair is composed of a wild type detecting probe which binds to the wild type of the RNF213 gene and a mutation detecting probe which binds to the mutation of the RNF213 gene,
The wild type detecting probe and the mutation detecting probe are labeled with different fluorescent materials,
Mutations of the RNF213 gene are detected by real-time PCR,
Wherein the disease caused by the c.14429G > A mutation of the RNF213 gene is Moyamoya disease, cerebrovascular stenosis, cerebrovascular atherosclerosis, renal artery stenosis or pulmonary vascular disease. delete The composition of claim 1, wherein the fluorescent material is 6-FAM, VIC, TET, 6-JOE, HEX, Cy3, or Cy5. The composition of claim 1, wherein the minerals are MGB-NFQ, 6-TAMRA, BHQ-1, BHQ-2, BH3-3, or ROX. delete delete A kit for diagnosing a disease caused by a mutation of c.14429G > A of the RNF213 gene comprising the composition of any one of claims 1, 3 and 4, wherein the disease causing c.14429G> A mutation of the RNF213 gene Wherein the disease is Moyamoya disease, cerebrovascular stenosis, cerebrovascular atherosclerosis, renal artery stenosis or pulmonary vascular disease. delete As a method for providing information necessary for diagnosing a disease caused by mutation c.14429G > A of RNF213 gene by real-time PCR,
Performing a real-time PCR using the DNA isolated from the sample as a template, the pair of primers of SEQ ID NOS: 1 and 2, and the pairs of probes of SEQ ID NOS: 3 and 4; And
Confirming the genotype of the c.14429G > A mutation site of the RNF213 gene,
The probe is labeled with a fluorescent substance at the 5'-end, a small mineral substance at the 3'-end,
The probe pair is composed of a wild type detecting probe which binds to the wild type of the RNF213 gene and a mutation detecting probe which binds to the mutation of the RNF213 gene,
The wild type detecting probe and the mutation detecting probe are labeled with different fluorescent materials,
Wherein the disease caused by the c.14429G > A mutation of the RNF213 gene is Moyamoya disease, cerebrovascular stenosis, cerebrovascular arteriosclerosis, renal artery stenosis or pulmonary vascular disease. delete The method according to claim 9, wherein simultaneous detection of the wild type detection probe signal and the mutation detection probe signal for the RNF213 mutation site in the step of identifying the genotype of the RNF213 mutation site indicates that the specimen is a heterozygote. The method of claim 9, wherein the fluorescent material is 6-FAM, VIC, TET, 6-JOE, HEX, Cy3, or Cy5. 10. The method of claim 9, wherein the minerals are MGB-NFQ, 6-TAMRA, BHQ-1, BHQ-2, BH3-3, or ROX. delete

Images