KR101899235B1

KR101899235B1 - Primer set for diagnosing adhd in korean, kit for diagnosing comprising the same, and method of predicting adhd risk in korean using thereof

Info

Publication number: KR101899235B1
Application number: KR1020170006124A
Authority: KR
Inventors: 진한준; 강근수; 고정문; 황인욱
Original assignee: 단국대학교 천안캠퍼스 산학협력단
Priority date: 2017-01-13
Filing date: 2017-01-13
Publication date: 2018-09-14
Also published as: KR20180083614A

Abstract

본 발명은, 한국인의 주의력결핍 과잉행동장애(ADHD) 진단용 프라이머 세트 및 이를 포함하는 한국인의 ADHD 진단용 키트 및 한국인의 ADHD 위험도의 예측 방법에 관한 것이다. The present invention relates to a primer set for the diagnosis of ADHD in Koreans, a kit for diagnosing ADHD in Koreans and a method for predicting the risk of ADHD in Koreans.

Description

TECHNICAL FIELD The present invention relates to a primer set for diagnosing attention deficit hyperactivity disorder in Koreans, a diagnostic kit including the same, and a method for predicting the risk of attention deficit hyperactivity disorder OF PREDICTING ADHD RISK IN KOREAN USING THEREOF}

본 발명은 한국인의 주의력결핍 과잉행동장애(ADHD) 진단용 프라이머 세트, 이를 포함하는 진단용 키트, 및 이를 이용한 한국인의 주의력결핍 과잉행동장애 위험도의 예측 방법에 관한 것이다. The present invention relates to a primer set for the diagnosis of ADHD in Koreans, a diagnostic kit containing the same, and a method for predicting the risk of ADHD in Koreans using the primer set.

주의력결핍 과잉행동장애(Attention Deficit Hyperactivity Disorder, ADHD)란 과잉행동, 주의력 결핍 및 충동 행동을 핵심 증상으로 하는 대표적 뇌 발달 장애 질환으로, 소아부터 성인까지 지속적인 치료가 요구되는 질환이고, 국내의 아동에서 2 ~ 7.6%의 발병율을 나타내고 있다. Attention Deficit Hyperactivity Disorder (ADHD) is a typical brain developmental disorder characterized by hyperactivity, attention deficit and impulsive behavior. It is a disease that requires continuous treatment from child to adult. 2 to 7.6%.

최근의 연구를 살펴보면, ADHD는 다양한 요인에 의해 발병하는 복합 질환(complex disease)으로, 특히 가족기반연구(family study)에서 ADHD는 80~90%의 높은 유전력(heritability)을 나타내고 있다(Levy et al., 1997; Thapar et al., 1999). Recent studies have shown that ADHD is a complex disease caused by a variety of factors, and in particular, family history of ADHD has shown a high heritability of 80-90% (Levy et al Thapar et al., 1999).

또한, ADHD 환자는 핵심 증상에 학습장애, 품행장애, 우울증, 수면장애 등의 정신과적 장애를 동반하고, 불순종, 공격성, 반사회적인 행동을 보이기 때문에 사회적인 적응이 어려울 뿐만 아니라, 양육 스트레스를 유발하여 가정과 사회에서 상호관계의 악순환을 유발한다. 뿐만 아니라, ADHD 환아는 주의가 산만하고 일반 아동에 비해 집중력의 지속성이 낮기 때문에 교통사고 등 사고에 취약하며, 공격적이고 반항적 행동을 보이기 때문에 청소년 비행이나 약물남용을 유발할 수 있어 왕따 등의 사회적 문제가 발생하기도 한다. 또한, ADHD 증세가 있는 경우, 정상적인 사회관계 정립 및 학습능력에도 문제를 드러내며 성인도 약물 중독 및 실행 능력 부족 등의 문제를 보이고, 특히, 일반 성인에 비하여 흡연률이 높게 나타난다. ADHD는 성인기까지 지속되는 비율이 40~60%로, 직업 유지 및 결혼생활의 어려움을 겪을 뿐 아니라 알코올을 비롯한 약물 남용 및 의존, 반사회적 행동, 비행, 범죄의 가능성이 높다(Arcos-Burgos and Acosta, 2007). In addition, patients with ADHD have difficulty adapting to social problems because they have disabilities, aggression, and antisocial behavior, accompanied by psychiatric disorders such as learning disabilities, conduct disorders, depression, and sleep disorders. In the same way. In addition, ADHD children are vulnerable to accidents such as traffic accidents because they are distracted and have less concentration of concentration than general children. They show aggressive and rebellious behavior, which can lead to juvenile delinquency and substance abuse. . In addition, when ADHD symptoms are present, normal social relations and learning ability are also problematic. Adults also have problems such as lack of drug addiction and ability to perform, and smoking rates are higher than that of general adults. ADHD has a 40 to 60% chance of continuing to adulthood and has difficulty in occupation and marriage as well as drug abuse and dependence including alcohol, antisocial behavior, flight and crime (Arcos-Burgos and Acosta, 2007).

ADHD를 조기에 치료하지 않을 경우, ADHD 환아의 대부분이 성인이 되어서도 그 증상을 유지하기 때문에(Kwon et al., 2014), 성인기의 ADHD 환자들은 주의력과 집중력의 저하로 사회생활의 부적응을 초래하게 되고 심한 경우 우울증 증상을 동반하여 일반인에 비해 높은 자살률을 보이는 것으로 보고된다(James et al., 2004). 따라서 환자 본인과 환자 가족들의 삶의 질을 향상시키기 위하여 ADHD의 조기예측 및 치료가 중요한 실정이다. Adult ADHD patients are more likely to experience malnutrition due to their attention and concentration (Kwon et al., 2014), since most ADHD patients maintain their symptoms when they become adults (Kwon et al., 2014) (Jones et al., 2004). In addition, there is a strong association between depressive symptoms and depressive symptoms. Therefore, early prediction and treatment of ADHD is important to improve the quality of life of patients and their families.

현재까지, ADHD 환자를 포함한 여러 민족 집단을 대상으로 한 ADHD의 유전적 상관성 연구에서, 다양한 유전자 내의 특정 변이체들이 ADHD의 발병과 증상에 영향을 주는 것으로 확인되었다(Kim et al., 2005; Lim et al., 2006; Hwang et al., 2015; Isaksson et al., 2015; Kayyal et al., 2015; Xu et al., 2007; Lee et al., 2016). 그러나, 한국인에 유의한 상관성을 보이는 유전자들에 대한 연구는 부족한 실정이다. To date, genetic correlations of ADHD among a range of ethnic groups, including ADHD patients, have shown that certain variants within a variety of genes affect the onset and symptoms of ADHD (Kim et al., 2005; Lim et al. 2005, Lee et al., 2016), as well as the results of the study (Kim et al., 2006; Hwang et al., 2015; However, there is a lack of research on genes that have significant correlation with Koreans.

따라서, 본 발명자는, 한국인 ADHD 환자와 유의한 상관성을 보이는 하플로타입 빈도를 확인하였고, 이를 토대로 본 발명을 완성하였다. Therefore, the present inventor confirmed a haplotypic frequency showing a significant correlation with Korean ADHD patients, and completed the present invention based on this finding.

본 발명의 목적은, 한국인의 주의력결핍 과잉행동장애(ADHD) 진단용 프라이머 세트, 이를 포함하는 한국인의 주의력결핍 과잉행동장애 진단용 키트 및 이를 이용한 주의력결핍 과잉행동장애 위험도의 예측 방법을 제공하는 것이다. It is an object of the present invention to provide a primer set for the diagnosis of ADHD in Koreans, a kit for diagnosing Attention Deficit Hyperactivity Disorder in Koreans and a method for predicting the risk of ADHD.

그러나, 본 발명이 해결하고자 하는 과제는 이상에서 언급한 과제로 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 해당 기술분야의 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.However, the problems to be solved by the present invention are not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

본 발명의 일 실시예는, 서열번호 1의 정방향 프라이머와 서열번호 2의 역방향 프라이머로 이루어진 제1 프라이머 쌍; 서열번호 3의 정방향 프라이머와 서열번호 4의 역방향 프라이머로 이루어진 제2 프라이머 쌍; 서열번호 5의 정방향 프라이머와 서열번호 6의 역방향 프라이머로 이루어진 제3 프라이머 쌍; 서열번호 7의 정방향 프라이머와 서열번호 8의 역방향 프라이머로 이루어진 제4 프라이머 쌍; 및 서열번호 9의 정방향 프라이머와 서열번호 10의 역방향 프라이머로 이루어진 제5 프라이머 쌍;으로부터 선택된 적어도 하나 이상의 프라이머 쌍을 포함하는 한국인의 주의력결핍 과잉행동장애(ADHD) 진단용 프라이머 세트를 제공한다. One embodiment of the present invention comprises a first primer pair consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2; A second primer pair consisting of the forward primer of SEQ ID NO: 3 and the reverse primer of SEQ ID NO: 4; A third primer pair consisting of the forward primer of SEQ ID NO: 5 and the reverse primer of SEQ ID NO: 6; A fourth primer pair consisting of the forward primer of SEQ ID NO: 7 and the reverse primer of SEQ ID NO: 8; And a fifth primer pair consisting of a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10; and a pair of at least one primer selected from the group consisting of a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10.

일측에 따르면, 상기 제1 프라이머 쌍은, LPHN3 유전자 내 rs6551665 단일염기다형성(single　nucleotide　polymorphism, SNP)에 특이적으로 결합하고, 상기 제2 프라이머 쌍은, FKBP5 유전자 내 rs7748266 SNP에 특이적으로 결합하고, 상기 제3 프라이머 쌍은, MAOA 유전자 내 rs6323 SNP에 특이적으로 결합하고, 상기 제4 프라이머 쌍은, GSTT1 유전자에 특이적으로 결합하고, 상기 제5 프라이머 쌍은, DAT1 유전자 내 종열반복변이(variable number of tandem repeat, VNTR)에 특이적으로 결합할 수 있다. According to one aspect, the first primer pair specifically binds to rs6551665 single nucleotide polymorphism (SNP) in the LPHN3 gene and the second primer pair specifically binds to rs7748266 SNP in the FKBP5 gene , The third primer pair specifically binds to the rs6323 SNP in the MAOA gene, the fourth primer pair specifically binds to the GSTT1 gene, and the fifth primer pair comprises a repeating mutation in the DAT1 gene variable number of tandem repeats, VNTR).

본 발명의 다른 일 실시예는, 상기 프라이머 세트를 포함하는 한국인의 주의력결핍 과잉행동장애 진단용 키트를 제공한다. Another embodiment of the present invention provides a kit for diagnosing attention deficit hyperactivity disorder in a Korean person including the primer set.

본 발명의 또 다른 일 실시예는, 피검체 유래의 생물학적 시료로부터 게놈 DNA를 분리하는 단계; 및 상기 프라이머 세트를 이용하여, 멀티플렉스 PCR(Multiplex-Polymerase Chain Reaction; multiplex PCR)로 LPHN3 유전자 내 rs6551665 SNP, FKBP5 유전자 내 rs7748266 SNP, MAOA 유전자 내 rs6323 SNP, GSTT1 유전자, 또는 DAT1 유전자를 확인하는 단계를 포함하는, 한국인의 주의력결핍 과잉행동장애 위험도의 예측 방법을 제공한다. According to another embodiment of the present invention, there is provided a method for producing a biological sample, comprising: separating genomic DNA from a biological sample derived from a subject; And confirming rs6551665 SNP in the LPHN3 gene, rs7748266 SNP in the FKBP5 gene, rs6323 SNP in the MAOA gene, GSTT1 gene, or DAT1 gene using multiplex PCR , Which is a method of predicting the risk of attention deficit hyperactivity disorder in Koreans.

일측에 따르면, 상기 생물학적 시료는, 머리카락, 혈액, 조직, 세포, 혈청, 혈장, 타액, 객담 및 소변 중 하나 이상일 수 있다.According to one aspect, the biological sample may be at least one of hair, blood, tissue, cells, serum, plasma, saliva, sputum and urine.

일측에 따르면, 상기 한국인의 주의력결핍 과잉행동장애 위험도의 예측 방법은, DAT1 유전자에 대해서, 인간 염색체 5 번의 3'UTR에서 VNTR이 40 bp의 단위로 반복해서 나타내는지를 확인하는 것; 상기 LPHN3 유전자 내 rs6551665 SNP에 대하여, 인간 염색체 4 번의 61873823번째 염기 위치에서 rs6551665 SNP 대립유전자형이 A/G를 나타내는지 확인하는 것; 상기 FKBP5 유전자 내 rs7748266 SNP에 대하여, 인간 염색체 6 번의 35624967번째 염기 위치에서 rs7748266 SNP 대립유전자형이 C/T를 나타내는지 확인하는 것; 상기 MAOA 유전자 내 rs6323 SNP에 대하여, 인간 염색체 X번의 43731789번째 염기 위치에서 rs6323 SNP 대립유전자형이 G/T를 나타내는지 확인하는 것; 또는 상기 GSTT1 유전자에 대하여, 인간 염색체 22번에서 상기 GSTT1 유전자가 존재하거나 존재하지 않는지를 확인하는 것;일 수 있다.According to one, the method for predicting the risk of attention deficit hyperactivity disorder in Koreans is to confirm that the DAT1 gene repeatedly shows the VNTR in the 3 'UTR of human chromosome 5 repeatedly in units of 40 bp; Confirming whether the rs6551665 SNP allele genotype at the 61873823 base position of human chromosome 4 indicates A / G for the rs6551665 SNP in the LPHN3 gene; Confirming whether the rs7748266 SNP allele genotype at the 35624967 base position of human chromosome 6 indicates C / T for the rs7748266 SNP in the FKBP5 gene; Confirming that the rs6323 SNP allele genotype at the 43731789th base position of human chromosome X indicates G / T for the rs6323 SNP in the MAOA gene; Or confirming whether the GSTT1 gene is present or absent on the human chromosome 22 with respect to the GSTT1 gene.

본 발명의 한국인의 주의력결핍 과잉행동장애(ADHD) 진단용 프라이머 세트, 이를 포함하는 진단용 키트, 및 한국인의 주의력결핍 과잉행동장애 위험도의 예측 방법을 이용하여, 한국인에서의 주의력결핍 과잉행동장애와 관련 있는 유전자 마커를 발굴하고, 이를 이용하여 한국인 ADHD를 조기에 예측가능하고, ADHD 예측을 위한 유전자 분석 시스템을 확립하고자 한다. Using a primer set for the diagnosis of ADHD, a diagnostic kit comprising the same, and a method for predicting the risk of attention deficit hyperactivity disorder in Koreans, the present invention relates to the use of a primer set for the diagnosis of attention deficit hyperactivity disorder We will identify genetic markers and use them to establish a genetic analysis system for ADHD predictions and ADHD predictions early in the Korean population.

도 1a 및 1b는, PCR 또는 PCR-RFLP 생산물의 전기영동의 결과를 나타낸 것이다.
도 2는, 멀티플렉스 PCR(Multiplex-Polymerase Chain Reaction; multiplex PCR)에 의한 DAT1 유전자 VNTR 변이체에 대한 전기영동의 결과를 나타낸 것이다.
도 3은 SNaPshot 분석 방법을 도시적으로 나타낸 것이다.
도 4는, 4 가지 유전자의 다형성(polymorphisms) 검출을 위한 SNaPshot 분석의 결과를 나타낸 것이다. Figures 1a and 1b show the results of electrophoresis of PCR or PCR-RFLP products.
FIG. 2 shows the results of electrophoresis on VNTR mutants of the DAT1 gene by multiplex PCR (Multiplex-Polymerase Chain Reaction; multiplex PCR).
3 schematically shows the SNaPshot analysis method.
Figure 4 shows the results of SNaPshot analysis for the detection of polymorphisms in four genes.

이하에서, 첨부된 도면을 참조하여 실시예들을 상세하게 설명한다. 각 도면에 제시된 동일한 참조 부호는 동일한 부재를 나타낸다. 아래 설명하는 실시예들에는 다양한 변경이 가해질 수 있다. 아래 설명하는 실시예들은 실시 형태에 대해 한정하려는 것이 아니며, 이들에 대한 모든 변경, 균등물 내지 대체물을 포함하는 것으로 이해되어야 한다.In the following, embodiments will be described in detail with reference to the accompanying drawings. Like reference symbols in the drawings denote like elements. Various modifications may be made to the embodiments described below. It is to be understood that the embodiments described below are not intended to limit the embodiments, but include all modifications, equivalents, and alternatives to them.

실시예에서 사용한 용어는 단지 특정한 실시예를 설명하기 위해 사용된 것으로, 실시예를 한정하려는 의도가 아니다. 단수의 표현은 문맥상 명백하게 다르게 뜻하지 않는 한, 복수의 표현을 포함한다. 본 명세서에서, "포함하다" 또는 "가지다" 등의 용어는 명세서 상에 기재된 구성을 조합한 것이 존재함을 지정하려는 것이지, 하나 또는 그 이상의 다른 구성들 또는 이들을 조합한 것들의 존재 또는 부가 가능성을 미리 배제하지 않는 것으로 이해되어야 한다. 다르게 정의되지 않는 한, 기술적이거나 과학적인 용어를 포함해서 여기서 사용되는 모든 용어들은 실시예가 속하는 기술 분야에서 통상의 지식을 가진 자에 의해 일반적으로 이해되는 것과 동일한 의미를 가지고 있다. 일반적으로 사용되는 사전에 정의되어 있는 것과 같은 용어들은 관련 기술의 문맥 상 가지는 의미와 일치하는 의미를 가지는 것으로 해석되어야 하며, 본 출원에서 명백하게 정의하지 않는 한, 이상적이거나 과도하게 형식적인 의미로 해석되지 않는다.The terms used in the examples are used only to illustrate specific embodiments and are not intended to limit the embodiments. The singular expressions include plural expressions unless the context clearly dictates otherwise. In this specification, the terms "comprises" or "having" are used to specify that a combination of features described in the specification is present, and that the presence or addition of one or more other features, or combinations thereof, It should be understood that it is not excluded in advance. Unless defined otherwise, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which this embodiment belongs. Terms such as those defined in commonly used dictionaries are to be interpreted as having a meaning consistent with the contextual meaning of the related art and are to be interpreted as either ideal or overly formal in the sense of the present application Do not.

본 발명자는, 한국인에서의 주의력결핍 과잉행동장애(ADHD) 진단용 키트를 제공하기 위해서, 한국인 ADHD 환자에 대한 유전자를 획득하여, 한국인의 ADHD와 유의한 연관성을 나타낸 유전자 프로파일을 확립하였다. The present inventors obtained a gene for a Korean ADHD patient and established a gene profile showing a significant association with Korean ADHD in order to provide a kit for the diagnosis of ADHD in Korean.

본 발명의 일 실시예에 따르면, 서열번호 1의 정방향 프라이머와 서열번호 2의 역방향 프라이머로 이루어진 제1 프라이머 쌍; 서열번호 3의 정방향 프라이머와 서열번호 4의 역방향 프라이머로 이루어진 제2 프라이머 쌍; 서열번호 5의 정방향 프라이머와 서열번호 6의 역방향 프라이머로 이루어진 제3 프라이머 쌍; 서열번호 7의 정방향 프라이머와 서열번호 8의 역방향 프라이머로 이루어진 제4 프라이머 쌍; 및 서열번호 9의 정방향 프라이머와 서열번호 10의 역방향 프라이머로 이루어진 제5 프라이머 쌍;으로부터 선택된 적어도 하나 이상의 프라이머 쌍을 포함하는 한국인의 주의력결핍 과잉행동장애(ADHD) 진단용 프라이머 세트를 제공한다. According to an embodiment of the present invention, a first primer pair consisting of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2; A second primer pair consisting of the forward primer of SEQ ID NO: 3 and the reverse primer of SEQ ID NO: 4; A third primer pair consisting of the forward primer of SEQ ID NO: 5 and the reverse primer of SEQ ID NO: 6; A fourth primer pair consisting of the forward primer of SEQ ID NO: 7 and the reverse primer of SEQ ID NO: 8; And a fifth primer pair consisting of a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10; and a pair of at least one primer selected from the group consisting of a forward primer of SEQ ID NO: 9 and a reverse primer of SEQ ID NO: 10.

프라이머는 짧은 자유 3' 말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로 상보적인 주형(template)과 염기쌍을 형성할 수 있고 주형 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 즉, 프라이머는 적절한 버퍼 중의 적절한 조건(예를 들면, 4개의 다른 뉴클레오시드 트리포스페이트 및 DNA, DNA 폴리머라제 효소와 같은 중합제) 및 적당한 온도 하에서 주형-지시 DNA 합성을 개시할 수 있는 단일가닥 올리고뉴클레오티드를 말하는 것이다. 본 발명의 일 실시예에 따른 프라이머 세트는 한국인의 ADHD에 특이적인 유전자를 증폭할 수 있도록 디자인된 프라이머 쌍 세트일 수 있다. PCR　프라이머 세트는 AHDH에 대하여 특이성을 가지고 있을 뿐만 아니라, 특이 유전자를 서로 다른 크기로 증폭시킬 수 있기 때문에, 다양한 유전자를 동시에 신속하게 구별하여 확인할 수 있다. A primer is a short nucleic acid sequence that can form a base pair with a complementary template with a short free 3 'hydroxyl group and serves as a starting point for template strand replication . That is, the primer can be a single strand capable of initiating template-directed DNA synthesis under appropriate conditions in an appropriate buffer (e.g., four different nucleoside triphosphates and DNA, a polymerase such as a DNA polymerase enzyme) Refers to oligonucleotides. The primer set according to one embodiment of the present invention may be a pair of primers designed to amplify a gene specific to ADHD in Korean. The PCR primer set not only has specificity for AHDH but also can amplify specific genes at different sizes, so that various genes can be rapidly identified at the same time.

본 발명의 다른 일 실시예에 따르면, 상기 프라이머 세트를 포함하는 한국인의 주의력결핍 과잉행동장애 진단용 키트를 제공한다. 키트는 멀티플렉스 PCR 증폭 반응 및/또는 SNaPshot 분석을 수행하기 위해 DNA 폴리머라제, dNTPs, 완충액 등을 포함할 수 있다.According to another embodiment of the present invention, there is provided a kit for diagnosing attention deficit hyperactivity disorder in a Korean person comprising the primer set. The kits may include DNA polymerases, dNTPs, buffers, etc. to perform multiplex PCR amplification reactions and / or SNaPshot analysis.

본 발명의 또 다른 일 실시예에 따르면, 피검체 유래의 생물학적 시료로부터 게놈 DNA를 분리하는 단계; 및 청구항 제1항의 프라이머 세트를 이용하여, 멀티플렉스 PCR(Multiplex-Polymerase Chain Reaction; multiplex PCR)로 LPHN3 유전자 내 rs6551665 SNP, FKBP5 유전자 내 rs7748266 SNP, MAOA 유전자 내 rs6323 SNP, GSTT1 유전자, 및 DAT1 유전자를 확인하는 단계;를 포함하는, 한국인의 주의력결핍 과잉행동장애 위험도의 예측 방법을 제공한다. According to another embodiment of the present invention, there is provided a method for detecting a biological sample, comprising: separating a genomic DNA from a biological sample derived from a subject; Rs6551665 SNP in the LPHN3 gene, rs7748266 SNP in the FKBP5 gene, rs6323 SNP in the MAOA gene, GSTT1 gene, and DAT1 gene were amplified by multiplex PCR using multiplex PCR And identifying the risk of attention deficit hyperactivity disorder in the Korean population.

일측에 따르면, 생물학적 시료는, 머리카락, 혈액, 조직, 세포, 혈청, 혈장, 타액, 객담 및 소변 중 하나 이상일 수 있다. 게놈 DNA를 분리하는 방법은, 해당 기술분야의 통상의 기술자에게 널리 알려진 방법으로 수행될 수 있으며, 보다 구체적으로, 효소 또는 화학적 방법에 의하여 DNA를 단백질, RNA 및 기타 물질과 같은 오염 물질로부터 실질적으로 분리하는 것을 포함할 수 있으나, 이에 제한되는 것은 아니다.According to one aspect, the biological sample can be at least one of hair, blood, tissue, cells, serum, plasma, saliva, sputum and urine. Methods for isolating genomic DNA can be performed by methods well known to those of ordinary skill in the art, and more specifically, by enzymatic or chemical methods, DNA can be substantially isolated from contaminants such as proteins, RNA, Including, but not limited to,

한국인의 주의력결핍 과잉행동장애 위험도를 예측하기 위해 사용된 멀티플렉스 PCR(multiplex PCR)은 복수의 프라이머 세트를 사용하여 동시에 1개의 반응 튜브 내에서　PCR　증폭하는 방법을 말한다. 따라서, PCR　프라이머 세트는 AHDH에 대한 특정 유전자를 서로 다른 크기로 증폭시킬 수 있기 때문에, 다양한 유전자를 동시에 신속하게 구별하여 확인할 수 있다. 멀티플렉스　PCR은 본 분야의 통상의 기술자에게 알려진 방법으로 수행될 수 있다. Multiplex PCR, used to predict the risk of attention deficit hyperactivity disorder in Koreans, refers to PCR amplification in one reaction tube at the same time using multiple sets of primers. Therefore, since the PCR primer set can amplify specific genes for AHDH to different sizes, various genes can be rapidly identified at the same time. Multiplex PCR can be performed by methods known to those of ordinary skill in the art.

한국인의 주의력결핍 과잉행동장애 위험도의 예측 방법은 유전자를 확인하는 단계를 포함한다. 유전자를 확인하는 방법은 당해 분야에서 공지된 다양한 방법을 이용하여 수행될 수 있다. 예를 들어, DNA 서열분석(sequencing), PCR-SSCP(single stranded conformation polymorphism) 분석, PCR-RFLP(restriction fragment length polymorphism) 분석, 대립형질(allele) 특이적 혼성화 방법, DNA 칩 방법, ELISA(enzyme-linked immunosorbent assay) 방법 및 면역블랏 (immunoblot) 방법,　SNaPShot　분석 방법, TDGS(Two-dimensional Gene Scanning), Taq-Man^® 및 TOGATM으로 구성된 군으로부터 선택된 하나 이상의 방법에 의해 수행되는 것을 특징으로 하는 방법을 포함하나, 이에 한정되는 것은 아니다. 바람직하게는 SNaPshot 분석 방법을 사용할 수 있다. Methods for predicting the risk of attention deficit hyperactivity disorder in Koreans include identifying genes. Methods for identifying genes can be performed using a variety of methods known in the art. For example, DNA sequencing, PCR-SSCP (single stranded conformation polymorphism) analysis, PCR-restriction fragment length polymorphism (PCR) analysis, allele- specific hybridization method, DNA chip method, ELISA -linked immunosorbent assay) characterized in that the method and the immune blot (immunoblot) method, SNaPShot analysis, TDGS (Two-dimensional Gene Scanning ), performed by one or more methods selected from the group consisting of Taq-Man ^® and TOGATM But are not limited thereto. Preferably, the SNaPshot analysis method can be used.

도 3은 SNaPshot 분석 방법을 도시적으로 나타낸 것이다. 도 3에 나타낸 바와 같이, SNaPshot 분석 방법은 Single base pair primer extension assay의 원리를 이용하여 Single base extension(SBE)을 하는 것이다(http://www.vicc.org/). Single base extension 반응은 디데옥시뉴클레오티드(dideoxynucleotides)(terminator)의 존재 하에 cycle sequencing을 하는 것이 핵심인　기술이고, terminator가 DNA 가닥으로 끼어 들어가면 더 이상의 연장(extension)은 진행되지 않는다. 이때 사용되는 디데옥시뉴클레오티드를 각각 다른 염료(dye)로 표지(label)함으로써 Cycle sequencing을 통해 연장된 단 하나의 특정 뉴클레오티드를 검출할 수 있게 된다. 또한, 도 4는 4 개의 유전자의 다형성(polymorphisms) 검출을 위한 SNaPshot 분석의 결과를 나타낸 것이다. 3 schematically shows the SNaPshot analysis method. As shown in FIG. 3, the SNaPshot analysis method is a single base extension (SBE) using the principle of single base pair primer extension assay (http://www.vicc.org/). Single base extension reaction is the key technique for performing cycle sequencing in the presence of dideoxynucleotides (terminator), and no further extension occurs when the terminator is inserted into the DNA strand. By labeling the dideoxynucleotides used with different dyes, it is possible to detect only one specific nucleotide extended through cycle sequencing. Figure 4 also shows the results of SNaPshot analysis for the detection of polymorphisms in four genes.

SNaPshot 분석방법에는 형광이 부착된 디데옥시뉴클레오티드 존재 하에서 단일 염기 다형성 위치를 포함하는 인접부위에서부터 증폭하여 단일 염기 다형성 바로 앞까지 붙도록 제작된　유전자형 분석 프라이머를 필요로 한다. SNaPshot 분석 방법을 위해 사용된 프라이머는 서열번호 11의 정방향 프라이머, 서열번호 12의 정방향 프라이머, 서열번호 13의 정방향 프라이머, 및 서열번호 14의 정방향 프라이머로부터 선택된 적어도 하나 이상의 타이핑 프라이머(typing primer)를 포함한다. 상기 서열번호 11의 프라이머는, LPHN3 유전자 내 rs6551665 SNP에 특이적으로 결합하고, 상기 서열번호 12의 프라이머는, FKBP5 유전자 내 rs7748266 SNP에 특이적으로 결합하고, 상기 서열번호 13의 프라이머는, MAOA 유전자 내 rs6323 SNP에 특이적으로 결합하고, 상기 서열번호 14의 프라이머는, GSTT1 유전자에 특이적으로 결합할 수 있다. The SNaPshot analysis method requires a genotyping primer designed to be amplified from adjacent sites containing a single base polymorphic site in the presence of fluorescently attached dideoxynucleotides and attached to the site immediately before the single base polymorphism. The primers used for the SNaPshot analysis method include at least one typing primer selected from a forward primer of SEQ ID NO: 11, a forward primer of SEQ ID NO: 12, a forward primer of SEQ ID NO: 13, and a forward primer of SEQ ID NO: 14 do. Wherein the primer of SEQ ID NO: 11 specifically binds to rs6551665 SNP in the LPHN3 gene, the primer of SEQ ID NO: 12 specifically binds to rs7748266 SNP in the FKBP5 gene, and the primer of SEQ ID NO: And specifically binds to the rs6323 SNP, and the primer of SEQ ID NO: 14 can specifically bind to the GSTT1 gene.

일 실시예에 따르면, 상기 한국인의 주의력결핍 과잉행동장애 위험도의 예측 방법은, DAT1 유전자에 대해서, 인간 염색체 5 번의 3'UTR에서 VNTR이 40 bp의 단위로 반복해서 나타내는지를 확인하는 것; 상기 LPHN3 유전자 내 rs6551665 SNP에 대하여, 인간 염색체 4 번의 61873823번째 염기 위치에서 rs6551665 SNP 대립유전자형이 A/G를 나타내는지 확인하는 것; 상기 FKBP5 유전자 내 rs7748266 SNP에 대하여, 인간 염색체 6 번의 35624967번째 염기 위치에서 rs7748266 SNP 대립유전자형이 C/T를 나타내는지 확인하는 것; 상기 MAOA 유전자 내 rs6323 SNP에 대하여, 인간 염색체 X번의 43731789번째 염기 위치에서 rs6323 SNP 대립유전자형이 G/T를 나타내는지 확인하는 것; 또는 상기 GSTT1 유전자에 대하여, 인간 염색체 22번에서 상기 GSTT1 유전자가 존재하거나 존재하지 않는지를 확인하는 것;일 수 있다. According to one embodiment, the method for predicting the risk of Attention Deficit Hyperactivity Disorder in Koreans is to confirm that the DAT1 gene repeatedly shows the VNTR in units of 40 bp in the 3'UTR of human chromosome 5; Confirming whether the rs6551665 SNP allele genotype at the 61873823 base position of human chromosome 4 indicates A / G for the rs6551665 SNP in the LPHN3 gene; Confirming whether the rs7748266 SNP allele genotype at the 35624967 base position of human chromosome 6 indicates C / T for the rs7748266 SNP in the FKBP5 gene; Confirming that the rs6323 SNP allele genotype at the 43731789th base position of human chromosome X indicates G / T for the rs6323 SNP in the MAOA gene; Or confirming whether the GSTT1 gene is present or absent on the human chromosome 22 with respect to the GSTT1 gene.

이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

본 발명의 실시예는 하기와 같은 방법으로 수행되었다.An embodiment of the present invention was carried out in the following manner.

실시예Example 1. 한국인의 1. Korean ADHD에On ADHD 특이적인 유전자 확인 Identifying specific genes

본 연구에서는 ADHD 예측키트 개발을 위해 이전에 여러 민족 집단에서 ADHD와의 유의한 연관성을 보인 유전자와 이들 유전자 내에 포함된 총 14개의 특정 변이체들을 하기와 같이 선정하였다. In order to develop the ADHD prediction kit, we selected genes with significant association with ADHD and a total of 14 specific variants contained in these genes in the following ethnic groups.

[표 1][Table 1]

한국인을 기반으로 150명의 ADHD 환자 및 322명의 정상 대조군을 대상으로 유전자형 세트 및 유전자를 분석하였다. 분석을 위해서 PCR 또는 PCR-RELP 방법, 및 전기영동 방법을 사용하여 실행하였다. 각각의 유전자들을 증폭하기 위한 PCR 조건은 표 2에 기재된 바와 같다. Based on the Korean population, genotype sets and genes were analyzed for 150 ADHD patients and 322 normal controls. For analysis, PCR or PCR-RELP method and electrophoresis method were used. PCR conditions for amplifying the respective genes are as shown in Table 2.

[표 2][Table 2]

유전자 MAOA_VNTR, GSTM1_in/del, GSTT1_in/del, DAT1_VNTR 및 5- HTT_VNTR에 대해서, 상기 기재된 PCR 조건 하에서 PCR을 실행하고 이를 전기영동하여 해당 유전자의 크기를 확인함으로써, 한국인의 ADHD 환자 및 정상 대조군에서의 해당 유전자별로 차이를 확인할 수 있다(도 1).By executing a PCR under the conditions described in PCR for the MAOA gene _VNTR, GSTM1 _in / del, GSTT1 _in / del, DAT1 and _VNTR 5- HTT _VNTR and determine the size of the gene of this by electrophoresis, in Korean patients with ADHD and Differences in the respective genes in the normal control group can be confirmed (Fig. 1).

MAOA(VNTR)에서는 ADHD의 경우에서 남아에서 총 97명의 환아 중 64명에서 3.5 Repeat가 33명에서 4.5 Repeat가 관찰되었으며, 여아에서 16명에서 3.5 Repeat/3.5 Repeat, 33명에서 3.5 Repeat/4.5 Repeat, 4명에서 4.5 Repeat/4.5 Repeat가 관찰되었다. 대조군의 경우 남아에서 109명의 3.5 Repeat와 79명의 4.5 Repeat가 관찰되었으며, 여아의 경우 48명에서 3.5 Repeat/3.5 Repeat, 56명에서 3.5 Repeat/4.5 Repeat, 27명에서 4.5 Repeat/4.5 Repeat가 관찰되었다. 환자 및 대조군 사이의 유전자형 및 대립 인자 빈도 분석 결과, 통계적으로 유의한 차이는 발견되지 않았다(p > 0.05). In the MAOA (VNTR), 3.5 repetitions were observed in 3.5 out of 97 boys in the boys, 3.5 repeat in 33 boys, 3.5 Repeat / 3.5 Repeat in 16 boys, 3.5 Repeat / 4.5 Repeat in 33 boys , 4.5 Repeat / 4.5 Repeat was observed in 4 patients. In the control group, 109 reporters and 79 reporters were observed in 109 boys and 79 reporters. In girls, 3.5 Repeat / 3.5 Repeat was observed in 48 children, 3.5 Repeat / 4.5 Repeat in 56 children, and 4.5 Repeat / 4.5 Repeat in 27 children . There was no statistically significant difference ( p > 0.05) between genotype and allele frequency analysis between patient and control group.

GSTM1(in/del)에서 ADHD 환아(Present 115명/243명; Null 128명/243명)와 대조군(Present 154명/327명; Null 173명/327명) 사이의 다형 빈도 분석에서는 통계적인 유의한 차이가 발견되지 않았다(p > 0.05) In polymorphism analysis between ADHD (Present 115/243; Null 128/243) and control (Present 154/327; Null 173/327 ) in GSTM1 (in / del) No differences were found ( p > 0.05)

GSTT1(in/del)에서는, ADHD의 3가지 증상 중 주의력 결핍을 보이는 남아에서 대조군 보다 더 많은 빈도의 null 타입이 관찰되었으며(환아: 39명/50명, 대조군: 112명/196명), 통계적으로 유의한 차이를 보여주었다(p < 0.05). In GSTT1 (in / del), more frequent null types were observed in patients with attention deficit among the three ADHD symptoms (control group: 39 patients / 50 patients, control group: 112 patients / 196 patients) ( P <0.05), respectively.

DAT1(VNTR)에서는 ADHD 환아인 경우에 Long repeat genotype(10 Repeat/11 Repeat)을 갖는 환자는 1명이었지만(0.7%), 대조군에서는 14명의 Long repeat genotype(10 Repeat/11 Repeat)이 관찰되었으며(4.4%), 통계적으로 유의한 차이를 보여주었다(p < 0.05). In DAT1 (VNTR), one patient had a long repeat genotype (10 Repeat / 11 Repeat) in ADHD patients (0.7%) and 14 repeat repeat genotypes (10 Repeat / 11 Repeat) in the control group 4.4%), showing statistically significant differences ( p <0.05).

5- HTT(VNTR)에서는 환자와 대조군 모두에서 14 ~ 16 Repeat가 관찰되었으며, 통계적인 유의한 차이는 보이지 않았다(p > 0.05). In the 5- HTT (VNTR), 14-16 replicates were observed in both the patient and the control group, but there was no statistically significant difference ( p > 0.05).

또한, 유전자 LPHN3_rs6551665, LPHN3_rs6858066, LPHN3 _rs2345039, FKBP5_rs7748266, FKBP5_rs9394309, MAOA_rs6323, DISC1_rs821616, DISC1_rs3738401, GSTP1_rs947894에 대해서, 상기 기재된 PCR 조건 하에서 PCR을 실행한 후에 RFLP(Restriction Fragment Length Polymorphism; 제한효소절편다형성)을 통해 검출하였고, 이를 아가로스 겔을 이용한 전기영동을 통해 확인하였다. 하기 표 3에 나타낸 바와 같이, 각각의 유전자(LPHN3_rs6551665, LPHN3_rs6858066, LPHN3_rs2345039, FKBP5_rs7748266, FKBP5_rs9394309, MAOA_rs6323, DISC1_rs821616, DISC1_rs3738401, GSTP1_rs947894)에 대한 10 ㎕의 PCR 증폭산물에 1 unit의 각각의 해당하는 제한효소를 첨가한 다음 해당 온도에서 약 3 시간 이상 반응시켰다. PCR 증폭산물을 제한효소로 각각 절단하여 얻어진 DNA 단편은 TAE buffer를 이용하여 3 % 아가로스 겔에 약 100 volt 전압으로 약 30분 동안 전기영동하고 loading dye로 염색한 후, DNA 단편의 크기를 관찰하여 한국인의 ADHD 환자 및 정상 대조군에서의 해당 유전자별로 차이를 확인할 수 있다.In addition, the gene LPHN3 _rs6551665, LPHN3 _rs6858066, LPHN3 _ rs2345039, FKBP5 _rs7748266, FKBP5 _rs9394309, MAOA _rs6323, DISC1 _rs821616, DISC1 _rs3738401, for GSTP1 _rs947894, after performing the PCR under the above described PCR conditions Restriction Fragment Length (RFLP Polymorphism; Restriction fragment length polymorphism) and confirmed by electrophoresis using agarose gel. As shown in following Table 3, each of the gene 1 unit in the PCR amplification product of 10 ㎕ for (LPHN3 _rs6551665, LPHN3 _rs6858066, LPHN3_ rs2345039, FKBP5 _rs7748266, FKBP5 _rs9394309, MAOA _rs6323, DISC1 _rs821616, DISC1 _rs3738401, GSTP1 _rs947894) Of the corresponding restriction enzymes were added, and the reaction was carried out at the temperature for about 3 hours or longer. The DNA fragments obtained by digesting the PCR amplification products with restriction enzymes were electrophoresed on a 3% agarose gel using TAE buffer at a voltage of about 100 volts for about 30 minutes, stained with loading dye, and the size of the DNA fragment was observed , And the differences in the respective genes in ADHD patients and normal controls of Koreans can be confirmed.

[표 3][Table 3]

도 1a 및 1b는 PCR 또는 PCR-RFLP(Restriction Fragment Length Polymorphism; 제한효소절편길이다형성)을 통해 검출한 전기영동 사진을 나타낸 것이다. 이를 자세히 살펴보면, LPHN3(rs6551665)에서 ADHD 환아인 경우에 2개의 제한효소 인지부위가 존재하여 64, 99 및 139 bp 크기를 갖는 GG 타입의 DNA 밴드가 대조군 보다 약 3배 이상 많은 것으로 관찰되었다(p < 0.05). 1A and 1B show electrophoresis images detected by PCR or PCR-RFLP (Restriction Fragment Length Polymorphism). In detail, in the case of ADHD in LPHN3 (rs6551665), two restriction endonuclease recognition sites existed, and the DNA bands of GG type having 64, 99 and 139 bp sizes were found to be about 3 times more than the control group ( p &Lt; 0.05).

LPHN3(rs6858066)에서는 ADHD 환아와 대조군에서 각 유전자형에 따른 G/G 타입:408 bp; G/A 타입: 408 bp, 241 bp 및 167 bp; A/A 타입: 241 bp 및 167 bp의 DNA 밴드가 관찰되었으며, 통계적으로 유의한 차이는 발견되지 않았다(p > 0.05). In LPHN3 (rs6858066), G / G type according to each genotype in ADHD patients and control group: 408 bp; G / A type: 408 bp, 241 bp and 167 bp; DNA bands of A / A type: 241 bp and 167 bp were observed and no statistically significant difference was found ( p > 0.05).

LPHN3(rs2345039)에서는 ADHD 환아와 대조군에서 각 유전자형에 따른 C/C 타입:733 bp, 283 bp 및 184 bp; C/G 타입: 733 bp, 283 bp, 184 bp 및 148 bp; G/G 타입: 733 bp, 283 bp 및 148 bp의 DNA 밴드가 관찰되었으며, 통계적으로 유의한 차이는 발견되지 않았다(p > 0.05). In LPHN3 (rs2345039), C / C type according to each genotype in ADHD patients and control group: 733 bp, 283 bp and 184 bp; C / G type: 733 bp, 283 bp, 184 bp and 148 bp; G / G type: 733 bp, 283 bp and 148 bp DNA bands were observed, but no statistically significant difference was found ( p > 0.05).

FKBP5(rs7748266)에서는 ADHD 환아와 대조군에서 각 유전자형에 따른 C/C 타입: 407 bp; C/T 타입: 407 bp, 226 bp 및 181 bp; T/T 타입: 226 bp 및 181 bp의 DNA 밴드가 관찰되었으며, ADHD 환아에서 대조군 보다 약 2배 이상의 T/T 빈도를 가지는 것으로 확인되었다(p < 0.05). In FKBP5 (rs7748266), C / C type according to each genotype in ADHD and control group: 407 bp; C / T type: 407 bp, 226 bp and 181 bp; T / T type: DNA bands of 226 bp and 181 bp were observed, and it was confirmed that ADHD patients had about 2 times more T / T frequency than the control group ( p <0.05).

FKBP5(rs9394309)에서는 ADHD 환아와 대조군에서 각 유전자형에 따른 A/A 타입:307 bp, 93 bp; A/G 타입: 307 bp, 228 bp, 93 bp 및 79 bp; G/G 타입: 228 bp, 93 bp 및 79 bp의 DNA 밴드가 관찰되었으며, 통계적으로 유의한 차이는 발견되지 않았다(p > 0.05). In FKBP5 (rs9394309), A / A type according to each genotype in ADHD and control group: 307 bp, 93 bp; A / G type: 307 bp, 228 bp, 93 bp and 79 bp; G / G type: 228 bp, 93 bp and 79 bp DNA bands were observed, and no statistically significant difference was found ( p > 0.05).

MAOA(rs6323)에서는 ADHD 환아와 대조군에서 각 유전자형에 따른 G/G 타입: 65 bp; G/T 타입: 130 bp 및 98 bp; T/T 타입: 130 bp의 DNA 밴드가 관찰되었으며, 유전자형 및 대립인자 빈도에서 ADHD 환아와 대조군사이에 통계적으로 유의한 차이가 발견되었다(p < 0.05). In MAOA (rs6323), G / G type according to each genotype in ADHD patients and control group: 65 bp; G / T type: 130 bp and 98 bp; A DNA band of 130 bp was observed in T / T type, and a statistically significant difference was found between ADHD and control group in genotype and allele frequency ( p <0.05).

DISC1(rs821616)에서는 ADHD 환아와 대조군에서 각 유전자형에 따른 A/A 타입: 540 bp; A/T 타입: 540 bp, 336 bp및 204 bp; T/T 타입: 336 bp 및 204 bp의 DNA 밴드가 관찰되었으며, 통계적으로 유의한 차이는 발견되지 않았다(p > 0.05). In DISC1 (rs821616), A / A type according to each genotype in ADHD and control group: 540 bp; A / T type: 540 bp, 336 bp and 204 bp; T / T type: DNA bands of 336 bp and 204 bp were observed and no statistically significant difference was found ( p > 0.05).

DISC1(rs3738401)에서는 ADHD 환아와 대조군에서 각 유전자형에 따른 G/G 타입: 387 bp; G/A 타입: 387 bp, 221 bp 및 165 bp; A/A 타입: 221 bp 및 165 bp의 DNA 밴드가 관찰되었으며, 통계적으로 유의한 차이는 발견되지 않았다(p > 0.05). In DISC1 (rs3738401), G / G type according to each genotype in ADHD and control group: 387 bp; G / A type: 387 bp, 221 bp and 165 bp; DNA bands of 221 bp and 165 bp were observed in A / A type, and no statistically significant difference was found ( p > 0.05).

GSTP1(rs947894)에서는 ADHD 환아와 대조군에서 각 유전자형에 따른 A/A 타입: 176 bp; A/G 타입: 176 bp, 93 bp 및 83 bp; G/G 타입: 93 bp 및 83 bp의 DNA 밴드가 되었으며, 통계적으로 유의한 차이는 발견되지 않았다(p > 0.05). In GSTP1 (rs947894), A / A type according to each genotype in ADHD and control group: 176 bp; A / G type: 176 bp, 93 bp and 83 bp; G / G type: 93 bp and 83 bp DNA bands. No statistically significant difference was found ( p > 0.05).

이를 통해, LPHN3(rs6858066, rs2345039), FKBP5(rs9394309), MAOA(VNTR), DISC1(rs821616, rs3738401), GSTP1(rs947894), GSTM1(in/del), 5- HTT(VNTR) 유전자 내 특정변이체에서는 ADHD 환아와 대조군 사이에 유의한 빈도 차이를 보이지 않았다(p > 0.05). 반면에 LPHN3(rs6551665), FKBP5(rs7748266), MAOA(rs6323), GSTT1(in/del), DAT1(VNTR) 마커는 ADHD 환아와 대조군의 유전자형 및 대립인자 빈도에서 통계적으로 유의한 차이를 나타내었으며(p < 0.05), 한국인의 ADHD에 특이적인 유전자형, LPHN3(rs6551665), FKBP5(rs7748266), MAOA(rs6323), GSTT1(in/del), DAT1(VNTR)를 확인할 수 있었다. Through this, LPHN3 (rs6858066, rs2345039), FKBP5 (rs9394309), MAOA (VNTR), DISC1 (rs821616, rs3738401), GSTP1 (rs947894), GSTM1 (in / del), 5- HTT (VNTR) in certain variants within the gene There was no significant difference between the ADHD and control groups ( p > 0.05). In contrast, the LPHN3 (rs6551665), FKBP5 (rs7748266), MAOA (rs6323), GSTT1 (in / del) and DAT1 (VNTR) markers showed statistically significant differences in genotype and allele frequency of ADHD and control groups p <0.05). We could confirm genotypes specific to ADHD in Korea, LPHN3 (rs6551665), FKBP5 (rs7748266), MAOA (rs6323), GSTT1 (in / del) and DAT1 (VNTR).

실시예Example 2. 한국인의2. Korean ADHDADHD 발병과 관련 있는 Related to an outbreak 5 가지의Five 유전자들에 대한 For genes 하플로타입Haplotype 빈도 확인 Check frequency

상기 실시예 1을 통해 선별된 5 가지의 유전자들에 대해 ADHD 어린이와 대조군 사이에서 하플로타입 빈도는 SNPstats (https://www.snpstats.net/) web-based tool을 확인하였다.For the five genes selected in Example 1, the haplotype frequency between the ADHD children and the control group was confirmed by SNPstats (https://www.snpstats.net/) web-based tool.

자세한 내용은 하기의 표에 기재하였다.Details are given in the following table.

[표 4][Table 4]

ADHD 어린이 및 대조군 사이에서 rs6551665 및 rs7748266 하플로타입 빈도의 비교 Comparison of rs6551665 and rs7748266 haplotype frequencies between ADHD children and controls

상기 표에 기재된 바와 같이, ADHD 어린이의 rs6551665 및 rs7748266에서 G-C/A-T 하플로타입이 대조군보다 통계적으로 유의한 수준으로 높은 빈도로 관찰됨을 알 수 있다(p < 0.05).As shown in the table above, GC / AT haplotypes were observed at a statistically significant higher frequency ( p <0.05) in rs6551665 and rs7748266 of ADHD children than in the control group.

[표 5][Table 5]

ADHD 어린이 및 대조군 사이에서 rs6551665-rs7748266-DAT1 VNTR 하플로타입 빈도의 비교 Between ADHD children and controls rs6551665-rs7748266- DAT1 Comparison of VNTR haplotype frequencies

상기 표에 기재된 바와 같이, ADHD 어린이의 rs6551665-rs7748266-DAT1 VNTR 에서 G-S-C/A-S-T 하플로타입이 대조군보다 통계적으로 유의한 수준으로 높은 빈도로 관찰됨을 알 수 있다(p < 0.05).As shown in the table above, rs6551665-rs7748266- DAT1 of ADHD children In the VNTR, the GSC / AST haplotype was observed at a statistically significant higher frequency than the control group ( p <0.05).

[표 6][Table 6]

ADHD 어린이 및 대조군 사이에서 rs6551665-rs7748266-DAT1 VNTR-rs6323 하플로타입 빈도의 비교 Between ADHD children and controls rs6551665-rs7748266- DAT1 Comparison of VNTR-rs6323 Haplotype Frequency

상기 표에 기재된 바와 같이, ADHD 어린이의 rs6551665-rs7748266-DAT1 VNTR-rs6323에서 G-S-C-G/A-S-T-T 하플로타입이 대조군보다 통계적으로 유의한 수준으로 높은 빈도로 관찰됨을 알 수 있다(p < 0.05).As shown in the table above, rs6551665-rs7748266- DAT1 of ADHD children In the VNTR-rs6323, the GSCG / ASTT haplotype was observed at a statistically significant higher frequency than the control group ( p <0.05).

[표 7][Table 7]

ADHD 어린이 및 대조군 사이에서 rs6551665-rs7748266-DAT1 VNTR-rs6323-GSTT1 in/del 하플로타입 빈도의 비교 Between ADHD children and controls rs6551665-rs7748266- DAT1 Comparison of VNTR-rs6323- GSTT1 in / del haplo type frequencies

상기 표에 기재된 바와 같이, ADHD 어린이의 rs6551665-rs7748266-DAT1 VNTR-rs6323-GSTT1 in/del에서 A-S-T-T-I 하플로타입이 대조군보다 통계적으로 유의한 수준으로 높은 빈도로 관찰됨을 알 수 있다(p < 0.05).As shown in the table above, rs6551665-rs7748266- DAT1 of ADHD children VNTR-rs6323-ASTTI haplotype was observed at GSTT1 in / del at a statistically significant higher frequency than the control ( p <0.05).

따라서, 상기 표 4 내지 7의 내용을 통해 확인된 ADHD 환자에서 높은 빈도를 보이는 하플로타입들을 기준으로 ADHD의 예측이 가능함을 알 수 있다. Therefore, it can be seen that ADHD can be predicted based on haplotypes showing high frequency in ADHD patients confirmed through the contents of Tables 4 to 7 above.

실시예Example 3. 한국인의 3. Korean ADHDADHD 위험도의 예측 방법 How to predict risk

대상에서의 ADHD를 검출하기 위해서는, 5 개의 유전자를 동시에 증폭하기 위한 멀티플렉스 PCR 및 유전자 내 변이 유무의 확인을 위한 SNaPshot 분석 방법을 사용하였다. To detect ADHD in subjects, multiplex PCR for amplifying 5 genes simultaneously and SNaPshot analysis method for confirmation of mutation in the gene were used.

ADHD에 특이적인 유전자로 선정된 5 개의 유전자를 대상으로 멀티플렉스 PCR 프라이머 세트를 설계하였다. 하기 표 8에 PCR 프라이머 서열 및 멀티플렉스 PCR 산물의 크기를 나타내었다. A multiplex PCR primer set was designed for five genes selected as specific genes for ADHD. Table 8 below shows the PCR primer sequences and sizes of the multiplex PCR products.

[표 8][Table 8]

PCR 프라이머 서열 및 멀티플렉스 PCR 산물의 크기PCR primer sequence and the size of the multiplex PCR product

피검체 유래의 생물학적 시료로부터 게놈(genomic) DNA를 추출하였고, 분리된 게놈 DNA를 주형으로 상기 프라이머를 사용하여 멀티플렉스 PCR을 실시하였다.Genomic DNA was extracted from a biological sample derived from a subject, and multiplex PCR was performed using the above-described primer as a template for the separated genomic DNA.

멀티플렉스 PCR 반응은 20 ㎕ PCR반응 용액(2 ㎕의 10× 버퍼, 2 mM MgCl2, 1mM dNTPs, 10 pmol/㎕의 서열번호 1 내지 10의 프라이머)과 20 ng의 주형 DNA, 1 U의 NV DNA 중합효소(NAVI BioTech사, Korea)를 0.2 ㎖ PCR 반응 튜브에 넣은 후, C1000 Touch^TM Thermal Cycler(Bio-Rad 사, CA)를 사용하여 다음과 같은 조건으로 PCR을 수행하였다. 멀티플렉스 PCR 반응 조건은 95 ℃, 5분 (94 ℃, 30초→ 58 ℃, 60초 72 ℃, 60초) 35 사이클(cycles) 72 ℃, 10분으로 설정하였다. The multiplex PCR reaction consisted of 20 μl of PCR reaction solution (2 μl of 10 × buffer, 2 mM MgCl 2, 1 mM dNTPs, 10 pmol / μl of primers of SEQ ID Nos. 1 to 10), 20 ng of template DNA, 1 U of NV DNA Polymerase (NAVI BioTech, Korea) was placed in a 0.2 ml PCR reaction tube and PCR was carried out using C1000 Touch ^TM Thermal Cycler (Bio-Rad, CA) under the following conditions. The multiplex PCR conditions were set at 95 ° C. for 5 minutes (94 ° C., 30 seconds → 58 ° C., 60 seconds, 72 ° C., 60 seconds) and 35 cycles (cycles) at 72 ° C. for 10 minutes.

멀티플렉스 PCR 후에 PCR 산물을 전기영동하여, DAT1 유전자 내의 VNTR 변이들의 대립인자에 대한 염기쌍(base pair) 크기를 확인하였다. 도 2에 나타낸 바와 같이, DAT1 유전자 내의 VNTR은 Short repeat와 Long repeat로 분류되며, 본 연구결과, 대조군에서 더 많은 빈도의 Long repeat가 관찰되었다(p < 0.05). After multiplex PCR, the PCR products were electrophoresed to determine the base pair size for alleles of VNTR mutations in the DAT1 gene. As shown in FIG. 2, VNTRs in the DAT1 gene are classified into Short repeat and Long repeat. As a result, Long repeat was observed more frequently in the control group (p <0.05).

또한, DAT1 유전자 외에 나머지 4 가지의 유전자 내의 변이들의 대립인자를 확인하기 위해 SNaPshot assay 분석을 위해 single base extension(SBE)을 수행하였고, 이를 위해 표 9에 나타낸 바와 같은 타이핑 프라이머를 사용하였다. 하기 표 9에 기재된 (gact)₅는, 반응에는 작용하지 않고 SNaPshot 결과에서 길이에 차이를 주기 위한 중립 서열을 의미하고, gactgactgactgactgact와 같이 gact로 동일하게 5번 반복되어 있다는 의미이다.In addition, a single base extension (SBE) was performed for SNaPshot assay analysis to identify alleles of mutations in the remaining four genes other than the DAT1 gene. For this, a typing primer as shown in Table 9 was used. In Table 9 below, (gact) ₅ means a neutral sequence that does not act on the reaction but gives a difference in length in the SNaPshot result, and it means that it is repeated 5 times with gact like gactgactgactgactgact.

[표 9][Table 9]

타이핑 프라이머 서열 및 SBE 산물의 크기Size of typing primer sequence and SBE product

SNaPshot 분석을 위한 상기 멀티플렉스 PCR 산물을 주형으로 이용하여, 설계한 4개의 타이핑 프라이머를 이용하여 멀티플렉스 단일염기 프라이머 확장반응을 시행하였다. Multiplex single base primer extension reaction was carried out using the designed typing primer using the multiplex PCR product for SNaPshot analysis as a template.

먼저 1차 멀티플렉스 PCR로 증폭된 PCR 산물들에 남아있는 프라이머와 dNTP들을 제거하기 위해 exo-SAP 1 unit(1 μL)를 넣어주고 37 ℃에서 60분, 80 ℃에서 15분 반응시킨다. 이후 single base extension (SBE)을 진행하기 위해 SNaPshot Multiplex Ready Reaction Mix 1 μL, 프라이머 1.75 μL, 중합연쇄 반응산물 각 1 μL, DW 2.25 μL 를 넣어주고, 96 ℃에서 10분, 50 ℃ 5 초, 60 ℃ 30초를 25 회 반응시킨 후, SAP 1 unit(1 μL)을 첨가하여 37 ℃ 60분, 80 ℃ 15분 반응시켜 남아있는 ddNTP 제거하였다. 반응 산물 0.5 μL에 GeneScan-120 LIZ size standard 0.15 μL와 Hi-Di formamide 9.35 μL를 넣어 ABI 310 Sequencer(Applied Biosystems, Foster, USA)를 이용하여 분석하였다.First, exo-SAP 1 unit (1 μL) is added to remove the primers and dNTPs remaining in the PCR products amplified by the first multiplex PCR, and the reaction is carried out at 37 ° C. for 60 minutes and at 80 ° C. for 15 minutes. To proceed with the single base extension (SBE), 1 μL of the SNaPshot Multiplex Ready Reaction Mix, 1.75 μL of the primer, 1 μL of each polymerase chain reaction product, and 2.25 μL of DW were added and incubated at 96 ° C. for 10 minutes, After incubation for 30 seconds at 25 ° C, 1 μl of SAP was added and the remaining ddNTP was removed by incubation at 37 ° C for 60 minutes and at 80 ° C for 15 minutes. To 0.5 μL of the reaction product, 0.15 μL of GeneScan-120 LIZ size standard and 9.35 μL of Hi-Di formamide were added and analyzed using an ABI 310 Sequencer (Applied Biosystems, Foster, USA).

각 단일염기 다형성 위치에 상보적인 형광을 붙인 ddNTP가 각 프라이머 3' 끝에 오도록 조합하여 확장반응 산물을 얻어, 각 SNP에 대한 각각의 최고점을 분석하였다. 소프트웨어는 GeneMapper v4.0(Applied Biosystems, Foster, USA)을 이용하였으며 분석결과에 따라 도 4에 나타낸 바와 같이 4 가지의 유전자에서의 변이들의 대립인자에서의 변이를 동시에 확인할 수 있다. The ddNTPs with complementary fluorescence at each single nucleotide polymorphic position were combined at the 3 'end of each primer to obtain extended reaction products, and the respective peaks for each SNP were analyzed. The software used was GeneMapper v4.0 (Applied Biosystems, Foster, USA). As shown in FIG. 4, mutations in alleles of four genes can be confirmed simultaneously according to the analysis results.

이러한 결과를 통해, 본 발명의 프라이머 세트를 이용하여, 한국인의 ADHD 관련 유전자, 즉 LPHN3 유전자 내 rs6551665 SNP, FKBP5 유전자 내 rs7748266 SNP, MAOA 유전자 내 rs6323 SNP, DAT1 유전자 내의 VNTR, GSTT1 유전자에 대한 변이 유무를 동시에 신속하게 확인할 수 있다. Based on these results, it was confirmed that the mutation of the ADHD-related gene in Korean, namely rs6551665 SNP in the LPHN3 gene, rs7748266 SNP in the FKBP5 gene, rs6323 SNP in the MAOA gene, VNTR in the DAT1 gene, At the same time.

이제까지 본 발명에 대하여 바람직한 실시예를 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.The preferred embodiments of the present invention have been described so far. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. The disclosed embodiments are to be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION, DANKOOK UNIVERSITY <120> PRIMER SET FOR DIAGNOSING ADHD IN KOREAN, KIT COMPRISING THE SAME, AND METHOD OF PREDICTING ADHD RISK IN KOREAN USING THEREOF <130> APC-2016-0442 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 1 gaccattatc agcatgcagt 20 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 2 aggatgttta gcaacaacca t 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 3 ggtccagtaa ttctacatct 20 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 4 agcaatgtgt gagaccaca 19 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 5 cgaccttgac tgccaagatt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 6 ttcttccaga aggcctcctt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 7 ctcgaggaca agttcctcca 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 8 agcttgggtc ggccttcgaa 20 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 9 tagggaacgg cctgagagg 19 <210> 10 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 10 tggaggtcac ggctcaa 17 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 11 gactgactga ctgactgact aatgagaggt 30 <210> 12 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 12 gactgactga ctgactgact gactgactcc agttgtatca 40 <210> 13 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 13 ggactgactg actgactgac tgactgactg actagttaat tcagcg 46 <210> 14 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 14 gactgactga ctgactgact gactgactga ctgactttag ctgacctcgt 50 <110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION, DANKOOK UNIVERSITY <120> PRIMER SET FOR DIAGNOSING ADHD IN KOREAN, KIT COMPRISING THE SAME, AND METHOD OF PREDICTING ADHD RISK IN KOREAN USING THEREOF <130> APC-2016-0442 <160> 14 <170> KoPatentin 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 1 gaccattatc agcatgcagt 20 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 2 aggatgttta gcaacaacca t 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 3 ggtccagtaa ttctacatct 20 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 4 agcaatgtgt gagaccaca 19 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 5 cgaccttgac tgccaagatt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 6 ttcttccaga aggcctcctt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 7 ctcgaggaca agttcctcca 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 8 agcttgggtc ggccttcgaa 20 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 9 tagggaacgg cctgagagg 19 <210> 10 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 10 tggaggtcac ggctcaa 17 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 11 gactgactga ctgactgact aatgagaggt 30 <210> 12 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 12 gactgactga ctgactgact gactgactcc agttgtatca 40 <210> 13 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 13 ggactgactg actgactgac tgactgactg actagttaat tcagcg 46 <210> 14 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 14 gactgactga ctgactgact gactgactga ctgactttag ctgacctcgt 50

Claims

A first primer pair consisting of the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 2;
A second primer pair consisting of the forward primer of SEQ ID NO: 3 and the reverse primer of SEQ ID NO: 4;
A third primer pair consisting of the forward primer of SEQ ID NO: 5 and the reverse primer of SEQ ID NO: 6;
A fourth primer pair consisting of the forward primer of SEQ ID NO: 7 and the reverse primer of SEQ ID NO: 8; And
A fifth primer pair consisting of the forward primer of SEQ ID NO: 9 and the reverse primer of SEQ ID NO: 10;
A set of primers for the diagnosis of ADHD in Koreans.

The method according to claim 1,
The first primer pair specifically amplifies a region containing the rs6551665 single nucleotide polymorphism (SNP) position in the LPHN3 gene,
The second primer pair specifically amplifies a site including the rs7748266 SNP position in the FKBP5 gene
The third primer pair specifically amplifies a site including the rs6323 SNP position in the MAOA gene,
The fourth primer pair specifically binds to the GSTT1 gene,
Wherein the fifth primer pair specifically binds to a variable number of tandem repeats (VNTR) in the DAT1 gene.

A kit for diagnosing attention deficit hyperactivity disorder in a Korean person, comprising a primer set according to claim 1.

1) separating the genomic DNA from the biological sample derived from the subject; And
2) rs6551665 SNP in LPHN3 gene, rs7748266 SNP in FKBP5 gene, rs6323 SNP in MAOA gene, GSTT1 gene, and DAT1 gene in Multiplex-Polymerase Chain Reaction (multiplex PCR) using the primer set of claim 1 ;
A method for predicting the risk of attention deficit hyperactivity disorder in Koreans.

5. The method of claim 4,
Wherein the biological sample is at least one of hair, blood, tissue, cells, serum, plasma, saliva, sputum and urine.

5. The method of claim 4,
In the step 2)
For the DAT1 gene, confirm that the 3 'UTR of human chromosome 5 repeatedly represents the VNTR in units of 40 bp;
Confirming whether the rs6551665 SNP allele genotype at the 61873823 base position of human chromosome 4 indicates A / G for the rs6551665 SNP in the LPHN3 gene;
Confirming whether the rs7748266 SNP allele genotype at the 35624967 base position of human chromosome 6 indicates C / T for the rs7748266 SNP in the FKBP5 gene;
Confirming that the rs6323 SNP allele genotype at the 43731789th base position of human chromosome X indicates G / T for the rs6323 SNP in the MAOA gene; or
Confirming whether the GSTT1 gene is present or absent on the human chromosome 22;
In method.