KR101915296B1 - OsPHYB gene from Oryza sativa for regulating salt stress resistance of plant and uses thereof - Google Patents

Abstract

The present invention relates to an OsPHYB gene derived from rice for regulating salt stress resistance of a plant, and a use thereof. In the present invention, it is founded that a mutation of OsPHYB improves the salt stress resistance. In the present invention, the effective use of the OsPHYB gene capable of regulating the salt resistance of the plant through the control of the expression of the OsPHYB gene in the plant. Therefore, the OsPHYB gene can be helpfully used for developing genetically modified (GM) crops such as transgenic plants and biofuel crops, which are resistant to environmental stress suitable for conditional disadvantages. A method for increasing the salt stress resistance of a plant includes the step of: inhibiting the expression of the OsPHYB gene by genetically transforming a plant cell with a recombinant vector including a gene to code OsPHYB protein.

Description

The OsPHYB gene from rice and its use for regulating the salt stress tolerance of a plant and its use (OsPHYB gene from Oryza sativa for regulating salt stress resistance of plant and uses thereof)

The present invention relates to a rice-derived OsPHYB gene which regulates salt stress tolerance of a plant and its use.

Light is a major environmental signal affecting the growth and development of plants such as seed germination, carbon assimilation, stem growth, leaf shape, and flowering time (Carvalho et al., 2011 J. Integr. Plant Biol. 53, 920-929). OsPHYB is a member of the phytochrome family of plant photoreceptors that respond to infrared (R) and near-infrared (FR) radiation and is influenced by many photomorphological events that are regulated by a variety of light-responsive genes (Franklin, KA, Quail , PH, 2010. J. Exp. Bot., 61, 11-24). R / FR ratios exposed to plants cause biochemical changes that are prominent in phytochrome-mediated reactions during responses to abiotic stress. For example, Mesembryanthemum grown in an infrared- crystallinum converts from C3 photosynthesis to CAM (cresylic acid metabolism) photosynthesis by increasing the mRNA level of the CAM parent enzyme PEP-decarboxylase. This phenomenon is observed when salt stress is exposed (McElwain et al., 1992 Plant Physiol. 99, 1261-1264). The CBF / DREB1 gene is induced at low temperatures and responds to cold stress, which is increased by low R / FR in Arabidopsis (Franklin and Whitelam, 2007, Nat. Genet. 39, 1410-1413).

Plants continue to face environmental stresses, including drought, high salt concentrations, and extreme temperatures. In particular, salt stress is a major factor limiting plant growth and crop production (Allakhverdiev et al., 2000 Plant Physiol. 123, 1047-1056). Approximately 7% of the world's land area, including agricultural areas, is affected by salt or sodium toxicity, and over 30% of irrigated plants such as rice are limited by salt stress (Schroeder et al., 2013 Nature 497, 60- 66). Excessive Na ⁺ in plant cells due to high salt conditions must be extruded or compartmentalized in the vacuole to mitigate Na ⁺ toxicity to the enzyme (Hasegawa et al., 2000 Annu. Rev. Plant Biol. 51, 463-499) . The inflow of Na ⁺ into the roots from the water tube prevents accumulation of Na ^{+ in} the ground. Plant HKT (high affinity K ⁺ transporter) transporter plays an essential role in reducing Na ⁺ transport to the ground and enhancing salt resistance (Deinlein et al., 2014 PLoS One 7, e45117). The HKT transporter of higher plants is divided into two main classes by phylogenetic analysis (Platten et al., 2006 Trends Plant Sci. 11, 372-374). Class I consists of Na ⁺ -selective transporter, and is present in both camphor plant species and dicotyledonous plant species. The Na ⁺ -K ⁺ cotransporter present in the cotyledon plant species belongs to class II (Deinlein et al., 2014 Trends Plant Sci. 19, 371-379). OsHKT1; 1 and OsHKT1; 3 belonging to Class I can only permeate Na ⁺ (Garciadeblas et al., 2003 Plant J. 34, 788-801). AtHKT1; 1 and its rice OSHKT1 ; 5 decrease Na ⁺ transport to the ground by releasing Na ⁺ from the ascending fluid and moving it to the descending tube (Berthomieu et al., 2003) -2014). OsHKT2; 1 is present in a variety of permeation modes, depending on the external Na ⁺ and K ⁺ concentrations, including Na ⁺ -K ⁺ , Na ⁺ , or transport inhibition (Horie et al., 2001 Plant J. 27, 138). Xenopus The heterologous expression of OsHKT2; 4 in laevis oocytes exhibits strong K ⁺ permeability without extracellular Na ⁺ stimulation, which is opposed to the general mechanism of other class II HKT transporters (Horie et al., 2011 Plant Physiol. 156, 1493 -1507). OsHAK21 promotes K ⁺ uptake and is resistant to salt stress by blocking high concentrations of Na ⁺ at the surface and at the root (Shen et al., 2015 Plant Cell Environ. 38, 2766-2779).

Many of the transcription factors promoted by external stimuli, including abiotic stress, induce them to tolerate poor environmental stress by modulating their target gene expression. Plant-specific NAC, MYB, bZIP and AP2 / ERF transcription factors are associated with regulatory mechanisms for salt stress tolerance. Previous studies have OsNAP (Chen et al., 2014 . Plant Cell Physiol. 55, 604-619), SNAC1 (Hu et al., 2006 Proc. Natl. Acad. Sci. USA 103, 12987-12992) and ONAC016 ( Sakuraba et al., 2015 Plant Cell Physiol. 56, 2325-2339) is induced by high salt stress and transgenic plants overexpressing these genes have a salt stress tolerance phenotype. DREBs / CBFs transcription factor family of OsDREB2A is induced by high salt stress, over-expression of OsDREB2A improves the resistance to dehydration, and salt stress (Dubouzet et al., 2003 Plant J. 33, 751-763). OsMYBc is a MYB coiled-coil transcription factor. Mutations in this gene show a susceptible phenotype to salt stress and attach directly to the OsHKT1; 1 promoter (Wang et al., 2015 Plant Physiol. 168, 1076-1090). The OsAP37 and OsAP59 transcription factors have the APETEL2 (AP2) domain, and their transcription levels are increased by exposure to drought and high salt status. Overexpression of OsAP37 and OsAP59 by the promoter OsCc1 increases tolerance to drought and salt stress during the nutrient-growth phase (Oh et al., 2009 Plant Physiol. 150, 1368-1379). OsbZIP23 is a member of the basic leucine zipper (bZIP) transcription factor family of rice and is derived from various stress derivatives such as salts, drought, abasic acid (ABA), polyethylene glycol (PEG), ABA- (Xiang et al., 2008 Plant Physiol. 148, 1938-1952).

In the meantime, Korean Patent No. 1669484 discloses' Purple / orange-colored phytochrome TpR0787 protein and its use 'derived from S-bacillus. However, as in the present invention,' OsPHYB gene derived from rice, which regulates salt stress tolerance of plants, Has never been disclosed.

The present invention has been made in view of the above needs, and it has been confirmed that the mutation of OsPHYB improves the salt stress tolerance. In order to reveal the mechanism of OsPHYB to regulate salt stress, Na ⁺ and K ⁺ RT-qPCR was performed on the salt stress-related genes including transcription factors and HKT transporter genes in the control and osphyB mutants. In the osphyB mutants, K ⁺ ion accumulation was higher in both the root and the root than in the control , And then Na ⁺ uptake decreased. Furthermore, the fact that the expression level of the HKT transporter gene was changed in the osphyB mutant revealed that OsPHYB maintains Na ⁺ / K ⁺ homeostasis under salt stress conditions and is associated with Na ⁺ and K ⁺ ion distribution. Accordingly, the present invention has been accomplished by confirming that it is possible to provide an effective method for controlling the salt tolerance of a plant through the regulation of OsPHYB gene expression in plants.

In order to accomplish the above object, the present invention provides a method for regulating expression of an OsPHYB gene by transforming a plant cell with a recombinant vector comprising a gene encoding a rice-derived OsPHYB protein comprising the amino acid sequence of SEQ ID NO: 2 A method for controlling the salt stress tolerance of a plant is provided.

The present invention also provides a method for producing a transgenic plant in which the salt stress tolerance is regulated by the above method.

In addition, the present invention provides a transgenic plant having the salt stress tolerance regulated by the above method.

In addition, the present invention provides a transformed seed of a plant in which the salt stress tolerance is regulated.

In addition, the present invention provides a composition for controlling a salt stress tolerance of a plant comprising the gene encoding the OsPHYB protein derived from rice comprising the amino acid sequence of SEQ ID NO: 2 as an active ingredient.

In the present invention, it has been found that the mutation of OsPHYB improves the salt stress tolerance, and the use of the OsPHYB gene, which is effective in regulating the salt tolerance of plants through regulation of OsPHYB gene expression in plants, is newly revealed . Therefore, the use of OsPHYB gene could be useful for genetically modified (GM) crops such as transgenic plants and biofuel crops, which are resistant to environmental stresses suitable for the disadvantaged areas.

FIG. 1 shows the results of confirming an increase in salt stress resistance of the osphyB mutant. (AD) seedlings grown for 3 weeks, treated with 200 mM NaCl for 10 days, and then restored for 10 days in water. Control and osphyB-2 OsPhyB level of expression of the mutant (E), survival rate (F), fresh weight (G), ion leakage (H), the total chlorophyll content (I), chlorophyll a / b ratio (J), the total carotenoid Content (K), DAB and NBT analysis (L) for analyzing hydrogen peroxide and superoxide anion radical, respectively. Survival was measured after recovery. The fresh weight was measured 7 days after treatment with NaCl. Ion leakage, total chlorophyll content, and carotenoid were analyzed before recovery. Photographs of the plants represent 7 independent experiments (n = 30-50), and all experiments were repeated over 10 individuals. Student t - test was used for statistical analysis (** P <0.01, *** P <0.001).
FIG. 2 shows the results of comparing the phenotype of osphyB-1 and osphyB-2 under salt stress conditions. Time-dependent phenotypes of osphyB-1 ( AE) and osphyB-2 ( FJ) compared to the control. All plants were grown for 60 days under general packaging conditions, then transplanted into pots and treated with 200 mM NaCl. All of the phenotypes presented represent 3 repeats. DAS, days after sowing. DAT, days after processing.
Fig. 3 shows the expression pattern of OsPhyB changed by NaCl treatment. Expression levels of OsPHYB transcript in whole tissues of control under salt conditions (A). Samples were collected from seedlings grown at 3 weeks in paddy soil (0 DT) and seedlings grown at 7 DT after 200 mM NaCl treatment for 7 days. Sample Segmentation Scheme in Rice Seedlings (B). Relative OsPHYB expression level (C) of each segmented fraction. In the above experiment, experiments on at least 5 individuals were repeated 3 times independently. All gene expression levels were measured by RT-qPCR and normalized by ubiquitin 5 ( UBQ5 ). The mean value of expression levels was statistically analyzed by Student's t -test (*** P <0.001).
Figure 4 shows Na ⁺ and K ⁺ homeostasis of osphyB mutants under salt stress conditions. Analysis of Na ⁺ and K ⁺ ion contents in surface (AC) and root tissue (DF). For the ion determination, 50 seedlings cultivated by hydroponics were sampled before and 4 days after NaCl treatment, respectively. The ion content was normalized by dry weight (DW). The experiment was repeated three or more times independently. All values were statistically analyzed by Student's t -test (** P <0.01, *** P <0.001).
Figure 5 osphyB Mutants show low Na ⁺ uptake and high K ⁺ uptake under salt conditions. Na ⁺ net uptake (A) and K ⁺ net uptake (B) of the control and osphyB -2 mutants. The seedlings grown for 2 weeks were treated with NaCl solution for 4 days (n = 50). All data were obtained from more than 3 independent experiments. The asterisk indicates a significant difference by Student's t -test (*** P <0.001). DW _root means dry weight of _root .
FIG. 6 is a graph showing the change of osphyB Transcript analysis of the mutant is shown. The ratio of expression levels of genes known to be involved in, or likely to be involved in, salt stress at 0, 12, 24 hours after salt treatment ( osphyB mutant versus control). The ratio of expression of osphyB- 2 relative to the control was calculated after measuring the relative expression ratios of the related genes through RT-qPCR. Samples were obtained at the top of seedlings treated with 120 mM NaCl and seedlings treated (n = 5). These experiments were repeated three or more times.

According to an aspect of the invention, the invention is by transforming the plant cell with a recombinant vector containing the gene encoding the OsPHYB (Oryza sativa phytochrome B) of rice-derived proteins comprising the amino acid sequence of SEQ ID NO: 2 in OsPHYB gene A method for regulating salt stress tolerance of a plant, comprising the step of regulating expression of the plant.

The method according to one embodiment of the present invention is characterized by inhibiting the expression of the OsPHYB gene to increase the salt stress tolerance of the plant, but is not limited thereto. The method of inhibiting the expression of the OsPHYB gene can be performed through, for example, T-DNA knockout, but is not limited thereto.

In the method according to one embodiment of the present invention, the OsPHYB gene may preferably consist of the nucleotide sequence of SEQ ID NO: 1. In addition, homologues of the nucleotide sequences are included within the scope of the present invention. Specifically, the gene has a nucleotide sequence having a sequence homology of 70% or more, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more, with the nucleotide sequence of SEQ ID NO: 1 . &Quot;% of sequence homology to polynucleotides " is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the &lt; / RTI &gt;

The term " recombinant " refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been modified and reintroduced intracellularly by an artificial means.

In the present invention, the OsPHYB gene sequence can be inserted into a recombinant expression vector. The term " recombinant expression vector " means a bacterial plasmid, a phage, a yeast plasmid, a plant cell virus, a mammalian cell virus, or other vector. In principle, any plasmid and vector can be used if it can replicate and stabilize within the host. An important characteristic of the expression vector is that it has a replication origin, a promoter, a marker gene and a translation control element.

Expression vectors containing OsPHYB gene sequences and appropriate transcription / translation control signals can be constructed by methods known to those skilled in the art. Such methods include in vitro recombinant DNA technology, DNA synthesis techniques, and in vivo recombination techniques. The DNA sequence can be effectively linked to appropriate promoters in the expression vector to drive mRNA synthesis. The expression vector may also include a ribosome binding site and a transcription terminator as a translation initiation site.

A preferred example of the recombinant vector of the present invention is a Ti-plasmid vector capable of transferring a so-called T-region to a plant cell when present in a suitable host, such as Agrobacterium tumefaciens. Other types of Ti-plasmid vectors (see EP 0 116 718 B1) are currently used to transfer hybrid DNA sequences to plant cells or protoplasts in which new plants capable of properly inserting hybrid DNA into the plant's genome can be produced have. A particularly preferred form of the Ti-plasmid vector is a so-called binary vector as claimed in EP 0 120 516 B1 and U.S. Patent No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into the plant host include viral vectors such as those that can be derived from double-stranded plant viruses (e. G., CaMV) and single- For example, from non -complete plant virus vectors. The use of such vectors may be particularly advantageous when it is difficult to transform the plant host properly.

The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, antibiotics such as kanamycin, G418, Bleomycin, hygromycin, chloramphenicol, Resistant gene, aadA gene, and the like, but are not limited thereto.

In the recombinant vector of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS, histone promoter, Clp promoter, but is not limited thereto. The term " promoter " refers to the region of DNA upstream from the structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A " plant promoter " is a promoter capable of initiating transcription in plant cells. A " constitutive promoter " is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constructive promoters may be preferred in the present invention because the choice of transformants can be made by various tissues at various stages. Thus, constitutive promoters do not limit selectivity.

In the recombinant vector of the present invention, conventional terminators can be used. Examples thereof include nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens (Agrobacterium tumefaciens ) Terminator of the Octopine gene, and the rrnB1 / B2 terminator of E. coli, but the present invention is not limited thereto. Regarding the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of a terminator is highly desirable in the context of the present invention.

The method of delivering the vector of the present invention into a host cell can be carried out by introducing the vector into a host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment, Can be injected.

The present invention also provides a method for producing a recombinant vector comprising the steps of: transforming a plant cell with a recombinant vector comprising a gene encoding a rice-derived OsPHYB protein comprising the amino acid sequence of SEQ ID NO: 2; And regenerating the plant from the transformed plant cell. The present invention also provides a method for producing a transgenic plant having regulated salt stress tolerance.

The method according to one embodiment of the present invention is characterized by inhibiting the expression of the OsPHYB gene to increase the salt stress tolerance of the plant, but is not limited thereto. Preferably, the OsPHYB gene may comprise the nucleotide sequence of SEQ ID NO: 1.

The method of the present invention comprises transforming a plant cell with a recombinant vector according to the invention, said transformation being mediated, for example, by Agrobacterium tumefaciens. In addition, the method of the present invention comprises regenerating a transgenic plant from the transformed plant cell. Any of the methods known in the art can be used for regeneration of transgenic plants from transgenic plant cells.

Transformed plant cells must be regenerated into whole plants. Techniques for the regeneration of mature plants from callus or protoplast cultures are well known in the art for a number of different species (Handbook of Plant Cell Culture, Vol. 1-5, 1983-1989, Momillan, N. Y.).

In addition, the present invention provides a transgenic plant having resistance to salt stress produced by the above method and a transformed seed thereof.

Preferably, the transgenic plants and their transformed seeds are transgenic plants with increased resistance to salt stress and their transformed seeds.

Preferably, the plant is selected from the group consisting of Arabidopsis thaliana, eggplant, tobacco, red pepper, tomato, burdock, chinese broad bean, lettuce, bellflower, spinach, modern sweet potato, celery, carrot, parsley, parsley, cabbage, It may be a dicotyledonous plant such as cucumber, squash, poultry, strawberry, soybean, mung bean, kidney bean or pea or a monocotyledon such as rice, barley, wheat, rye, maize, sorghum, oat, onion, . The plant may be, but is not limited to, rice ( Oryza sativa ).

In addition, the present invention provides a composition for controlling the salt stress tolerance of a plant, which comprises a gene encoding the OsPHYB protein derived from rice comprising the amino acid sequence of SEQ ID NO: 2. The composition comprises a gene encoding an OsPHYB protein derived from rice comprising the amino acid sequence of SEQ ID NO: 2 as an active ingredient, and the salt stress tolerance of the plant is regulated by transforming the gene into a plant to inhibit the expression of the gene Preferably, increased).

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Materials and methods

1. Target plants and growth conditions

"Dongjinbil" and osphyB-1 and osphyB-2 mutants were grown in packaging and greenhouses located in Suwon, South Korea at 37 degrees latitude, and in growth chambers located in 37 degrees latitude Seoul or Anseong, South Korea. T-DNA knockout osphyB-1 and osphyB-2 mutants were obtained from Kyunghee University's Crop Biotechnology Research Center (Jeon et al. 2000 Plant J. 22, 561-570). Genetic information of the two osphyB mutants has been previously reported (Jeon et al. 2007 Plant Cell Environ. 30, 590-599).

2. Physiological analysis of salt resistance

Three - week - old plants were treated with 200 mM NaCl to recover salt resistance. Plants were grown in a greenhouse for physiological analysis and photography such as survival rate and fresh weight. Survival rate was measured after recovery for 10 days, and fresh weight was measured after one week salt treatment. To determine salt resistance during germination, germination was carried out on MS medium with or without 150 mM NaCl. Prior to sowing in the medium, the peeled seeds were sterilized in 2% NaClO for 20 minutes and washed 4 times with distilled water. All plants were grown in a light condition (30 ° C) for 14 hours 30 minutes and in a dark condition (24 ° C) for 9 hours 30 minutes.

3. Photosynthetic pigment content analysis

The photosynthetic pigment content was measured prior to recovery of salted seedlings for 10 days. To analyze total chlorophyll and carnenoid contents, photosynthetic pigments were extracted from each leaf using 80% acetone. Photosynthetic pigment content was measured with a UV / VIS spectrophotometer using the method used in previous reports (Lichtenthaler, 1987 Methods Enzymol. 148, 350-382).

4. Ion leakage analysis

Samples used for ion leakage analysis were seeded with salt for 10 days and membrane leakage was analyzed by measuring the electrolyte (or ion) of the leaves isolated from the plant. Membrane leakage was measured by placing 5 leaf pieces separated from rice in 0.4 mM mannitol solution and reacting for 3 hours while stirring at room temperature. The first conductivity was measured using a conductivity meter (CON6 METER, LaMOTTE, USA). The second measurement was performed after each sample was boiled for 20 minutes. The ratio of ion leakage was analyzed by comparing the total conductivity and the post-treatment conductivity as a percentage in each sample. This experiment was previously performed and reported (Fan et al., 1997 Plant Cell 9, 2183-2196).

5. Histochemical analysis of reactive oxygen species

Systematic detection of hydrogen peroxide (H ₂ O ₂ ) and excess oxide anion radicals (O ₂ ^- ) was performed using previously reported methods (Han et al., 2012 Mol. Cells 33, 87-97). 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium chloride (NBT) were used for the detection of hydrogen peroxide and excess oxide anion radical, respectively. The leaf treated for 10 days was mixed with DAB and NBT at room temperature and stirred. The chlorophyll was removed by boiling with 95% ethanol treatment.

6. Measurement of Na ⁺ and K ⁺ content

Two-week-old plants with hydroponic cultivation were treated with 120 mM NaCl in a chamber (14 h 30 min light condition; 30 ° C / 9 hr 30 min dark condition; 24 ° C) for 4 days. The root and root of the plant were cut with a razor and the Na ⁺ and K ⁺ contents were measured by the previously reported method (Shen et al., 2015 Plant Cell Environ. 38, 2766-2779). To summarize, the samples were rinsed with water and dried at 80 ° C for 2 days. The dried samples were then weighed, treated with nitric acid at 90 ° C and then diluted with distilled water. Ion concentration was measured by an inductively coupled plasma spectrometer (ICP-OES, iCAP 7400 Duo, Thermo Fisher Scientific, Massachusetts, USA). The ionic net uptake rate measurements were performed using previously reported calculations (Nieves-Cordones et al., 2010 Mol. Plant 3, 326-333).

7. RNA extraction and RT-qPCR analysis

RT-PCR and RT-qPCR assays were performed with some modification of previously reported methods (Kwon et al., 2015 Rice 8, 23). The total RNA of the plant tissue was extracted using a total RNA extraction kit (MM Med, Korea). First strand cDNA was synthesized from 2 μg RNA using M-MLV reverse transcriptase and oligo (dT) ₁₅ primer (Promega, WI, USA). The amount of transcript was measured using a gene-specific primer and standardized with Ubiquitin 5 (Ubq5) (AK061988) (Table 1). RT-qPCR analysis was performed with 2 μl cDNA, 2 μl 0.5 μM primer, and 10 μl 2X GoTaq qPCR Master Mix (Promega) in a total volume of 20 μl. The qPCR reaction was carried out using a LightCycler 480 machine (Roche). The reaction conditions were as follows: 94 ° C for 2 minutes, 94 ° C for 15 seconds, 60 ° C for 1 minute 40 cycles.

Gene Forward (5 '- &gt; 3') (SEQ ID NO: Reverse (5 '- &gt; 3') (SEQ ID NO: OsPHYB ATGGAACAGACACAATGCTT (3) AGCATACACCATATCAGCTT (4) OsAP37 TCCGATGTTTTGGTCCTCTG (5) TCCACGGTTTAGTCCATCTCATC (6) OsAP59 GGTGATTTAGCCATCTTGTGCG (7) TCGTCACATTTCTTGGAGCAG (8) OsDREB2A AGGGCAATGTATGGTCCCACAG (9) TGCTGATGTGCAGCCAGAGTTG (10) OsSalT TGGATTCTTTGGAAGGTCTGG (11) TTGACCACTGGGAATCAAGG (12) TRAB1 GGATGATCAAGAACAGGGAGT (13) TCAGCCTTCTGTTCCTTCAGT (14) OsbZIP23 GGAGCTGAACGATGAACTCCAG (15) TCGGCTCATTCTCTCTAGAACCTC (16) ZFP179 AGAGAAGAAGCGGAGAGCAAGG (17) TGCACGTCTTGCACTCGAACAC (18) ZFP252 CCCTTGCAAGCTCAAGAAACCC (19) GCCTCCTCCTCACTACTACTTCTC (20) OsLEA3 TTTCTGACGGGTGTGGGTGATG (21) AACACAGACGAGAAACTCTGACG (22) OsTCP19 TTTTCTCCGTTTTTGTTTGAGTTG (23) CATGAATATATGATGGGTCGAGGAA (24) OsMYBc CAAATGAGCTGCACGAACGA (25) GAGGGGTCAGTTCTTTCGGA (26) OsNAC5 CGCAAGCTCTCCAAGTCCT (27) GTCCACCGTGTCGTACCTCT (28) OsNAC6 AGAAGAACAGCCTCAGGTTGGATG (29) AGCCCGCCCTTCTTGTTGTAAATC (30) OsNAC10 GCTTGAAGACATCCATGACAA (31) AGTCGATGGTGTTGAGGAGAT (32) ONAC106 CGTGGCAACACACGAGTC (33) CGTGATGGTGAGCTGATGAC (34) SNAC1 GCCAAGAAGGGATCTCTCAGGTTG (35) TCTTCTTGTTGTACAGCCGACAC (36) OsNAP AGTTCCGCAACACCTCCA (37) CTGCTCGTGGTCGGAGAG (38) OsHKT1; 1 TTCACCACTCTTGCGGCTATG (39) TGTTTGTAGCCAGTCTCCCCAG (40) OsHKT1; 3 ATGTAGAGCCCAAGACGATT (41) CCAACTGAGGAGATGGCTGT (42) OsHKT2; 1 CACAGTCTCCTCGTTTGCGAA (43) GCAAGAATCTGGCCGATGAA (44) OsHKT2; 3 GCCCAGAAAGCGACGATAGA (45) AACCCAATGTTCCCGTAGGC (46) OsHKT2; 4 ACTGCTCCCTATGTTTCTGA (47) ATCCCAGTTCAAGCAGCAGA (48) OsHAK21 GGTGGGACATTTGCACTCTACTC (49) ATGGCTTCCCGCTACTGCT (50)

Example 1. OsPHYB  Genetic mutations increase salt resistance in rice.

To confirm the salt tolerance of the osphyB mutants, the control and osphyB-2 (hereinafter osphyB ) mutants were grown in the same pot for 3 weeks (Fig. IA). The grown plants were treated with 200 mM NaCl for 7 and 10 days (FIG. 1B and FIG. 1C) and then cultured in distilled water for 10 days (FIG. 1D). The above experiment showed that the osphyB mutant had higher resistance to salt than the control. Through RT-qPCR analysis of the leaf sample of Figure 1A (before salt treatment), it was confirmed that the OsPHYB gene was not expressed at the RNA level in the osphyB mutant (Fig. 1E). The osphyB mutants had a higher survival rate, higher live weight and lower ion leakage rate than the control (Fig. 1F-H), suggesting that the osphyB mutant is more resistant to salt than the control. Moreover, the osphyB mutants had higher total chlorophyll content, chlorophyll a / b ratio, and total carotenoid content than the control, suggesting that the osphyB mutants are less sensitive to salt stress than the control (FIG. 1I-K). Furthermore, we found that under salt stress conditions, active oxygen (hydrogen peroxide and excess oxide anion groups) accumulated in the leaves of the control compared to the osphyB mutants (Fig. 1L). To reaffirm the salt resistance of the osphyB mutant, we treated the NaCl solution to the osphyB-1 and osphyB-2 mutants grown in the two-month-old paddy field. As expected, the osphyB-1 and osphyB-2 mutants showed a salt stress resistant phenotype compared to the control (Figure 2). From these results, we conclude that the osphyB mutant has a higher resistance to salt in soil conditions.

Example  2. Under salt conditions OsPHYB  Expression pattern

We measured the expression pattern of OsPHYB gene in the wild type, using RT-qPCR analysis technique, under salt conditions. The amount of RNA expression of the OsPHYB gene was increased in the salt condition than in the normal condition (Fig. 3A). To further investigate the expression profile of the OsPHYB gene, rice seedlings were divided into leaf (U), stem (M), and root (L) to determine the amount of OsPHYB RNA expression in each of them . Prior to salt stress, the amount of OsPHYB RNA expression was higher in leaves than in other parts, whereas the amount of OsPHYB RNA expression in leaves was significantly decreased after one week of salt treatment. However, the amount of mRNA expression of OsPHYB gene in stem and root was increased in salt treatment as opposed to leaf spot . In particular, the amount of OsPHYB gene expression in roots increased three-fold in the salt treatment (Fig. 3C). These results indicate that the amount of OsPHYB expression increases in response to salt stress.

Example  3. Salts Under the conditions osphyB  The sodium and potassium contents of the mutant Control and  different.

To investigate the mechanism of osphyB mutants showing salt resistance, we analyzed the concentrations of Na ⁺ and K ⁺ ions in the root and root tissues of control and osphyB mutants cultivated in 120 mM NaCl solution for 4 days. As a control experiment, Na ⁺ concentration was measured at the root and root of the control and osphyB mutants grown in distilled water. As a result, there was no difference between the top and root Na ⁺ concentrations of the osphyB mutants in the control. Under salt stress conditions, the Na ⁺ concentration in the osphyB mutant body tissue was lower than that in the control, and the Na ⁺ concentration in the root tissue was similar to that of the control (Figs. 4A and 4D). On the other hand, K ⁺ concentration in the root and root tissues of the osphyB mutants was higher than in the control (Fig. 4B and 4E). Since it is important for plant cells to maintain Na ⁺ / K ⁺ homeostasis in order to be resistant to salt stress, we have calculated the Na ⁺ / K ⁺ ratio in the top and root tissues of the control and osphyB mutants. Na ⁺ / K ⁺ ratios in the osphyB mutant body surface tissues were lower in both the control and salt treatment experiments than the control. However, the Na ⁺ / K ⁺ ratio in the osphyB mutant root tissue was lower in the salt stress condition than in the control (Fig. 4C and 4F). To investigate whether mutations in the OsPHYB gene affect Na ⁺ and K ⁺ uptake, we compared the net absorption rates of ions during salt stress treatment. As shown in FIG. 5A, the net absorption rate of Na.sup. ⁺ Ions in the osphyB mutants was lower than that of the control under salt conditions. In contrast, osphyB mutants under salt conditions were found to have a higher net K ⁺ ion uptake rate than the control. However, the net K ⁺ ion uptake rates in the control and osphyB mutants were negative. These results indicate that the OsPHYB gene plays a role in Na ⁺ and K ⁺ uptake and distribution under salt conditions.

Example  4. OsPHYB  The mutation of the gene Under the conditions  Salt stress related genes and salt stress related Vehicle  Changes the expression of genes.

To identify the genes regulated by the OsPHYB gene and to investigate the molecular mechanism of the salt resistance of the osphyB mutants, we used the RT-qPCR assay to measure the expression profiles of the 21 selected genes under salt stress conditions saw. The selected 21 genes were divided into three groups based on their respective functional roles: (i) genes involved in salt stress, (ii) NAC transcription factors, (iii) high affinity for potassium Genes for the Potassium Transporter.

Samples for expression profile analysis were obtained from each of the control and osphyB mutants that were grown under the same growth conditions. As shown in FIG. 6, OsAP37 , OsAP59 , OsDREB2A , TRAB1 , OsbZIP23, OsTCP19 , and OsMYBc , genes encoding transcription factors involved in salt stress, were increased in osphyB mutants (Dubouzet et al., 2003 Plant J. 33,751-763). RNA expression levels of ZEP252 (Xu et al., 2008 FEBS Lett. 582, 1037-1043), a gene encoding zinc finger proteins involved in salt resistance, were also increased in osphyB mutants. The late genes in response to ABA OsLEA3 (Duan and Cai 2012 PLoS One 7, e45117) and OsSalT to increase the amount of expression is involved in resistance to salt by ABA (Claes et al., 1990 Plant Cell 2, 19-27) genes The expression level of osphyB mutant was increased. The expression levels of OsNAC106, SNAC1 , and OsNAP, also known as NAC transcription factors in response to abiotic stress, were also increased in osphyB mutants. There was no change in expression of ZEP179, OsNAC5, OsNAC6 , and OsNAC10 under salt stress conditions. HKT transporters play an important role in inducing plant resistance to salt stress by reducing Na ⁺ ion accumulation at the surface. As a result of RT-qPCR analysis, the expression levels of five HKT transporters ( OsHKT1; 1, OsHKT1; 3, OsHKT2: 3, OsHKT2: 4, OsHAK21 ) were increased in osphyB mutants. Taken together, these results indicate that the functional deficiency of phyB in rice increases the expression of the stress-related genes including transcription factors and also maintains Na ⁺ / K ⁺ homeostasis by increasing the expression of genes encoding HKT transporter It means to contribute.

<110> Seoul National University R & DB Foundation <120> OsPHYB gene from Oryza sativa for regulating salt stress          resistance of plant and uses thereof <130> PN17308 <160> 50 <170> Kopatentin 2.0 <210> 1 <211> 3516 <212> DNA <213> Oryza sativa <400> 1 atggcctcgg gtagccgcgc cacgcccacg cgctccccct cctccgcgcg gcccgcggcg 60 ccgcggcacc agcaccacca ctcgcagtcc tcgggcggga gcacgtcccg cgcgggaggg 120 ggtggcgggg gcgggggagg gggagggggc ggcgcggccg ccgcggagtc ggtgtccaag 180 gccgtggcgc agtacaccct ggacgcgcgc ctccacgccg tgttcgagca gtcgggcgcg 240 tcgggccgca gcttcgacta cacgcagtcg ctgcgtgcgt cgcccacccc gtcctccgag 300 cagcagatcg ccgcctacct ctcccgcatc cagcgcggcg ggcacataca gcccttcggc 360 tgcacgctcg ccgtcgccga cgactcctcc ttccgcctcc tcgcctactc cgagaacacc 420 gccgacctgc tcgacctgtc gccccaccac tccgtcccct cgctcgactc ctccgcggtg 480 cctccccccg tctcgctcgg cgcagacgcg cgcctccttt tcgccccctc gtccgccgtc 540 ctcctcgagc gcgccttcgc cgcgcgcgag atctcgctgc tcaacccgct ctggatccac 600 tccagggtct cctctaaacc cttctacgcc atcctccacc gcatcgatgt cggcgtcgtc 660 atcgacctcg agcccgcccg caccgaggat cctgcactct ccatcgctgg cgcagtccag 720 tctcagaagc tcgcggtccg tgccatctcc cgcctccagg cgcttcccgg cggtgacgtc 780 aagctccttt gcgacaccgt tgttgagtat gttagagagc tcacaggtta tgaccgcgtt 840 atggtgtaca ggttccatga ggatgagcat ggagaagtcg ttgccgagag ccggcgcaat 900 aaccttgagc cctacatcgg gttgcattat cctgctacag atatcccaca ggcatcacgc 960 ttcctgttcc ggcagaaccg tgtgcggatg attgctgatt gccatgctgc gccggtgagg 1020 gtcatccagg atcctgcact aacacagccg ctgtgcttgg ttgggtccac gctgcgttcg 1080 ccgcatggtt gccatgcgca gtatatggcg aacatgggtt ccattgcatc tcttgttatg 1140 gcagtgatca ttagtagtgg tggggatgat gatcataaca tttcacgggg cagcatcccg 1200 tcggcgatga agttgtgggg gttggtagta tgccaccaca catctccacg gtgcatccct 1260 ttcccactac ggtatgcatg cgagttcctc atgcaagcct ttgggttgca gctcaacatg 1320 gagttgcagc ttgcacacca actgtcagag aaacacattc tgcggacgca gacactgctg 1380 tgtgatatgc tactccggga ttcaccaact ggcattgtca cacaaagccc cagcatcatg 1440 gaccttgtga agtgtgatgg tgctgctctg tattaccatg ggaagtacta ccctcttggt 1500 gtcactccca cagaagttca gattaaggac atcatcgagt ggttgactat gtgccatgga 1560 gactccacag ggctcagcac agatagcctt gctgatgcag gctaccctgg tgctgctgca 1620 ctaggagatg cagtgagtgg aatggcggta gcatatatca cgccaagtga ttatttgttt 1680 tggttccggt cacacacagc taaggagata aagtggggtg gtgcaaagca tcatccagag 1740 gataaggatg atggacaacg aatgcatcca cgatcatcgt tcaaggcatt tcttgaagtt 1800 gtgaagagta ggagcttacc atgggagaat gcggagatgg atgcaataca ttccttgcag 1860 ctcatattgc gggactcttt cagagattct gcagagggca caagtaactc aaaagccata 1920 gtgaatggcc aggttcagct tggggagcta gaattacggg gaatagatga gcttagctcg 1980 gtagcaaggg agatggttcg gttgatcgag acagcaacag tacccatctt tgcagtagat 2040 actgatggat gtataaatgg ttggaatgca aaggttgctg agctgacagg cctctctgtt 2100 gaggaagcaa tgggcaaatc attggtaaat gatctcatct tcaaggaatc tgaggaaaca 2160 gtaaacaagc tactctcacg agctttaaga ggtgatgaag acaaaaatgt agagataaag 2220 ttgaagacat tcgggccaga acaatctaaa ggaccaatat tcgttattgt gaatgcttgt 2280 tctagcaggg attacactaa aaatattgtt ggtgtttgtt ttgttggcca agatgtcaca 2340 ggacaaaagg tggtcatgga taaatttatc aacatacaag gggattacaa ggctatcgta 2400 cacaacccta atcctctcat acccccaata tttgcttcag atgagaatac ttgttgttcg 2460 gagtggaaca cagcaatgga aaaactcaca ggatggtcaa gaggggaagt tgttggtaag 2520 cttctggtcg gtgaggtctt tggtaattgt tgtcgactca agggcccaga tgcattaacg 2580 aaattcatga ttgtcctaca caacgctata ggaggacagg attgtgaaaa gttccccttt 2640 tcattttttg acaagaatgg gaaatacgtg caggccttat tgactgcaaa cacgaggagc 2700 agaatggatg gtgaggccat aggagccttc tgtttcttgc agattgcaag tcctgaatta 2760 cagcaagcct ttgagattca gagacaccat gaaaagaagt gttatgcaag gatgaaggaa 2820 ttggcttaca tttaccagga aataaagaat cctctcaacg gtatccgatt tacaaactcg 2880 ttattggaga tgactgatct aaaggatgac cagaggcagt ttcttgaaac cagcactgct 2940 tgtgagaaac agatgtccaa aattgttaag gatgctagcc tccaaagtat tgaggatggc 3000 tctttggtgc ttgagaaagg tgaattttca ctaggtagtg ttatgaatgc tgttgtcagc 3060 caagtgatga tacagttgag agaaagagat ttacaactta ttcgagatat ccctgatgaa 3120 attaaagaag cctcagcata tggtgaccaa tatagaattc aacaagtttt atgtgacttt 3180 ttgctaagca tggtgaggtt tgctccagct gaaaatggct gggtggagat acaggtcaga 3240 ccaaatataa aacaaaattc tgatggaaca gacacaatgc ttttcctctt caggtttgcc 3300 tgtcctggcg aaggccttcc cccagagatt gttcaagaca tgtttagtaa ctcccgctgg 3360 acaacccaag agggtattgg cctaagcata tgcaggaaga tcctaaaatt gatgggtggc 3420 gaggtccaat atataaggga gtcggagcgg agtttcttcc atatcgtact tgagctgccc 3480 cagcctcagc aagcagcaag tagggggaca agctga 3516 <210> 2 <211> 1171 <212> PRT <213> Oryza sativa <400> 2 Met Ala Ser Gly Ser Arg Ala Thr Pro Thr Arg Ser Ser Ser Ser Ala   1 5 10 15 Arg Pro Ala Ala Pro Arg His Gln His His His Ser Gln Ser Ser Gly              20 25 30 Gly Ser Thr Ser Arg Ala Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly          35 40 45 Gly Gly Gly Ala Ala Ala Glu Ser Val Ser Lys Ala Val Ala Gln      50 55 60 Tyr Thr Leu Asp Ala Arg Leu His Ala Val Phe Glu Gln Ser Gly Ala  65 70 75 80 Ser Gly Arg Ser Phe Asp Tyr Thr Gln Ser Leu Arg Ala Ser Pro Thr                  85 90 95 Pro Ser Ser Glu Gln Gln Ile Ala Ala Tyr Leu Ser Arg Ile Gln Arg             100 105 110 Gly Gly His Ile Gln Pro Phe Gly Cys Thr Leu Ala Val Ala Asp Asp         115 120 125 Ser Ser Phe Arg Leu Leu Ala Tyr Ser Glu Asn Thr Ala Asp Leu Leu     130 135 140 Asp Leu Ser Pro His His Ser Val Ser Ser Leu Asp Ser Ser Ala Val 145 150 155 160 Pro Pro Pro Val Ser Leu Gly Ala Asp Ala Arg Leu Leu Phe Ala Pro                 165 170 175 Ser Ser Ala Val Leu Leu Glu Arg Ala Phe Ala Ala Arg Glu Ile Ser             180 185 190 Leu Leu Asn Pro Leu Trp Ile His Ser Arg Val Ser Ser Lys Pro Phe         195 200 205 Tyr Ala Ile Leu His Arg Ile Asp Val Gly Val Val Ile Asp Leu Glu     210 215 220 Pro Ala Arg Thr Glu Asp Pro Ala Leu Ser Ile Ala Gly Ala Val Gln 225 230 235 240 Ser Gln Lys Leu Ala Val Arg Ala Ile Ser Arg Leu Gln Ala Leu Pro                 245 250 255 Gly Gly Asp Val Lys Leu Leu Cys Asp Thr Val Val Glu Tyr Val Arg             260 265 270 Glu Leu Thr Gly Tyr Asp Arg Val Met Val Tyr Arg Phe His Glu Asp         275 280 285 Glu His Gly Glu Val Val Ala Glu Ser Arg Arg Asn Leu Glu Pro     290 295 300 Tyr Ile Gly Leu His Tyr Pro Ala Thr Asp Ile Pro Gln Ala Ser Arg 305 310 315 320 Phe Leu Phe Arg Gln Asn Arg Val Met Met Ile Ala Asp Cys His Ala                 325 330 335 Ala Pro Val Arg Ile Gln Asp Pro Ala Leu Thr Gln Pro Leu Cys             340 345 350 Leu Val Gly Ser Thr Leu Arg Ser Pro His Gly Cys His Ala Gln Tyr         355 360 365 Met Ala Asn Met Gly Ser Ile Ala Ser Leu Val Met Ala Val Ile Ile     370 375 380 Ser Ser Gly Gly Asp Asp Asp His Asn Ile Ser Arg Gly Ser Ile Pro 385 390 395 400 Ser Ala Met Lys Leu Trp Gly Leu Val Val Cys His His Thr Ser Pro                 405 410 415 Arg Cys Ile Pro Phe Pro Leu Arg Tyr Ala Cys Glu Phe Leu Met Gln             420 425 430 Ala Phe Gly Leu Gln Leu Asn Met Glu Leu Gln Leu Ala His Gln Leu         435 440 445 Ser Glu Lys His Ile Leu Arg Thr Gln Thr Leu Leu Cys Asp Met Leu     450 455 460 Leu Arg Asp Ser Pro Thr Gly Ile Val Thr Gln Ser Pro Ser Ile Met 465 470 475 480 Asp Leu Val Lys Cys Asp Gly Ala Leu Tyr Tyr His Gly Lys Tyr                 485 490 495 Tyr Pro Leu Gly Val Thr Pro Thr Glu Val Gln Ile Lys Asp Ile Ile             500 505 510 Glu Trp Leu Thr Met Cys His Gly Asp Ser Thr Gly Leu Ser Thr Asp         515 520 525 Ser Leu Ala Asp Ala Gly Tyr Pro Gly Ala Ala Ala Leu Gly Asp Ala     530 535 540 Val Ser Gly Met Ala Val Ala Tyr Ile Thr Pro Ser Asp Tyr Leu Phe 545 550 555 560 Trp Phe Arg Ser His Thr Ala Lys Glu Ile Lys Trp Gly Gly Ala Lys                 565 570 575 His His Pro Glu Asp Lys Asp Asp Gly Gln Arg Met Met His Pro Arg Ser             580 585 590 Ser Phe Lys Ala Phe Leu Glu Val Val Lys Ser Arg Ser Leu Pro Trp         595 600 605 Glu Asn Ala Glu Met Asp Ala Ile His Ser Leu Gln Leu Ile Leu Arg     610 615 620 Asp Ser Phe Arg Asp Ser Ala Glu Gly Thr Ser Asn Ser Lys Ala Ile 625 630 635 640 Val Asn Gly Glu Val Glu Leu Gly Glu Leu Glu Leu Arg Gly Ile Asp                 645 650 655 Glu Leu Ser Ser Ala Arg Glu Met Val Arg Leu Ile Glu Thr Ala             660 665 670 Thr Val Ile Phe Ala Val Asp Thr Asp Gly Cys Ile Asn Gly Trp         675 680 685 Asn Ala Lys Val Ala Glu Leu Thr Gly Leu Ser Val Glu Glu Ala Met     690 695 700 Gly Lys Ser Leu Val Asn Asp Leu Ile Phe Lys Glu Ser Glu Glu Thr 705 710 715 720 Val Asn Lys Leu Leu Ser Arg Ala Leu Arg Gly Asp Glu Asp Lys Asn                 725 730 735 Val Glu Ile Lys Leu Lys Thr Phe Gly Pro Glu Gln Ser Lys Gly Pro             740 745 750 Ile Phe Val Ile Val Asn Ala Cys Ser Ser Arg Asp Tyr Thr Lys Asn         755 760 765 Ile Val Gly Val Cys Phe Val Gly Gln Asp Val Thr Gly Gln Lys Val     770 775 780 Val Met Asp Lys Phe Ile Asn Ile Gln Gly Asp Tyr Lys Ala Ile Val 785 790 795 800 His Asn Pro Asn Pro Leu Ile Pro Pro Ile Phe Ala Ser Asp Glu Asn                 805 810 815 Thr Cys Cys Ser Glu Trp Asn Thr Ala Met Glu Lys Leu Thr Gly Trp             820 825 830 Ser Arg Gly Glu Val Val Gly Lys Leu Leu Val Gly Glu Val Phe Gly         835 840 845 Asn Cys Cys Arg Leu Lys Gly Pro Asp Ala Leu Thr Lys Phe Met Ile     850 855 860 Val Leu His Asn Ala Ile Gly Gly Gln Asp Cys Glu Lys Phe Pro Phe 865 870 875 880 Ser Phe Phe Asp Lys Asn Gly Lys Tyr Val Gln Ala Leu Leu Thr Ala                 885 890 895 Asn Thr Arg Ser Arg Met Asp Gly Glu Ala Ile Gly Ala Phe Cys Phe             900 905 910 Leu Gln Ile Ala Ser Pro Glu Leu Gln Gln Ala Phe Glu Ile Gln Arg         915 920 925 His His Glu Lys Lys Cys Tyr Ala Arg Met Lys Glu Leu Ala Tyr Ile     930 935 940 Tyr Gln Glu Ile Lys Asn Pro Leu Asn Gly Ile Arg Phe Thr Asn Ser 945 950 955 960 Leu Leu Glu Met Thr Asp Leu Lys Asp Asp Gln Arg Gln Phe Leu Glu                 965 970 975 Thr Ser Thr Ala Cys Glu Lys Gln Met Ser Lys Ile Val Lys Asp Ala             980 985 990 Ser Leu Gln Ser Ile Glu Asp Gly Ser Leu Val Leu Glu Lys Gly Glu         995 1000 1005 Phe Ser Leu Gly Ser Val Met Asn Ala Val Val Ser Gln Val Met Ile    1010 1015 1020 Gln Leu Arg Glu Arg Asp Leu Gln Leu Ile Arg Asp Ile Pro Asp Glu 1025 1030 1035 1040 Ile Lys Glu Ala Ser Ala Tyr Gly Asp Gln Tyr Arg Ile Gln Gln Val                1045 1050 1055 Leu Cys Asp Phe Leu Leu Ser Met Val Arg Phe Ala Pro Ala Glu Asn            1060 1065 1070 Gly Trp Val Glu Ile Gln Val Arg Pro Asn Ile Lys Gln Asn Ser Asp        1075 1080 1085 Gly Thr Asp Thr Met Leu Phe Leu Phe Arg Phe Ala Cys Pro Gly Glu    1090 1095 1100 Gly Leu Pro Pro Glu Ile Val Gln Asp Met Phe Ser Asn Ser Arg Trp 1105 1110 1115 1120 Thr Gln Glu Gly Ile Gly Leu Ser Ile Cys Arg Lys Ile Leu Lys                1125 1130 1135 Leu Met Gly Gly Glu Val Gln Tyr Ile Arg Glu Ser Glu Arg Ser Phe            1140 1145 1150 Phe His Ile Val Leu Glu Leu Pro Gln Pro Gln Gln Ala Ala Ser Arg        1155 1160 1165 Gly Thr Ser    1170 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 atggaacaga cacaatgctt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 agcatacacc atatcagctt 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 tccgatgttt tggtcctctg 20 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 tccacggttt agtccatctc atc 23 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 ggtgatttag ccatcttgtg cg 22 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 tcgtcacatt tcttggagca g 21 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 agggcaatgt atggtcccac ag 22 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 tgctgatgtg cagccagagt tg 22 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 tggattcttt ggaaggtctg g 21 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 ttgaccactg ggaatcaagg 20 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 ggatgatcaa gaacagggag t 21 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 tcagccttct gttccttcag t 21 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 ggagctgaac gatgaactcc ag 22 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 tcggctcatt ctctctagaa cctc 24 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 agagaagaag cggagagcaa gg 22 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 tgcacgtctt gcactcgaac ac 22 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 cccttgcaag ctcaagaaac cc 22 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 gcctcctcct cactactact tctc 24 <210> 21 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 tttctgacgg gtgtgggtga tg 22 <210> 22 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 aacacagacg agaaactctg acg 23 <210> 23 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 ttttctccgt ttttgtttga gttg 24 <210> 24 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 catgaatata tgatgggtcg aggaa 25 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 caaatgagct gcacgaacga 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 gaggggtcag ttctttcgga 20 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 cgcaagctct ccaagtcct 19 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 gtccaccgtg tcgtacctct 20 <210> 29 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 agaagaacag cctcaggttg gatg 24 <210> 30 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 agcccgccct tcttgttgta aatc 24 <210> 31 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 gcttgaagac atccatgaca a 21 <210> 32 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 agtcgatggt gttgaggaga t 21 <210> 33 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 cgtggcaaca cacgagtc 18 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 cgtgatggtg agctgatgac 20 <210> 35 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 gccaagaagg gatctctcag gttg 24 <210> 36 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 tcttcttgtt gtacagccga cac 23 <210> 37 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 agttccgcaa cacctcca 18 <210> 38 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 ctgctcgtgg tcggagag 18 <210> 39 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 ttcaccactc ttgcggctat g 21 <210> 40 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 40 tgtttgtagc cagtctcccc ag 22 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 atgtagagcc caagacgatt 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 42 ccaactgagg agatggctgt 20 <210> 43 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 43 cacagtctcc tcgtttgcga a 21 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 44 gcaagaatct ggccgatgaa 20 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 45 gcccagaaag cgacgataga 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 46 aacccaatgt tcccgtaggc 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 47 actgctccct atgtttctga 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 48 atcccagttc aagcagcaga 20 <210> 49 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 49 ggtgggacat ttgcactcta ctc 23 <210> 50 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 50 atggcttccc gctactgct 19

Claims (6)

Comprising the step of transforming a plant cell with a recombinant vector comprising a gene encoding a rice-derived OsPHYB ( Oryza sativa phytochrome B) protein consisting of the amino acid sequence of SEQ ID NO: 2 to inhibit the expression of the OsPHYB gene. Methods of increasing tolerance. delete A step of transforming a plant cell with a recombinant vector comprising a gene encoding an OsPHYB protein derived from rice and comprising the amino acid sequence of SEQ ID NO: 2 to inhibit the expression of a gene encoding OsPHYB protein; And
And regenerating the plant from the transformed plant cell.  A transformed plant having increased salt stress tolerance produced by the method of claim 3. The transformed seed of a plant of claim 4 having increased salt stress tolerance. A composition for increasing the salt stress tolerance of a plant comprising the gene encoding the OsPHYB protein derived from rice comprising the amino acid sequence of SEQ ID NO: 2 as an active ingredient,
Wherein the expression of the gene encoding the OsPHYB protein is inhibited to thereby increase the salt stress of the plant.

Images