KR101911235B1 - Gene cassette for expression STF2 recombinant protein - Google Patents

Abstract

The present invention relates to a gene cassette for expression of a salmonella typhimurium flagellin fljB (STF2) recombinant protein. More specifically, the present invention relates to a gene cassette designed so that a foreign gene can be inserted into an N-terminal fragment and a C-terminal fragment of STF2 by being connected by a linker, an expression vector including the gene cassette, a host cell transformed with the expression vector, and a manufacturing method of an STF2 recombinant protein comprising a step of culturing the host cell. The gene cassette sequentially comprises an N-terminal fragment gene of the STF2 represented by sequence number 1, a gene encrypting the linker represented by sequence number 3, a cloning site for inserting the foreign gene, the gene encrypting the linker represented by sequence number 3 and a C-terminal fragment gene of the STF2 represented by sequence number 2.

Description

Gene cassette for expression STF2 recombinant protein < RTI ID = 0.0 >

The present invention relates to a gene cassette for expressing STF2 (Salmonella typhimurium flagellin fljB) recombinant protein, and more particularly, to a STF2 recombinant protein designed to be inserted into a N-terminal fragment and a C- A gene cassette for expression, an expression vector containing the gene cassette, a host cell transformed with the expression vector, and a method for culturing the host cell.

The vaccine is injected into the human body prior to the infection of the pathogen by inactivating the virus inactivated or attenuated pathogen, Refers to a medicament that is used to activate the immune system to prevent damage to the pathogen, even if the human body subsequently infects the pathogen, or to minimize the damage.

Vaccines include a variety of components, including the major antigen. A composition comprising an antigen may be used to stimulate immunity against an infection caused by a disease or exposure resulting from exposure to an organism comprising an antigen. Immunity to certain diseases In particular, the antigens used in the compositions to stimulate protective immunity mimic disease-causing organisms, and the source of antigens from such organisms is the source. The composition comprising the antigen may also include an adjuvant that increases the immune response to the antigen to maximize antibody production that neutralizes the relevant antigen in the disease-causing organism. To increase the immune response to the antigen, recombinant DNA techniques were used to generate fusion proteins including antigen and toll-like receptor agonists, particularly toll-like receptor 5 agonists, flagellin.

However, not all antigens are suitable for fusion proteins of the present form into plasmids. Accordingly, there is a need for a novel and improved design of a fusion protein comprising an antigen and a plasgel for use in an immune response to an antigen, particularly a method for stimulating a protective immune response.

On the other hand, among the plasmids, STF2 (Salmonella typhimurium flagellin fljB) acts as a ligand for TLR5 (Toll-like receptor 5) and is known to play an important role in the activation of adaptive immune response (Huleatt JW et al., Vaccine, 25, 763-775, 2007). Until now, fusion proteins including STF2 have been found to attach antigens to the N-terminal or C-terminal of proteins, but in this case, it is difficult to further express proteins that are functioning differently due to their structural characteristics in which both terminals are adjacent to each other.

Accordingly, the present inventors have made efforts to develop a gene cassette suitable for the production of a plasmalin recombinant protein capable of additionally expressing a protein capable of containing an antigen and carrying out other functions. As a result, it has been found that the foreign gene is an N-terminal fragment of STF2, A gene cassette for expression of STF2 recombinant protein designed to be inserted into a C-terminal fragment by being linked with a linker was constructed and the present invention was completed.

It is an object of the present invention to provide a gene cassette for expressing STF2 (Salmonella typhimurium flagellin fljB) recombinant protein containing a cloning site for foreign protein insertion.

It is still another object of the present invention to provide an expression vector containing the gene cassette for expression of the STF2 recombinant protein.

It is still another object of the present invention to provide a transformant obtained by transforming a host cell with the expression vector.

It is still another object of the present invention to provide a method for producing an STF2 recombinant protein comprising culturing a transformant.

In order to achieve the above object, the present invention provides a nucleic acid encoding an N-terminal fragment gene of STF2 (salmonella typhimurium flagellin fljB) represented by SEQ ID NO: 1, a gene encoding a linker, a cloning site for insertion of a foreign gene, Terminal fragment gene of STF2 represented by SEQ ID NO: 2 in sequence.

The present invention also provides an expression vector containing the gene cassette for expression of the STF2 recombinant protein.

The present invention also provides a transformant obtained by transforming a host cell with the expression vector.

In addition, the present invention provides a method for producing an STF2 recombinant protein comprising the step of culturing a transformant.

The present invention provides a gene cassette for expressing STF2 recombinant protein designed to be inserted into a N-terminal fragment and a C-terminal fragment of a STF2 linked by a linker, and 12 GnRH (gonadotropin -releasing hormone gene inserted into the STF2 N-terminal fragment and the C-terminal fragment so that 12 GnRH can be inserted into the STF2 N-terminal fragment and the C-terminal fragment to insert the STF2 recombinant protein. Therefore, the gene cassette can be used as an STF2 recombinant protein And can be usefully used for production.

Figure 1 shows an STF2 gene N-terminal fragment gene (SEQ ID NO: 1) and a STF2 gene C-terminal fragment gene (SEQ ID NO: 2) containing a linker gene (SEQ ID NO: 3) encoding a gly- gly- gly-ser linker (GGGS linker) (SEQ ID NO: 8) in which a foreign gene can be inserted between the STF2 gene cassette (SEQ ID NO: 8).
FIG. 2 shows electrophoresis images of C-terminal fragment gene product and N-terminal fragment gene product of STF2 gene amplified by PCR method, wherein M represents 100 bp DNA ladder and lane 1 represents C terminal fragment of amplified STF2 gene Lane 2 represents the N-terminal fragment gene product of the amplified STF2 gene.
FIG. 3 shows an electrophoresis image of a 1566 bp PCR product containing the STF2 gene cassette, wherein lane 1 represents a 1 Kb DNA ladder and lane 2 represents an STF2 gene cassette.
4 shows a STF2 recombinant gene (SEQ ID NO: 16) in which GnRH 12 copy gene is inserted by inserting 12 copies of a pig-derived gonadotropin-releasing hormone (GnRH) gene into a STF2 gene cassette into which a foreign gene can be inserted It is a degree.
FIG. 5 shows an electrophoresis image of an STF2 recombinant gene inserted with a GnRH 12 copy gene, wherein M represents a 100 bp DNA ladder and lane 1 represents an STF2 recombinant gene inserted with a GnRH 12 copy gene.
FIG. 6 shows the expression and purification of STF2 recombinant protein inserted with GnRH 12 copy gene using SDS-PAGE.
FIG. 7 is a graph showing antibody titer against GnRH. FIG.

Hereinafter, the present invention will be described in detail.

The present invention relates to an N-terminal fragment gene of STF2 (salmonella typhimurium flagellin fljB) represented by SEQ ID NO: 1, a gene encoding a linker, a gene coding for a foreign gene insertion, a gene encoding a linker, and a C A gene cassette for expression of an STF2 recombinant protein is provided, which comprises, in sequence, a terminal fragment gene.

In the present invention, the above-mentioned "STF2 (salmonella typhimurium flagellin fljB)" is a substance acting as a ligand of TLR5 and is known to affect the activity of the acquired immune response. Preferably, in the present invention, STF2 can be represented by the nucleotide sequence of SEQ ID NO: 21 and the amino acid sequence of SEQ ID NO: 22.

In addition, the N-terminal fragment gene of STF2 refers to a 705 bp N-terminal fragment gene of 13 bp to 717 bp of the STF2 gene, which can be represented by the nucleotide sequence of SEQ ID NO: 21. The STF2 N-terminal fragment gene may further include a gene encoding a linker at the 5'-end thereof, and may further include a gene encoding the target protein, and the gene encoding the target protein may be linked by a linker.

The C-terminal fragment gene of STF2 means a C-terminal fragment gene of C-terminal 795 bp which is 727 bp to 1521 bp of the STF2 gene, which can be represented by the nucleotide sequence of SEQ ID NO: 21. The STF2 C-terminal fragment gene may further comprise a gene encoding a linker at the 3 'end thereof, and may further include a gene encoding the target protein, and the gene encoding the target protein may be linked to a linker.

In the present invention, the term "linker" used herein refers to a protein having a structure that when a recombinant protein is produced by linking a STF2 N-terminal fragment and an STF2 C-terminal fragment with a foreign gene, Refers to a peptide that is inserted between a protein and a protein. The linker is not limited in its kind or the number of amino acids as long as it can minimize the immune response, but preferably 1 to 20 amino acids, more preferably 1 to 5 amino acids.

More specifically, the linker may be an amino acid sequence of glycine (Gly) -glycine (Gly) -glycine (glycine) -serine (Ser), and the gene encoding the linker may be the nucleotide sequence represented by SEQ ID NO: 3 But is not limited thereto.

In the present invention, the "foreign gene cloning site" means a nucleic acid sequence in which a restriction enzyme cleavage site is introduced so as to insert a foreign gene. The foreign gene insertion cloning site may include, but is not limited to, a BglII and XhoI cleavage site.

In the present invention, the gene cassette may be represented by the nucleotide sequence represented by SEQ ID NO: 8. In the case where the gene encoding the linker is further included at the 5 'end of the STF2 N-terminal fragment gene of the gene cassette, . ≪ / RTI >

In a specific example of the present invention, the inventors of the present invention constructed a STF2 gene N-terminal fragment gene (SEQ ID NO: 1) containing a linker gene encoding a gly-gly-gly-ser linker as shown in the schematic diagram of FIG. 1, A gene cassette for expressing STF2 recombinant protein (SEQ ID NO: 8) in which a foreign gene can be inserted between genes (SEQ ID NO: 2) was prepared.

The present invention also provides an expression vector comprising a gene encoding the STF2 recombinant protein.

The present invention also provides a transformant obtained by transforming a host cell with the expression vector.

In addition, the present invention provides a method for producing an STF2 recombinant protein, comprising culturing the transformant.

The process for producing the recombinant protein of the present invention by a recombinant method comprises the following steps.

First, an expression vector is prepared by inserting a gene encoding the recombinant protein into a vector.

By "vector" is meant a DNA construct containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA within the appropriate host. The vector may be a plasmid, phage particle or simply a potential genome insert. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. For the purpose of the present invention, it is preferable to use a plasmid vector. Typical plasmid vectors that can be used for this purpose include (a) a cloning start point that allows replication to be efficiently made to include several to several hundred plasmid vectors per host cell, (b) a host cell transformed with the plasmid vector, (C) a restriction enzyme cleavage site into which a foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cleavage site is not present, using a synthetic oligonucleotide adapter or a linker according to a conventional method can easily ligate the vector and the foreign DNA.

As a vector used for overexpression of the gene according to the present invention, an expression vector known in the art can be used. The framework vectors that may be used in the methods of the invention include but are not limited to various vectors capable of transforming into E. coli selected from the group consisting of pQE40, pT7, pET / Rb, pET28a, pET-22b Can be used.

Second, the host cell is transformed using the expression vector and cultured. (Sambrook, J. et al., Molecular Cloning, A Laboratory Manual (2nd Edition), Cold Spring Harbor Laboratory, 1. 74, 1989), as a method for preparing a transformant by introducing an expression vector into a host cell, A calcium phosphate method or a calcium chloride / rubidium chloride method, an electroporation method, an electroinjection method, a chemical treatment method such as PEG, a gene gun, or the like can be used.

When the transformant expressing the expression vector is cultured in a nutrient medium, a large amount of useful protein can be prepared and isolated. The medium and culture conditions can be suitably selected depending on the host cell. The conditions such as temperature, medium pH and incubation time should be appropriately adjusted so as to be suitable for cell growth and mass production of the protein during culturing.

A host cell that can be transformed with an expression vector according to the present invention includes both prokaryotic and eukaryotic cells, and a host having high efficiency of introduction of DNA and high efficiency of expression of the introduced DNA is usually used. Bacteria such as known eukaryotic and prokaryotic hosts such as Escherichia coli, Pseudomonas, Bacillus, Streptomyces, fungi and yeast, insect cells such as Spodoptera frugiperda (SF 9), CHO, COS 1, COS 7, BSC 1, BSC 40, BMT 10 and the like can be used. Preferably, Escherichia coli can be used.

Third, it is a step of inducing and accumulating the expression of the fusion recombinant protein. In a specific embodiment of the present invention, protein expression was induced using the inducer IPTG and the induction time was adjusted to maximize the amount of protein.

Finally, it is a step of separating and purifying the recombinant protein. In general, recombinantly produced proteins can be recovered from the medium or cell lysate. If membrane bound, it can be liberated from the membrane by using a suitable surfactant solution (e.g., Triton-X 100) or by enzymatic cleavage. Cells used for fusion recombinant protein expression can be disrupted by various physical or chemical means such as freeze-thaw cycles, sonication, mechanical disruption or cell disruption and can be isolated and purified by conventional biochemical separation techniques Inc., San Diego, Calif., 1989. [0154] The compounds of the present invention can be prepared according to the methods described in Sambrook et al., Molecular Cloning: A laborarory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, 1989; Deuscher, M., Guide to Protein Purification Methods Enzymology, Vol. , 1990). (Ion exchange chromatography, affinity chromatography, immuno sorbent affinity chromatography, reversed phase HPLC, gel permeation HPLC), isoelectric focusing and a variety of variations and combinations thereof, as well as electrophoresis, centrifugation, gel filtration, precipitation, dialysis, chromatography But is not limited to these.

In a specific embodiment of the present invention, the present inventors used a gene cassette for expressing STF2 recombinant protein into which foreign genes could be inserted so that 12 GnRHs as a foreign gene were linked to a STF2 N-terminal fragment and a C- And a pQE40 expression vector for producing STF2 recombinant protein containing the gene cassette was prepared and transformed into E. coli M15 competent cells. Then, STF2 recombinant protein with GnRH inserted was purified using chromatography using Ni-NTA resin for histidine tag protein.

Therefore, the target gene can be inserted using the gene cassette for expressing the STF2 recombinant protein of the present invention, and the gene cassette for expressing the STF2 recombinant protein in which the target gene is inserted can be cloned into the expression vector to obtain the STF2 recombinant protein It can be used for production.

Hereinafter, the present invention will be described in detail with reference to examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

< Example  1> for foreign gene insertion STF2  Genetic cassette production

STF2 (salmonella typhimurium flagellin fljB) is disadvantageous in that it is difficult to additionally express a protein having different functions due to the structural characteristics of the N-terminal and C-terminal adjacent to each other. Therefore, in order to produce an STF2 recombinant protein inserted into the STF2 protein, a linker gene encoding a gly-gly-gly-ser linker (GGGS linker) of the nucleotide sequence shown in [Table 1] An STF2 gene cassette was constructed in which a foreign gene could be inserted between an STF2 gene N-terminal fragment gene (SEQ ID NO: 1) and an STF2 gene C terminal fragment gene (SEQ ID NO: 2).

gene The sequence (5 '- &gt; 3') SEQ ID NO: STF2 N terminal fragment gene ATCAACACTAACAGTCTGTCGCTGCTGACCCAGAATAACCTGAACAAATCCCAGTCCGCACTGGGCACCGCTATCGAGCGTCTGTCTTCTGGTCTGCGTATCAACAGCGCGAAAGACGATGCGGCAGGTCAGGCGATTGCTAACCGTTTCACCGCGAACATCAAAGGTCTGACTCAGGCTTCCCGTAACGCTAACGACGGTATCTCCATTGCGCAGACCACTGAAGGCGCGCTGAACGAAATCAACAACAACCTGCAGCGTGTGCGTGAACTGGCGGTTCAGTCTGCTAACAGCACCAACTCCCAGTCTGACCTCGACTCCATCCAGGCTGAAATCACCCAGCGCCTGAACGAAATCGACCGTGTATCCGGCCAGACTCAGTTCAATGGCGTGAAAGTCCTGGCGCAGGACAACACCCTGACCATCCAGGTTGGCGCCAACGACGGTGAAACTATCGATATCGATCTGAAGCAGATCAACTCTCAGACCCTGGGTCTGGACTCACTGAACGTGCAGAAAGCGTATGATGTGAAAGATACAGCAGTAACAACGAAAGCTTATGCCAATAATGGTACTACACTGGACGTATCGGGTCTTGATGATGCAGCTATTAAAGCGGCTACGGGTGGTACGAATGGTACGGCTTCTGTAACCGGTGGTGCGGTTAAATTTGACGCAGATAATAACAAGTACTTTGTTACTATT One STF2 C terminal fragment gene ACTGGTGCTGATGCCGCCAAAAATGGCGATTATGAAGTTAACGTTGCTACTGACGGTACAGTAACCCTTGCGGCTGGCGCAACTAAAACCACAATGCCTGCTGGTGCGACAACTAAAACAGAAGTACAGGAGTTAAAAGATACACCGGCAGTTGTTTCAGCAGATGCTAAAAATGCCTTAATTGCTGGCGGCGTTGACGCTACCGATGCTAATGGCGCTGAGTTGGTCAAAATGTCTTATACCGATAAAAATGGTAAGACAATTGAAGGCGGTTATGCGCTTAAAGCTGGCGATAAGTATTACGCCGCAGATTACGATGAAGCGACAGGAGCAATTAAAGCTAAAACTACAAGTTATACTGCTGCTGACGGCACTACCAAAACAGCGGCTAACCAACTGGGTGGCGTAGACGGTAAAACCGAAGTCGTTACTATCGACGGTAAAACCTACAATGCCAGCAAAGCCGCTGGTCATGATTTCAAAGCACAACCAGAGCTGGCGGAAGCAGCCGCTAAAACCACCGAAAACCCGCTGCAGAAAATTGATGCCGCGCTGGCGCAGGTGGATGCGCTGCGCTCTGATCTGGGTGCGGTACAAAACCGTTTCAACTCTGCTATCACCAACCTGGGCAATACCGTAAACAATCTGTCTGAAGCGCGTAGCCGTATCGAAGATTCCGACTACGCGACCGAAGTTTCCAACATGTCTCGCGCGCAGATTCTGCAGCAGGCCGGTACTTCCGTTCTGGCGCAGGCTAACCAGGTCCCGCAGAACGTGCTGTCTCTGTTACGTTAA 2 Linker gene GGTGGCGGTAGT 3

<1-1> STF2  Production of gene N-terminal fragment

The following experiment was carried out in order to construct a pRBC TA vector into which an STF2 gene N-terminal fragment gene (SEQ ID NO: 1) containing a linker gene (SEQ ID NO: 3) encoding GGGS linker at both ends was inserted.

Specifically, to amplify the STF2 gene N-terminal fragment gene (STF2-1) containing the SpeI restriction enzyme site and the linker gene at the 5 'end of the STF2 gene and the Bg1II restriction enzyme site and the linker gene at the 3' PCR was carried out using the SpeI_STF2-1_F primer and the Bg1II_STF2-1_R primer described in [Table 2] below using the STF2 plasmid DNA cloned as a TA cloning vector by the method described in Korean Patent No. 10-1298215 as a template. For PCR, a total of 20 μl of the reaction solution was added with iNtRON's Maxime ™ PCR PreMix (i-StarTaq) (Cat No. 25180), 10 pmol each of SpeI_STF2-1_F primer and Bg1II_STF2-1_R primer and 10 ng of the template plasmid DNA And PCR was carried out under the conditions shown in Table 3 below to obtain an amplified STF2 gene N-terminal fragment gene product (FIG. 2, lane 2).

primer The sequence (5 '- &gt; 3') SEQ ID NO: SpeI_STF2-1_F ACTAGT _SpeI GGTGGCGGTAGT _{GGGS Linker} ATCAACACTAACAGTC 4 Bg1II_STF2-1_R AGATCT _Bg1II ACTACCGCCACC _{GGGS Linker} AATAGTAACAAAGTACTTG 5

PCR step Temperature (℃) time cycles First denaturation 95 5 minutes One Denaturation 95 30 seconds 35

Annealing 52 30 seconds Extension 72 1 minute Final Extension 72 7 minutes One

The STF2 gene N-terminal fragment gene product amplified was ligated to TA cloning vector (Real Bio Tech Corporation) using TA cloning technique and transformed into stellar competent cells (Clonetech, USA) using heat shock method . Transformed E. coli was plated on LB plates containing ampicillin inoculated with Xgal and IPTG, and cultured at 37 占 폚 for 16 hours, and white colonies were selected. The selected colonies were cultured overnight in LB broth containing ampicillin, and the plasmid DNA was extracted and DNA sequencing was performed to confirm that the STF2 gene N terminal fragment gene containing the GGGS linker gene was cloned at both ends. A recombinant pRBC TA plasmid in which the STF2 gene N-terminal fragment gene containing the GGGS linker gene was inserted at both ends was obtained through the above method (hereinafter referred to as 'pRBC [SpeI_STF2-1_Bg1II]').

<1-2> STF2  Production of gene C terminal fragment

The following experiment was carried out in order to construct a pRBC TA vector into which the STF2 gene C terminal fragment gene (SEQ ID NO: 2) containing the linker gene (SEQ ID NO: 3) encoding the GGGS linker was inserted at the 5 'end.

Specifically, in order to amplify the STF2 gene C-terminal fragment gene (STF2-2) containing the XhoI restriction enzyme site and the linker gene at the 5 'end of the STF2 gene and the XbaI and SacI restriction enzyme sites at the 3' end, PCR was performed in the same manner as described in Example <1-1> to obtain amplified STF2 gene C terminal fragment gene product (FIG. 2, lane 1). The XhoI_STF2-2_F primer and XbaI_SacI_STF2-2_R primer described in [Table 4] below were used for PCR.

primer The sequence (5 '- &gt; 3') SEQ ID NO: XhoI_STF2-2_F CTCGAG _XhoI GGTGGCGGTAGT _{GGGS Linker} ACTGGTGCTGATGCC 6 XbaI_SacI_STF2-2_R TCTAGA _XbaI GAGCTC _SacI TTAACGTAACAGAGACAGCA 7

The STF2 gene C terminal fragment gene product amplified was cloned by the same method as described in the above Example <1-1>, transformed, selected for colonies, and then subjected to DNA sequencing to obtain a GGGS linker gene at the 5 ' It was confirmed that STF2 gene C terminal fragment gene was cloned. Through this method, a recombinant pRBC TA plasmid in which the STF2 gene C terminal fragment gene containing the GGGS linker gene was inserted at the 5 'end was obtained (hereinafter referred to as' pRBC [XhoI_STF2-2_XbaI_SacI]').

<1-3> For foreign gene insertion STF2  Gene cassette manufacturing

As shown in the schematic diagram of FIG. 1, in order to construct a pRBC TA vector including the STF2 gene cassette which contains the GGGS linker gene and can insert a foreign gene between the N-terminal fragment gene and the C-terminal fragment gene of the STF2 gene, Respectively.

The pRBC [XhoI_STF2-2_XbaI_SacI] plasmid DNA prepared in Example <1-2> was digested with BglII (NEB) and XbaI (NEB) restriction enzymes. The digested pRBC [XhoI_STF2-2_XbaI_SacI] plasmid DNA was then confirmed by electrophoresis on a 1.5% agarose gel and purified using a DokDo-Prep Gel Extraction Kit (Cat No. EBD-1005).

Further, the pRBC [SpeI_STF2-1_Bg1II] plasmid DNA prepared in Example <1-1> was digested with restriction enzymes Bg1III (NEB) and XbaI (NEB). The digested pRBC [SpeI_STF2-1_Bg1II] plasmid DNA was then confirmed by electrophoresis on 1% agarose gel and purified using a DokDo-Prep Gel Extraction Kit (Cat No. EBD-1005).

The pRBC [XhoI_STF2-2_XbaI_SacI] plasmid DNA and pRBC [SpeI_STF2-1_Bg1II] plasmid DNA purified through the above method were ligated with the nucleic acid-binding enzyme T2 ligase (NEB) , And a linker gene was included in the N-terminus of the nucleotide sequence shown in Table 5 through DNA sequencing, and the linker gene and the foreign gene were inserted into the SFT2 gene (SEQ ID NO: 9) inserted therein (hereinafter referred to as &quot; pRBC [STF2-1_STF2-2] &quot;).

gene The sequence (5 '- &gt; 3') SEQ ID NO: STF2 N terminal fragment gene-GGGS linker gene-cloning site for insertion of a foreign gene (Bg1II_XhoI restriction enzyme site) -GGGS linker gene-STF2 C terminal fragment gene GGTGGCGGTAGT _{GGGS Linker} AGATCT _Bg1II CTCGAG _XhoI GGTGGCGGTAGT _{GGGS Linker} 8 GGGS linker gene - STF2 N terminal fragment gene - GGGS linker gene - Cloning site for insertion of foreign gene (Bg1II_XhoI restriction enzyme site) - GGGS linker gene - STF2 C terminal fragment gene GGTGGCGGTAGT _{GGGS linker} GGTGGCGGTAGT _{GGGS linker} AGATCT _Bg1II CTCGAG _XhoI GGTGGCGGTAGT _{GGGS linker} 9

Further, using the XhoI_STF2-2_F primer described in [Table 1] above and the XbaI_SacI_STF2-2_R primer described in [Table 2] using the above pRBC [STF2-1_STF2-2] as a template, PCR was carried out in the same manner as described, and the PCR amplified product was electrophoresed on 1% agarose gel to confirm the STF2 gene cassette of 1566 bp as shown in FIG.

< Example  2> as an exogenous gene GnRH ( gonadotropin -releasing hormone) 12 copy gene inserted STF2  Production of recombinant gene

<2-1> swGn  6 Copy manufacture

In order to insert the swine-derived GnRH gene (swGnRH) represented by the nucleotide sequence of SEQ ID NO: 10 and the amino acid sequence of SEQ ID NO: 11 into the STF2 gene cassette into which the foreign gene prepared in Example 1 was inserted, swGnRH PRBC TA vector containing 6 copies of the gene was constructed by performing the following experiment.

Specifically, in order to amplify the swGnRH6 copy gene containing the Bg1II restriction enzyme site at the 5 'end of the swGnRH6 copy gene and the XhoI restriction enzyme site at the 3' end, the gene described in Korean Patent No. 10-1298215 PCR was carried out using the swGnRH6 copy gene plasmid DNA (pGnRH6) cloned into the pQE40 vector as a template and the same method as described in the above Example <1-1> to obtain amplified swGnRH6 copy gene product. Bg1II_GnRH6_F primer and XhoI-GnRH6_R primer described in [Table 6] below were used for PCR.

primer The sequence (5 '- &gt; 3') SEQ ID NO: BglII_GnRH6_F GTGCTGTCTCTGTTACGT AGATCT _Bg1II GAA 12 XhoI_GnRH6_R GAGTCCAA CTCGAG _XhoI ATT AAGCTT _HindIII TCCCGG 13

The amplified swGnRH 6 copy gene product was cloned by the same method as described in the above Example <1-1>, transformed, colonies were selected, and swGnRH 6 copy gene was cloned through DNA sequencing. A recombinant pRBC TA plasmid in which the swGnRH6 copy gene was inserted (hereinafter referred to as 'pRBC [Bg1II_6copy-GnRH_XhoI]') was obtained by the above method.

<2-2> swGn  12 copies made

In order to insert 12 copies of the swGnRH gene into the STF2 gene cassette into which the foreign gene prepared in Example 1 could be inserted, a pRBC TA vector containing 12 copies of the swGnRH gene was constructed by performing the following experiment .

Specifically, in order to amplify the swGnRH6 copy gene including the XhoI and BglII restriction sites at the 5 'end of the swGnRH6 copy gene and the XhoI restriction site at the 3' end, PCR was performed using the GnRHI_InFusion_F primer and the GnRHI_InFusion_R primer described in Table 7 below using the pRBC [Bg1II_6copy-GnRH_XhoI] obtained in the above Example <2-1> as a template. The amplified swGnRH6 copy gene product was digested with XhoI (NEB) restriction enzyme. Then, the truncated swGnRH 6 copy gene product was confirmed by electrophoresis on 1.5% agarose gel for use as insert DNA, and purified using a DokDo-Prep Gel Extraction kit.

primer The sequence (5 '- &gt; 3') SEQ ID NO: GnRHI_InFusion_F AAAGCTTAAT CTCGAG _XhoI AGT AGATCT _Bg1II GAACAT 14 GnRHI_InFusion_R TACCGCCACC CTCGAGA _XhoI TTAAGC 15

The pRBC [Bg1II_6copy-GnRH_XhoI] plasmid DNA prepared in Example <2-1> was digested with XhoI (NEB) restriction enzyme. Then, the digested pRBC [Bg1II_6copy-GnRH_XhoI] plasmid DNA was confirmed by electrophoresis on a 1% agarose gel and purified using a DokDo-Prep Gel Extraction kit.

The insert DNA purified by the above method and pRBC [Bg1II_6copy-GnRH_XhoI] plasmid DNA were cloned using an In-fusion cloning kit (Cat No. 121416, Takara). For cloning, a total of 10 μl of the reaction solution was prepared by adding 2 μl of 5 × In-Fusion HD Enzyme Premix and 6: 1 ratio of insert DNA and pRBC [Bg1II_6copy-GnRH_XhoI] plasmid DNA. The reaction solution was allowed to react at 50 ° C for 15 minutes and then allowed to stand in ice. The cloning products were transformed in the same manner as described in the above Example <1-1> to select colonies, and DNA sequencing confirmed that the swGnRH 12 copy gene (SEQ ID NO: 17) was cloned. A recombinant pRBC TA plasmid in which the swGnRH 12 copy gene was inserted (hereinafter referred to as "pRBC [Bg1II_12copy-GnRH_XhoI]") was obtained by the above method.

<2-3> swGnRH  12 copy gene inserted STF2  Recombinant gene production

As shown in the schematic diagram of FIG. 4, the following experiment was carried out to prepare a pRBC vector containing the STF2 gene cassette in which the swGnRH 12 copy gene was inserted between the N-terminal and C-terminal fragment genes containing the GGGS linker gene.

Specifically, the pRBC [STF2-1_STF2-2] plasmid DNA prepared in Example <1-3> was digested with restriction enzymes Bg1II (NEB) and XhoI (NEB) . &Lt; / RTI &gt;

Further, the pRBC [Bg1II_12copy-GnRH_XhoI] plasmid DNA prepared in Example <2-2> was digested with BglII (NEB) restriction enzyme and XhoI (NEB) restriction enzyme. The truncated swGnRH 12 copy gene product was identified by electrophoresis on 1.5% agarose gel for use as insert DNA and purified using a DokDo-Prep Gel Extraction kit.

The pRBC [STF2-1_STF2-2] plasmid DNA and insert DNA purified through the above method were inoculated into an In-fusion cloning kit (Cat No. 121416, Takara) in the same manner as described in Example <2-2>Lt; / RTI &gt; The cloning product was transformed in the same manner as described in Example <1-1> to select colonies. DNA sequencing was performed to confirm that the STF2 gene cassette into which the swGnRH 12 copy gene was inserted was cloned. A recombinant pRBC TA plasmid containing the STF2 gene cassette (SEQ ID NO: 17) in which the swGnRH 12 copy gene of the nucleotide sequence shown in Table 8 below was inserted was obtained through the above method (hereinafter, referred to as' pRBC [STF2-1_12copy- GnRH_STF2-2].

gene The sequence (5 '- &gt; 3') SEQ ID NO: STF2 N terminal fragment gene-GGGS linker gene-
swGnRH 12 copy-GGGS linker gene-STF2 C terminal fragment gene GGTGGCGGTAGT _{GGGS linker} AGATCT _Bg1II GAACATTGGTCATATGGACTACGGCCGGGAGAACATTGGTCATATGGACTACGGCCGGGAGAACATTGGTCATATGGACTACGGCCGGGAGGTACCGAACATTGGTCATATGGACTACGGCCGGGAGAACATTGGTCATATGGACTACGGCCGGGAGAACATTGGTCATATGGACTACGGCCGGGAAAGCTTAATCTCGAGAGTAGATCTGAACATTGGTCATATGGACTACGGCCGGGAGAACATTGGTCATATGGACTACGGCCGGGAGAACATTGGTCATATGGACTACGGCCGGGAGGTACCGAACATTGGTCATATGGACTACGGCCGGGAGAACATTGGTCATATGGACTACGGCCGGGAGAACATTGGTCATATGGACTACGGCCGGGAAAGCTTAAT CTCGAG _XhoI GGTGGCGGTAGT _{GGGS linker} 16 GGGS linker gene-STF2 N terminal fragment gene-GGGS linker gene-swGnRH 12 copy-GGGS linker gene-STF2 C terminal fragment gene GGTGGCGGTAGT _GGGS GGTGGCGGTAGT _{GGGS Linker Linker Linker} AGATCT _Bg1II GAACATTGGTCATATGGACTACGGCCGGGAGAACATTGGTCATATGGACTACGGCCGGGAGAACATTGGTCATATGGACTACGGCCGGGAGGTACCGAACATTGGTCATATGGACTACGGCCGGGAGAACATTGGTCATATGGACTACGGCCGGGAGAACATTGGTCATATGGACTACGGCCGGGAAAGCTTAATCTCGAGAGTAGATCTGAACATTGGTCATATGGACTACGGCCGGGAGAACATTGGTCATATGGACTACGGCCGGGAGAACATTGGTCATATGGACTACGGCCGGGAGGTACCGAACATTGGTCATATGGACTACGGCCGGGAGAACATTGGTCATATGGACTACGGCCGGGAGAACATTGGTCATATGGACTACGGCCGGGAAAGCTTAAT CTCGAG _XhoI GGTGGCGGTAGT _GGGS 17

< Example  3> swGnRH  12 copy gene inserted STF2  Preparation of recombinant proteins

<3-1> swGnRH  12 copy gene inserted STF2  Production of recombinant gene expression vector

For the production of STF2 recombinant protein with swGnRH 12 copy gene inserted, the STF2 recombinant gene in which the swGnRH 12 copy gene was inserted into the pQE40 vector as an expression vector was cloned by the following experiment.

Specifically, pRBC [STF2-1_12copy-GnRH_STF2-2] prepared in the above Example <2-3> was used as a template to amplify the STF2 recombinant gene into which the swGnRH12 copy gene was inserted, PCR was carried out using the pQE40_STF2_InFusion_F primer and the pAE40_STF2_InFusion_R primer in the same manner as described in the above Example <1-1>. Then, the STF2 recombinant gene product in which the amplified swGnRH 12 copy gene was inserted was confirmed by electrophoresis on 1% agarose gel for use as insert DNA and purified using a DokDo-Prep Gel Extraction kit (FIG. 5).

primer The sequence (5 '- &gt; 3') SEQ ID NO: pQE40_STF2_InFusion_F TCACCATCACGGATCCATCAACACTAACAGT 18 pQE40_STF2_InFusion_R TCAGCTAATTAAGCTGAGCTCTTAACGTAA 19

In addition, the pQE40 vector was digested with BamHI (NEB) and HimdIII (NEB) restriction enzymes and purified using a DokDo-Prep Gel Extraction kit.

The purified pQE40 plasmid DNA and insert DNA were cloned using an In-fusion cloning kit (Cat No. 121416, Takara) in the same manner as described in Example <2-2> above. The cloning product was transformed in the same manner as described in Example <1-1> to select colonies. DNA sequencing was performed to confirm that the STF2 gene cassette into which the swGnRH 12 copy gene was inserted was cloned. The nucleotide sequence of SEQ ID NO: 16 and the amino acid sequence of SEQ ID NO: 20 were confirmed by DNA sequencing. A recombinant pQE expression vector containing the STF2 gene inserted with the swGnRH 12 copy gene was obtained through the above method (hereinafter referred to as 'pQE40 [STF2-1_12copy-GnRH_STF2-2]').

Amino acid sequence SEQ ID NO: swGnRH 12 copy gene inserted STF2 gene MRGSHHHHHHGSINTNSLSLLTQNNLNKSQSALGTAIERLSSGLRINSAKDDAAGQAIANRFTANIKGLTQASRNANDGISIAQTTEGALNEINNNLQRVRELAVQSANSTNSQSDLDSIQAEITQRLNEIDRVSGQTQFNGVKVLAQDNTLTIQVGANDGETIDIDLKQINSQTLGLDSLNVQKAYDVKDTAVTTKAYANNGTTLDVSGLDDAAIKAATGGTNGTASVTGGAVKFDADNNKYFVTIGGGSRSEHWSYGLRPGEHWSYGLRPGEHWSYGLRPGGTEHWSYGLRPGEHWSYGLRPGEHWSYGLRPGKLNLESRSEHWSYGLRPGEHWSYGLRPGEHWSYGLRPGGTEHWSYGLRPGEHWSYGLRPGEHWSYGLRPGKLNLEGGGSTGADAAKNGDYEVNVATDGTVTLAAGATKTTMPAGATTKTEVQELKDTPAVVSADAKNALIAGGVDATDANGAELVKMSYTDKNGKTIEGGYALKAGDKYYAADYDEATGAIKAKTTSYTAADGTTKTAANQLGGVDGKTEVVTIDGKTYNASKAAGHDFKAQPELAEAAAKTTENPLQKIDAALAQVDALRSDLGAVQNRFNSAITNLGNTVNNLSEARSRIEDSDYATEVSNMSRAQILQQAGTSVLAQANQVPQNVLSLLR * 20

<3-2> swGnRH  12 copy gene inserted STF2  Recombinant protein expression and purification

The swGnRH 12 copy gene-inserted STF2 recombinant protein was expressed and purified according to the QIAexpressionist (Qiagen) protocol as follows.

Specifically, pQE40 [STF2-1_12copy-GnRH_STF2-2] obtained in Example <3-1> was transformed into M15 competent cells (Qiagen, USA) using a thermal shock method. Transformed E. coli was plated on LB plates containing ampicillin inoculated with Xgal and IPTG, and cultured at 37 占 폚 for 16 hours, and white colonies were selected. The selected colonies were cultured in LB broth containing ampicillin for 16 hours. 10 ml of the cultured product was inoculated into 1 L of LB broth, cultured until an OD 600 value reached 0.9, and IPTG 1 mM was added to induce protein expression . After centrifugation to obtain pellets, the pellet was stored at -20 ° C for 16 hours, and the pellet was dissolved using a lysis buffer. Then, the pellet was centrifuged again, The mixture was shaken for 30 minutes and then dropped on the column. The plate was then washed twice with C buffer (pH 6.3) as described in [Table 11] and [Table 12], and then eluted four times with D buffer, pH 5.9 elution buffer, And eluted with an E buffer as an elution buffer. Thereafter, the expression and purification were confirmed using SDS-PAGE, and a band of about 72.49 KD was confirmed (FIG. 6).

Buffer C (1 L) 100 mM NaH ₂ PO _{4 13.8 g NaH 2 PO 4 H 2} O ( molecular weight 137.99 g / mol) 10 mM Tris-Cl 1.2 g Tris base (molecular weight 121.1 g / mol) 8 M elements 480.5 g (molecular weight 60.06 g / mol) Adjusted to pH 6.3 with HCl

Buffer D (1 L) 100 mM NaH ₂ PO _{4 13.8 g NaH 2 PO 4 H 2} O ( molecular weight 137.99 g / mol) 10 mM Tris-Cl 1.2 g Tris base (molecular weight 121.1 g / mol) 8 M elements 480.5 g (molecular weight 60.06 g / mol) Adjusted to pH 5.9 using HCI Buffer E (1 L) 100 mM NaH ₂ PO _{4 13.8 g NaH 2 PO 4 H 2} O ( molecular weight 137.99 g / mol) 10 mM Tris-Cl 1.2 g Tris base (molecular weight 121.1 g / mol) 8 M elements 480.5 g (molecular weight 60.06 g / mol) Adjusted to pH 6.3 with HCl

Therefore, through the results of Examples 2 and 3, the target gene can be inserted using the STF2 gene cassette prepared in Example 2, and the STF2 gene cassette Was cloned into an expression vector to confirm that the STF2 recombinant protein having the desired gene inserted therein could be produced.

< Example  4> In rats swGnRH  12 copy gene inserted STF2  Identification of recombinant protein antigen

A total of 12 four-week-old male Spraque Dawley (SD) rats were divided into two groups of six; Group 1; 50 ug of STF2 recombinant protein with swGnRH 12 copy gene inserted, Group 2; Control group.

Group 1 was inoculated with an equal amount of the swGnRH 12 copy gene-inserted STF2 recombinant protein and freud's imcomplete adjuvant. Group 2 was not inoculated as a control. The inoculation was carried out in five-week-old rats, and three additional inoculations were performed at intervals of two weeks. Rats from all groups were drawn from the venous blood before the inoculation and blood was drawn from the abdominal vein before euthanizing two weeks after the last vaccination. Blood samples were separated by serum and used for GnRH antibody test by ELISA.

KLH-GnRH protein was diluted to a concentration of 10 μg / ml in a carbonate / bicarbonate buffer (pH 9.6) to measure the antibody against GnRH present in the blood before and after each inoculation. 100 [mu] l per well was dispensed into well ELISA plates (SPL) and reacted at 4 [deg.] C for 16 hours. After washing three times with wash buffer (PBST: Phosphate buffered saline tween 20), 100 μl of blocking buffer (5% skim milk-PBST) was added per well and reacted at 37 ° C for 1 hour and 30 minutes. After washing three times with wash buffer, the rat serum was diluted to 40 × in a dilution buffer (2.5% skim milk-PBST) and added at a rate of 100 μl per well. The plate was incubated at 37 ° C. for 1 hour and 30 minutes . After washing with wash buffer 5 times, HRP (horseradish peroxidase) conjugated anti-rat antibody (Bethyl) was diluted to 10000 × in dilution buffer (2.5% skim milk-PBST) And the mixture was reacted at 37 ° C for 1 hour. After washing 5 times with washing buffer, 50 μl of TMB solution (KPL) was added to each well and reacted for 10 minutes. After that, 50 μl of stop solution (1 M HCl) was added to each well, and the value was measured with an ELISA reader at a wavelength of 450 nm.

As a result, as shown in Fig. 7, it was confirmed that the antibody titer was increased in the inoculation group rats after the second inoculation, while the antibody was not formed in the inoculated group (Fig. 7).

<110> Konkuk University-Industry Cooperation Foundation <120> Gene cassette for expression STF2 recombinant protein <130> P2017-031 <160> 23 <170> KoPatentin 3.0 <210> 1 <211> 705 <212> DNA <213> Salmonella typhimurium <400> 1 atcaacacta acagtctgtc gctgctgacc cagaataacc tgaacaaatc ccagtccgca 60 ctgggcaccg ctatcgagcg tctgtcttct ggtctgcgta tcaacagcgc gaaagacgat 120 gcggcaggtc aggcgattgc taaccgtttc accgcgaaca tcaaaggtct gactcaggct 180 tcccgtaacg ctaacgacgg tatctccatt gcgcagacca ctgaaggcgc gctgaacgaa 240 atcaacaaca acctgcagcg tgtgcgtgaa ctggcggttc agtctgctaa cagcaccaac 300 tcccagtctg acctcgactc catccaggct gaaatcaccc agcgcctgaa cgaaatcgac 360 cgtgtatccg gccagactca gttcaatggc gtgaaagtcc tggcgcagga caacaccctg 420 accatccagg ttggcgccaa cgacggtgaa actatcgata tcgatctgaa gcagatcaac 480 tctcagaccc tgggtctgga ctcactgaac gtgcagaaag cgtatgatgt gaaagataca 540 gcagtaacaa cgaaagctta tgccaataat ggtactacac tggacgtatc gggtcttgat 600 gatgcagcta ttaaagcggc tacgggtggt acgaatggta cggcttctgt aaccggtggt 660 gcggttaaat ttgacgcaga taataacaag tactttgtta ctatt 705 <210> 2 <211> 795 <212> DNA <213> Salmonella typhimurium <400> 2 actggtgctg atgccgccaa aaatggcgat tatgaagtta acgttgctac tgacggtaca 60 gtaacccttg cggctggcgc aactaaaacc acaatgcctg ctggtgcgac aactaaaaca 120 gaagtacagg agttaaaaga tacaccggca gttgtttcag cagatgctaa aaatgcctta 180 attgctggcg gcgttgacgc taccgatgct aatggcgctg agttggtcaa aatgtcttat 240 cgataagtat tacgccgcag attacgatga agcgacagga gcaattaaag ctaaaactac aagttatact 360 gctgctgacg gcactaccaa aacagcggct aaccaactgg gtggcgtaga cggtaaaacc 420 gaagtcgtta ctatcgacgg taaaacctac aatgccagca aagccgctgg tcatgatttc 480 aaagcacaac cagagctggc ggaagcagcc gctaaaacca ccgaaaaccc gctgcagaaa 540 attgatgccg cgctggcgca ggtggatgcg ctgcgctctg atctgggtgc ggtacaaaac 600 cgtttcaact ctgctatcac caacctgggc aataccgtaa acaatctgtc tgaagcgcgt 660 agccgtatcg aagattccga ctacgcgacc gaagtttcca acatgtctcg cgcgcagatt 720 ctgcagcagg ccggtacttc cgttctggcg caggctaacc aggtcccgca gaacgtgctg 780 tctctgttac gttaa 795 <210> 3 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> linker <400> 3 ggtggcggta gt 12 <210> 4 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> SpeI_STF2-1_F <400> 4 actagtggtg gcggtagtat caacactaac agtc 34 <210> 5 <211> 37 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Bg1II_STF2-1_R <400> 5 agatctacta ccgccaccaa tagtaacaaa gtacttg 37 <210> 6 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> XhoI_STF2-2_F <400> 6 ctcgagggtg gcggtagtac tggtgctgat gcc 33 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> XbaI_SacI_STF2-2_R <400> 7 tctagagagc tcttaacgta acagagacag ca 32 <210> 8 <211> 1536 <212> DNA <213> Artificial Sequence <220> <223> STF2 recombinent gene cassette <400> 8 atcaacacta acagtctgtc gctgctgacc cagaataacc tgaacaaatc ccagtccgca 60 ctgggcaccg ctatcgagcg tctgtcttct ggtctgcgta tcaacagcgc gaaagacgat 120 gcggcaggtc aggcgattgc taaccgtttc accgcgaaca tcaaaggtct gactcaggct 180 tcccgtaacg ctaacgacgg tatctccatt gcgcagacca ctgaaggcgc gctgaacgaa 240 atcaacaaca acctgcagcg tgtgcgtgaa ctggcggttc agtctgctaa cagcaccaac 300 tcccagtctg acctcgactc catccaggct gaaatcaccc agcgcctgaa cgaaatcgac 360 cgtgtatccg gccagactca gttcaatggc gtgaaagtcc tggcgcagga caacaccctg 420 accatccagg ttggcgccaa cgacggtgaa actatcgata tcgatctgaa gcagatcaac 480 tctcagaccc tgggtctgga ctcactgaac gtgcagaaag cgtatgatgt gaaagataca 540 gcagtaacaa cgaaagctta tgccaataat ggtactacac tggacgtatc gggtcttgat 600 gatgcagcta ttaaagcggc tacgggtggt acgaatggta cggcttctgt aaccggtggt 660 gcggttaaat ttgacgcaga taataacaag tactttgtta ctattggtgg cggtagtaga 720 tctctcgagg gtggcggtag tactggtgct gatgccgcca aaaatggcga ttatgaagtt 780 aacgttgcta ctgacggtac agtaaccctt gcggctggcg caactaaaac cacaatgcct 840 gctggtgcga caactaaaac agaagtacag gagttaaaag atacaccggc agttgtttca 900 gcagatgcta aaaatgcctt aattgctggc ggcgttgacg ctaccgatgc taatggcgct 960 gagttggtca aaatgtctta taccgataaa aatggtaaga caattgaagg cggttatgcg 1020 cttaaagctg gcgataagta ttacgccgca gattacgatg aagcgacagg agcaattaaa 1080 gctaaaacta caagttatac tgctgctgac ggcactacca aaacagcggc taaccaactg 1140 ggtggcgtag acggtaaaac cgaagtcgtt actatcgacg gtaaaaccta caatgccagc 1200 aaagccgctg gtcatgattt caaagcacaa ccagagctgg cggaagcagc cgctaaaacc 1260 accgaaaacc cgctgcagaa aattgatgcc gcgctggcgc aggtggatgc gctgcgctct 1320 gatctgggtg cggtacaaaa ccgtttcaac tctgctatca ccaacctggg caataccgta 1380 aacaatctgt ctgaagcgcg tagccgtatc gaagattccg actacgcgac cgaagtttcc 1440 aacatgtctc gcgcgcagat tctgcagcag gccggtactt ccgttctggc gcaggctaac 1500 caggtcccgc agaacgtgct gtctctgtta cgttaa 1536 <210> 9 <211> 1548 <212> DNA <213> Artificial Sequence <220> <223> STF2 recombinent gene cassette <400> 9 ggtggcggta gtatcaacac taacagtctg tcgctgctga cccagaataa cctgaacaaa 60 tcccagtccg cactgggcac cgctatcgag cgtctgtctt ctggtctgcg tatcaacagc 120 gcgaaagacg atgcggcagg tcaggcgatt gctaaccgtt tcaccgcgaa catcaaaggt 180 ctgactcagg cttcccgtaa cgctaacgac ggtatctcca ttgcgcagac cactgaaggc 240 gcgctgaacg aaatcaacaa caacctgcag cgtgtgcgtg aactggcggt tcagtctgct 300 aacagcacca actcccagtc tgacctcgac tccatccagg ctgaaatcac ccagcgcctg 360 aacgaaatcg accgtgtatc cggccagact cagttcaatg gcgtgaaagt cctggcgcag 420 gacaacaccc tgaccatcca ggttggcgcc aacgacggtg aaactatcga tatcgatctg 480 aagcagatca actctcagac cctgggtctg gactcactga acgtgcagaa agcgtatgat 540 gtgaaagata cagcagtaac aacgaaagct tatgccaata atggtactac actggacgta 600 tcgggtcttg atgatgcagc tattaaagcg gctacgggtg gtacgaatgg tacggcttct 660 gtaaccggtg gtgcggttaa atttgacgca gataataaca agtactttgt tactattggt 720 ggcggtagta gatctctcga gggtggcggt agtactggtg ctgatgccgc caaaaatggc 780 gattatgaag ttaacgttgc tactgacggt acagtaaccc ttgcggctgg cgcaactaaa 840 accacaatgc ctgctggtgc gacaactaaa acagaagtac aggagttaaa agatacaccg 900 gcagttgttt cagcagatgc taaaaatgcc ttaattgctg gcggcgttga cgctaccgat 960 gctaatggcg ctgagttggt caaaatgtct tataccgata aaaatggtaa gacaattgaa 1020 ggcggttatg cgcttaaagc tggcgataag tattacgccg cagattacga tgaagcgaca 1080 ggagcaatta aagctaaaac tacaagttat actgctgctg acggcactac caaaacagcg 1140 gctaaccaac tgggtggcgt agacggtaaa accgaagtcg ttactatcga cggtaaaacc 1200 tacaatgcca gcaaagccgc tggtcatgat ttcaaagcac aaccagagct ggcggaagca 1260 gccgctaaaa ccaccgaaaa cccgctgcag aaaattgatg ccgcgctggc gcaggtggat 1320 gcgctgcgct ctgatctggg tgcggtacaa aaccgtttca actctgctat caccaacctg 1380 ggcaataccg taaacaatct gtctgaagcg cgtagccgta tcgaagattc cgactacgcg 1440 accgaagttt ccaacatgtc tcgcgcgcag attctgcagc aggccggtac ttccgttctg 1500 gcgcaggcta accaggtccc gcagaacgtg ctgtctctgt tacgttaa 1548 <210> 10 <211> 30 <212> DNA <213> Sus scrofa <400> 10 gaacattggt catatggact acggccggga 30 <210> 11 <211> 10 <212> PRT <213> Sus scrofa <400> 11 Glu His Trp Ser Tyr Gly Leu Arg Pro Gly   1 5 10 <210> 12 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> BglII_GnRH6_F <400> 12 gtgctgtctc tgttacgtag atctgaa 27 <210> 13 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> XhoI_GnRH6_R <400> 13 gagtccaact cgagattaag ctttcccgg 29 <210> 14 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> GnRHI_InFusion_F <400> 14 aaagcttaat ctcgagagta gatctgaaca t 31 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GnRHI_InFusion_R <400> 15 taccgccacc ctcgagatta agc 23 <210> 16 <211> 1941 <212> DNA <213> Artificial Sequence <220> <223> STF2-1_12xGnRH_STF2-2 <400> 16 atcaacacta acagtctgtc gctgctgacc cagaataacc tgaacaaatc ccagtccgca 60 ctgggcaccg ctatcgagcg tctgtcttct ggtctgcgta tcaacagcgc gaaagacgat 120 gcggcaggtc aggcgattgc taaccgtttc accgcgaaca tcaaaggtct gactcaggct 180 tcccgtaacg ctaacgacgg tatctccatt gcgcagacca ctgaaggcgc gctgaacgaa 240 atcaacaaca acctgcagcg tgtgcgtgaa ctggcggttc agtctgctaa cagcaccaac 300 tcccagtctg acctcgactc catccaggct gaaatcaccc agcgcctgaa cgaaatcgac 360 cgtgtatccg gccagactca gttcaatggc gtgaaagtcc tggcgcagga caacaccctg 420 accatccagg ttggcgccaa cgacggtgaa actatcgata tcgatctgaa gcagatcaac 480 tctcagaccc tgggtctgga ctcactgaac gtgcagaaag cgtatgatgt gaaagataca 540 gcagtaacaa cgaaagctta tgccaataat ggtactacac tggacgtatc gggtcttgat 600 gatgcagcta ttaaagcggc tacgggtggt acgaatggta cggcttctgt aaccggtggt 660 gcggttaaat ttgacgcaga taataacaag tactttgtta ctattggtgg cggtagtaga 720 tctgaacatt ggtcatatgg actacggccg ggagaacatt ggtcatatgg actacggccg 780 ggagaacatt ggtcatatgg actacggccg ggaggtaccg aacattggtc atatggacta 840 cggccgggag aacattggtc atatggacta cggccgggag aacattggtc atatggacta 900 cggccgggaa agcttaatct cgagagtaga tctgaacatt ggtcatatgg actacggccg 960 ggagaacatt ggtcatatgg actacggccg ggagaacatt ggtcatatgg actacggccg 1020 ggaggtaccg aacattggtc atatggacta cggccgggag aacattggtc atatggacta 1080 cggccgggag aacattggtc atatggacta cggccgggaa agcttaatct cgagggtggc 1140 ggtagtactg gtgctgatgc cgccaaaaat ggcgattatg aagttaacgt tgctactgac 1200 ggtacagtaa cccttgcggc tggcgcaact aaaaccacaa tgcctgctgg tgcgacaact 1260 aaaacagaag tacaggagtt aaaagataca ccggcagttg tttcagcaga tgctaaaaat 1320 gccttaattg ctggcggcgt tgacgctacc gatgctaatg gcgctgagtt ggtcaaaatg 1380 tcttataccg ataaaaatgg taagacaatt gaaggcggtt atgcgcttaa agctggcgat 1440 aagtattacg ccgcagatta cgatgaagcg acaggagcaa ttaaagctaa aactacaagt 1500 tatactgctg ctgacggcac taccaaaaca gcggctaacc aactgggtgg cgtagacggt 1560 aaaaccgaag tcgttactat cgacggtaaa acctacaatg ccagcaaagc cgctggtcat 1620 gatttcaaag cacaaccaga gctggcggaa gcagccgcta aaaccaccga aaacccgctg 1680 cagaaaattg atgccgcgct ggcgcaggtg gatgcgctgc gctctgatct gggtgcggta 1740 caaaaccgtt tcaactctgc tatcaccaac ctgggcaata ccgtaaacaa tctgtctgaa 1800 gcgcgtagcc gtatcgaaga ttccgactac gcgaccgaag tttccaacat gtctcgcgcg 1860 cagattctgc agcaggccgg tacttccgtt ctggcgcagg ctaaccaggt cccgcagaac 1920 gtgctgtctc tgttacgtta a 1941 <210> 17 <211> 1953 <212> DNA <213> Artificial Sequence <220> <223> STF2-1_12xGnRH_STF2-2 <400> 17 ggtggcggta gtatcaacac taacagtctg tcgctgctga cccagaataa cctgaacaaa 60 tcccagtccg cactgggcac cgctatcgag cgtctgtctt ctggtctgcg tatcaacagc 120 gcgaaagacg atgcggcagg tcaggcgatt gctaaccgtt tcaccgcgaa catcaaaggt 180 ctgactcagg cttcccgtaa cgctaacgac ggtatctcca ttgcgcagac cactgaaggc 240 gcgctgaacg aaatcaacaa caacctgcag cgtgtgcgtg aactggcggt tcagtctgct 300 aacagcacca actcccagtc tgacctcgac tccatccagg ctgaaatcac ccagcgcctg 360 aacgaaatcg accgtgtatc cggccagact cagttcaatg gcgtgaaagt cctggcgcag 420 gacaacaccc tgaccatcca ggttggcgcc aacgacggtg aaactatcga tatcgatctg 480 aagcagatca actctcagac cctgggtctg gactcactga acgtgcagaa agcgtatgat 540 gtgaaagata cagcagtaac aacgaaagct tatgccaata atggtactac actggacgta 600 tcgggtcttg atgatgcagc tattaaagcg gctacgggtg gtacgaatgg tacggcttct 660 gtaaccggtg gtgcggttaa atttgacgca gataataaca agtactttgt tactattggt 720 ggcggtagta gatctgaaca ttggtcatat ggactacggc cgggagaaca ttggtcatat 780 ggactacggc cgggagaaca ttggtcatat ggactacggc cgggaggtac cgaacattgg 840 tcatatggac tacggccggg agaacattgg tcatatggac tacggccggg agaacattgg 900 tcatatggac tacggccggg aaagcttaat ctcgagagta gatctgaaca ttggtcatat 960 ggactacggc cgggagaaca ttggtcatat ggactacggc cgggagaaca ttggtcatat 1020 ggactacggc cgggaggtac cgaacattgg tcatatggac tacggccggg agaacattgg 1080 tcatatggac tacggccggg agaacattgg tcatatggac tacggccggg aaagcttaat 1140 ctcgagggtg gcggtagtac tggtgctgat gccgccaaaa atggcgatta tgaagttaac 1200 gttgctactg acggtacagt aacccttgcg gctggcgcaa ctaaaaccac aatgcctgct 1260 ggtgcgacaa ctaaaacaga agtacaggag ttaaaagata caccggcagt tgtttcagca 1320 gatgctaaaa atgccttaat tgctggcggc gttgacgcta ccgatgctaa tggcgctgag 1380 ttggtcaaaa tgtcttatac cgataaaaat ggtaagacaa ttgaaggcgg ttatgcgctt 1440 aaagctggcg ataagtatta cgccgcagat tacgatgaag cgacaggagc aattaaagct 1500 aaaactacaa gttatactgc tgctgacggc actaccaaaa cagcggctaa ccaactgggt 1560 ggcgtagacg gtaaaaccga agtcgttact atcgacggta aaacctacaa tgccagcaaa 1620 gccgctggtc atgatttcaa agcacaacca gagctggcgg aagcagccgc taaaaccacc 1680 gaaaacccgc tgcagaaaat tgatgccgcg ctggcgcagg tggatgcgct gcgctctgat 1740 ctgggtgcgg tacaaaaccg tttcaactct gctatcacca acctgggcaa taccgtaaac 1800 aatctgtctg aagcgcgtag ccgtatcgaa gattccgact acgcgaccga agtttccaac 1860 atgtctcgcg cgcagattct gcagcaggcc ggtacttccg ttctggcgca ggctaaccag 1920 gtcccgcaga acgtgctgtc tctgttacgt taa 1953 <210> 18 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> pQE40_STF2_InFusion_F <400> 18 tcaccatcac ggatccatca acactaacag t 31 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pQE40_STF2_InFusion_R <400> 19 tcagctaatt aagctgagct cttaacgtaa 30 <210> 20 <211> 658 <212> PRT <213> Artificial Sequence <220> <223> STF2-1_12xGnRH_STF2-2 <400> 20 Met Arg Gly Ser His His His His His His Gly Ser Ile Asn Thr Asn 120 124 129 134 Ser Leu Ser Leu Leu Thr Gln Asn Asn Leu Asn Lys Ser Gln Ser Ala             139 144 149 Leu Gly Thr Ala Ile Glu Arg Leu Ser Ser Gly Leu Arg Ile Asn Ser         154 159 164 Ala Lys Asp Ala Ala Gly Ala Asn Arg Phe Thr Ala     169 174 179 Asn Ile Lys Gly Leu Thr Gln Ala Ser Arg Asn Asn Asn Asp Gly Ile 184 189 194 199 Ser Ile Ala Gln Thr Thr Glu Gly Ala Leu Asn Glu Ile Asn Asn Asn                 204 209 214 Leu Gln Arg Val Glu Leu Ala Val Gln Ser Ala Asn Ser Thr Asn             219 224 229 Ser Gln Ser Asp Leu Asp Ser Ile Gln Ala Glu Ile Thr Gln Arg Leu         234 239 244 Asn Glu Ile Asp Arg Val Ser Gly Gln Thr Gln Phe Asn Gly Val Lys     249 254 259 Val Leu Ala Gln Asp Asn Thr Leu Thr Ile Gln Val Gly Ala Asn Asp 264 269 274 279 Gly Glu Thr Ile Asp Ile Asp Leu Lys Gln Ile Asn Ser Gln Thr Leu                 284 289 294 Gly Leu Asp Ser Leu Asn Val Gln Lys Ala Tyr Asp Val Lys Asp Thr             299 304 309 Ala Val Thr Thr Lys Ala Tyr Ala Asn Asn Gly Thr Thr Leu Asp Val         314 319 324 Ser Gly Leu Asp Asp Ala Ile Lys Ala Ala Thr Gly Gly Thr Asn     329 334 339 Gly Thr Ala Ser Val Thr Gly Gly Ala Val Lys Phe Asp Ala Asp Asn 344 349 354 359 Asn Lys Tyr Phe Val Thr Ile Gly Gly Gly Ser Ser Arg Ser Glu His Trp                 364 369 374 Ser Tyr Gly Leu Arg Pro Gly Glu His Trp Ser Tyr Gly Leu Arg Pro             379 384 389 Gly Glu His Trp Ser Tyr Gly Leu Arg Pro Gly Gly Thr Glu His Trp         394 399 404 Ser Tyr Gly Leu Arg Pro Gly Glu His Trp Ser Tyr Gly Leu Arg Pro     409 414 419 Gly Glu His Trp Ser Tyr Gly Leu Arg Pro Gly Lys Leu Asn Leu Glu 424 429 434 439 Ser Arg Ser Glu His Trp Ser Tyr Gly Leu Arg Pro Gly Glu His Trp                 444 449 454 Ser Tyr Gly Leu Arg Pro Gly Glu His Trp Ser Tyr Gly Leu Arg Pro             459 464 469 Gly Gly Thr Glu His Trp Ser Tyr Gly Leu Arg Pro Gly Glu His Trp         474 479 484 Ser Tyr Gly Leu Arg Pro Gly Glu His Trp Ser Tyr Gly Leu Arg Pro     489 494 499 Gly Lys Leu Asn Leu Glu Gly Gly Gly Ser Thr Gly Ala Asp Ala Ala 504 509 514 519 Lys Asn Gly Asp Tyr Glu Val Asn Val Ala Thr Asp Gly Thr Val Thr                 524 529 534 Leu Ala Ala Gly Ala Thr Lys Thr Thr Met Pro Ala Gly Ala Thr Thr             539 544 549 Lys Thr Glu Val Gln Glu Leu Lys Asp Thr Pro Ala Val Val Ser Ala         554 559 564 Asp Ala Lys Asn Ala Leu Ile Ala Gly Gly Val Asp Ala Thr Asp Ala     569 574 579 Asn Gly Ala Glu Leu Val Lys Met Ser Tyr Thr Asp Lys Asn Gly Lys 584 589 594 599 Thr Ile Glu Gly Gly Tyr Ala Leu Lys Ala Gly Asp Lys Tyr Tyr Ala                 604 609 614 Ala Asp Tyr Asp Glu Ala Thr Gly Ala Ile Lys Ala Lys Thr Thr Ser             619 624 629 Tyr Thr Ala Ala Asp Gly Thr Thr Lys Thr Ala Aspen Gln Aspen Gly         634 639 644 Gly Val Asp Gly Lys Thr Gly Val Val Thr Ile Asp Gly Lys Thr Tyr     649 654 659 Asn Ala Ser Lys Ala Ala Gly His Asp Phe Lys Ala Gln Pro Glu Leu 664 669 674 679 Ala Glu Ala Ala Ala Lys Thr Thr Glu Asn Pro Leu Gln Lys Ile Asp                 684 689 694 Ala Ala Leu Ala Gln Val Asp Ala Leu Arg Ser Asp Leu Gly Ala Val             699 704 709 Gln Asn Arg Phe Asn Ser Ala Ile Thr Asn Leu Gly Asn Thr Val Asn         714 719 724 Asn Leu Ser Glu Ala Arg Ser Ser Ile Glu Asp Ser Asp Tyr Ala Thr     729 734 739 Glu Val Ser Asn Met Ser Arg Ala Gln Ile Leu Gln Gln Ala Gly Thr 744 749 754 759 Ser Val Leu Ala Gln Ala Asn Gln Val Pro Gln Asn Val Leu Ser Leu                 764 769 774 Leu Arg         <210> 21 <211> 1521 <212> DNA <213> Salmonella typhimurium <400> 21 atggcacaag taatcaacac taacagtctg tcgctgctga cccagaataa cctgaacaaa 60 tcccagtccg cactgggcac cgctatcgag cgtctgtctt ctggtctgcg tatcaacagc 120 gcgaaagacg atgcggcagg tcaggcgatt gctaaccgtt tcaccgcgaa catcaaaggt 180 ctgactcagg cttcccgtaa cgctaacgac ggtatctcca ttgcgcagac cactgaaggc 240 gcgctgaacg aaatcaacaa caacctgcag cgtgtgcgtg aactggcggt tcagtctgct 300 aacagcacca actcccagtc tgacctcgac tccatccagg ctgaaatcac ccagcgcctg 360 aacgaaatcg accgtgtatc cggccagact cagttcaacg gcgtgaaagt cctggcgcag 420 gacaacaccc tgaccatcca ggttggcgcc aacgacggtg aaactatcga tatcgatctg 480 aagcagatca actctcagac cctgggtctg gactcactga acgtgcagaa agcgtatgat 540 gtgaaagata cagcagtaac aacgaaagct tatgccaata atggtactac actggacgta 600 tcgggtcttg atgatgcagc tattaaagcg gctacgggtg gtacgaatgg tacggcttct 660 gtaaccggtg gtgcggttaa atttgacgca gataataaca agtactttgt tactattggt 720 ggctttactg gtgctgatgc cgccaaaaat ggcgattatg aagttaacgt tgctactgac 780 ggtacagtaa cccttgcggc tggcgcaact aaaaccacaa tgcctgctgg tgcgacaact 840 aaaacagaag tacaggagtt aaaagataca ccggcagttg tttcagcaga tgctaaaaat 900 gccttaattg ctggcggcgt tgacgctacc gatgctaatg gcgctgagtt ggtcaaaatg 960 tcttataccg ataaaaatgg taagacaatt gaaggcggtt atgcgcttaa agctggcgat 1020 aagtattacg ccgcagatta cgatgaagcg acaggagcaa ttaaagctaa aactacaagt 1080 tatactgctg ctgacggcac taccaaaaca gcggctaacc aactgggtgg cgtagacggt 1140 aaaaccgaag tcgttactat cgacggtaaa acctacaatg ccagcaaagc cgctggtcat 1200 gatttcaaag cacaaccaga gctggcggaa gcagccgcta aaaccaccga aaacccgctg 1260 cagaaaattg atgccgcgct ggcgcaggtg gatgcgctgc gctctgatct gggtgcggta 1320 caaaaccgtt tcaactctgc tatcaccaac ctgggcaata ccgtaaacaa tctgtctgaa 1380 gcgcgtagcc gtatcgaaga ttccgactac gcgaccgaag tttccaacat gtctcgcgcg 1440 cagattctgc agcaggccgg tacttccgtt ctggcgcagg ctaaccaggt cccgcagaac 1500 gtgctgtctc tgttacgtta a 1521 <210> 22 <211> 506 <212> PRT <213> Salmonella typhimurium <400> 22 Met Ala Gln Val Ile Asn Thr Asn Ser Leu Ser Leu Leu Thr Gln Asn   1 5 10 15 Asn Leu Asn Lys Ser Gln Ser Ala Leu Gly Thr Ala Ile Glu Arg Leu              20 25 30 Ser Ser Gly Leu Arg Ile Asn Ser Ala Lys Asp Asp Ala Ala Gly Gln          35 40 45 Ala Ile Ala Asn Arg Phe Thr Ala Asn Ile Lys Gly Leu Thr Gln Ala      50 55 60 Ser Arg Asn Ala Asn Asp Gly Ile Ser Ile Ala Gln Thr Thr Glu Gly  65 70 75 80 Ala Leu Asn Glu Ile Asn Asn Asn Leu Gln Arg Val Val Glu Leu Ala                  85 90 95 Val Gln Ser Ala Asn Ser Thr Asn Ser Gln Ser Asp Leu Asp Ser Ile             100 105 110 Gln Ala Glu Ile Thr Gln Arg Leu Asn Glu Ile Asp Arg Val Ser Gly         115 120 125 Gln Thr Gln Phe Asn Gly Val Lys Val Leu Ala Gln Asp Asn Thr Leu     130 135 140 Thr Ile Gln Val Gly Ala Asn Asp Gly Glu Thr Ile Asp Ile Asp Leu 145 150 155 160 Lys Gln Ile Asn Ser Gln Thr Leu Gly Leu Asp Ser Leu Asn Val Gln                 165 170 175 Lys Ala Tyr Asp Val Lys Asp Thr Ala Val Thr Thr Lys Ala Tyr Ala             180 185 190 Asn Asn Gly Thr Thr Leu Asp Val Ser Gly Leu Asp Asp Ala Ala Ile         195 200 205 Lys Ala Ala Thr Gly Gly Thr Asn Gly Thr Ala Ser Val Thr Gly Gly     210 215 220 Ala Val Lys Phe Asp Ala Asp Asn Asn Lys Tyr Phe Val Thr Ile Gly 225 230 235 240 Gly Phe Thr Gly Ala Asp Ala Ala Lys Asn Gly Asp Tyr Glu Val Asn                 245 250 255 Val Ala Thr Asp Gly Thr Val Thr Leu Ala Ala Gly Ala Thr Lys Thr             260 265 270 Thr Met Pro Ala Gly Ala Thr Thr Lys Thr Glu Val Gln Glu Leu Lys         275 280 285 Asp Thr Pro Ala Val Val Ser Ala Asp Ala Lys Asn Ala Leu Ile Ala     290 295 300 Gly Gly Val Asp Ala Thr Asp Ala Asn Gly Ala Glu Leu Val Lys Met 305 310 315 320 Ser Tyr Thr Asp Lys Asn Gly Lys Thr Ile Glu Gly Gly Tyr Ala Leu                 325 330 335 Lys Ala Gly Asp Lys Tyr Tyr Ala Ala Asp Tyr Asp Glu Ala Thr Gly             340 345 350 Ala Ile Lys Ala Lys Thr Thr Ser Tyr Thr Ala Ala Asp Gly Thr Thr         355 360 365 Lys Thr Ala Ala Asn Gln Leu Gly Gly Val Asp Gly Lys Thr Glu Val     370 375 380 Val Thr Ile Asp Gly Lys Thr Tyr Asn Ala Ser Lys Ala Ala Gly His 385 390 395 400 Asp Phe Lys Ala Gln Pro Glu Leu Ala Glu Ala Ala Ala Lys Thr Thr                 405 410 415 Glu Asn Pro Leu Gln Lys Ile Asp Ala Ala Leu Ala Gln Val Asp Ala             420 425 430 Leu Arg Ser Asp Leu Gly Ala Val Gln Asn Arg Phe Asn Ser Ala Ile         435 440 445 Thr Asn Leu Gly Asn Thr Val Asn Asn Leu Ser Glu Ala Arg Ser Arg     450 455 460 Ile Glu Asp Ser Asp Tyr Ala Thr Glu Val Ser Asn Met Ser Ser Ala 465 470 475 480 Gln Ile Leu Gln Gln Ala Gly Thr Ser Val Leu Ala Gln Ala Asn Gln                 485 490 495 Val Pro Gln Asn Val Leu Ser Leu Leu Arg             500 505 <210> 23 <211> 396 <212> DNA <213> Artificial Sequence <220> <223> 12xGnRH <400> 23 gaacattggt catatggact acggccggga gaacattggt catatggact acggccggga 60 gaacattggt catatggact acggccggga ggtaccgaac attggtcata tggactacgg 120 ccgggagaac attggtcata tggactacgg ccgggagaac attggtcata tggactacgg 180 ccgggaaagc ttaatctcga gagtagatct gaacattggt catatggact acggccggga 240 gaacattggt catatggact acggccggga gaacattggt catatggact acggccggga 300 ggtaccgaac attggtcata tggactacgg ccgggagaac attggtcata tggactacgg 360 ccgggagaac attggtcata tggactacgg ccggga 396

Claims (10)

An N-terminal fragment gene of STF2 (salmonella typhimurium flagellin fljB) represented by SEQ ID NO: 1, a gene encoding a linker represented by SEQ ID NO: 3, a cloning site for insertion of a foreign gene, a gene encoding a linker represented by SEQ ID NO: 3, A gene cassette for expressing STF2 recombinant protein, which comprises in sequence the C-terminal fragment gene of STF2 represented by SEQ ID NO: 2.
delete The gene cassette for expression of an STF2 recombinant protein according to claim 1, wherein the linker has an amino acid sequence of Gly-Gly-Gly-Ser.
The gene cassette according to claim 1, wherein the cloning site for foreign gene insertion comprises BglII and XhoI cleavage sites.
The gene cassette for expressing STF2 recombinant protein according to claim 1, wherein said gene cassette is represented by SEQ ID NO: 8.
The gene cassette for expressing STF2 recombinant protein according to claim 1, further comprising a gene encoding a linker at the 5 'end of the N-terminal fragment gene of STF2.
7. The gene cassette for expressing STF2 recombinant protein according to claim 6, wherein said gene cassette is represented by SEQ ID NO:
8. An expression vector containing the gene cassette of any one of claims 1 to 7.
A transformant obtained by transforming a host cell with the expression vector of claim 8.
A method for producing an STF2 recombinant protein comprising culturing the transformant of claim 9.

Images