KR101884074B1 - Novel polyene specific hybrid hydroxylase constructed by domain swapping - Google Patents

Abstract

The present invention relates to a domain-substituted polyene-specific hybrid hydroxylase, and the present invention provides a polyene-specific hybrid hydroxylase consisting of the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2. The present invention also relates to a method for producing a recombinant expression vector, comprising the steps of: preparing a recombinant expression vector by inserting a gene encoding the hybrid hydroxylase into an expression vector; Transforming the cells with the recombinant expression vector; And culturing the transformed cells in a medium containing a polyene. The present invention also provides a method for hydroxylation of a polyene.

Description

Domain substituted polyene-specific < RTI ID = 0.0 > hydroxylase < / RTI >

The present invention relates to a domain-substituted polyene-specific hybrid hydroxylase.

Cytochrome P450 (Cytochrome P450, CYP) is an iron-containing enzyme that plays an important role in biochemistry, pharmacology, and toxicology and causes oxidation or hydroxylation by recognizing steroids, fatty acids and polyketides as substrates. Although many studies on CYP have been made so far, polyene compounds have been used as antifungal agents, but their use has been limited due to their high toxicity and low water solubility in the human body. I am having difficulties. In order to construct biologically diverse derivatives by manipulating the CYP involved in the biosynthesis step of the polyene compound, it is necessary to identify the substrate specificity of CYP. However, to date, no system has been known to indicate the substrate specificity of CYP.

Typical polyene-producing strain of Streptomyces surf suspension (Streptomyces nodosus), Streptomyces Nord assay (Streptomyces noursei ) and sparse actinomycetes Pseudonocardia autotrophica have CYPs of AmphL, NysL and NppL, respectively. These genes have been reported to be involved in the hydroxylation, which is the final step in the polyene biosynthesis process, but the domains affecting the substrate specificity are clearly .

Korean Registered Patent No. 10-1379978 (Registered on March 25, 2014)

An object of the present invention is to provide a polyene-specific hybrid hydroxylase consisting of the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.

Another object of the present invention is to provide a method of hydroxylating a polyene using the above-mentioned hybrid hydroxylase.

In order to achieve the above object, the present invention provides a polyene-specific hybrid hydroxylase consisting of the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.

The present invention also relates to a method for producing a recombinant expression vector, comprising the steps of: preparing a recombinant expression vector by inserting a gene encoding the hybrid hydroxylase into an expression vector; Transforming the cells with the recombinant expression vector; And culturing the transformed cells in a medium containing a polyene. The present invention also provides a method for hydroxylation of a polyene.

The present invention relates to domain-substituted polyene-specific hybrid hydrolytic enzymes, and the substrate specificity is confirmed through fusion CYP construction using three polyen-specific CYPs. In the present invention, the substrate specificity of CYP, which specifically recognizes two sugars as substrates, as well as CYP, which is involved in the biosynthesis of a conventional antifungal agent, is analyzed, It is expected that various polyene derivatives can be constructed by recognizing monosaccharides as well as substrates of disialic structures, thereby enabling the production of useful polyene derivatives.

1 (A) shows polyene biosynthesis mechanism. Nystatin-like Pseudonocardia polyene (NPP) is illustratively shown. (B) Cloning and insertion plasmids used in the present invention. (C) P. autotrophica Δ nppY Δ nppL, P. autotrophica Δ nppL .
Figure 2a shows amino acid sequence analysis (PimD, NysL, NppL, AmphL) and two critical regions for making fusion CYPs. Figure 2b shows mutant CYP genes. FIG. 2C shows a construction diagram of mutation genes by In-fusion.
Figure 3 (A) shows the conversion yield of fused CYPs. (B) a polyene-producing strain. (C) The conversion yield of CYP-AsL002 in S. nodosus ? AmphL is shown.
Figure 4 (A) shows a specific region showing substrate specificity. (B) Conversion rates of fusion CYPs based on specific zones. In pCYP-PsL001, pCYP-NysL was substituted for both A and B regions, pCYP-PsL003 was substituted for pCYP-NysL for A region, and pCYP-NysL was substituted for pCYP-PsL002 for B region only.

The present inventors have carried out heterologous host expression of each polyene-specific CYP (AmphL, NysL and NppL) and confirmed that they have different substrate specificities. AmphL preferred mycosamine as a substrate and NysL recognized both a single sugar (Mycosamine) and two sugars (N-acetyl glucosamine, Mycosamine) as substrates. Finally, NppL was found to prefer N-acetyl glucosamine (Mycosamine) as a substrate. In order to clarify the site showing substrate specificity, the fusion CYP using AmphL, NysL and NppL was constructed and the substrate specificity for one sugar (Mycosamine) and two sugars (N-acetyl glucosamine, Mycosamine) .

The present invention provides a polyene-specific hybrid hydroxylase consisting of the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 and functional equivalents thereof. In the present invention, SEQ ID NO: 1 was named AsL001 and SEQ ID NO: 2 was named PsL002.

Specifically, the domain consisting of amino acids 252 to 394 of SEQ ID NO: 1 or amino acids 345 to 401 of SEQ ID NO: 2 can determine the substrate specificity of the polyene, but is not limited thereto.

Specifically, the polyene may be 10-deoxy nystatin-like Pseudonocardia polyene (10-deoxy NPP) or 10-deoxy nystatin , But is not limited thereto.

Specifically, the hydroxylase is characterized by converting 10-deoxy NPP to NPP or 10-deoxynistatin to nystatin.

The "polyene" of the present invention has a macrolactone ring structure generally comprised of 20 to 40 carbons and has about 3 to 8 conjugated double bonds in the molecule A typical type I polyketide macrolide compound.

"Functional equivalent" of the present invention includes all of the amino acid sequence variants in which some or all of the hydroxylases of SEQ ID NO: 1 or SEQ ID NO: 2 are substituted, or amino acid sequence variants in which some of the amino acids are deleted or added, . Substitution of amino acids is preferably conservative substitution. Examples of conservative substitutions of amino acids present in nature are as follows: (Gly, Ala, Pro), hydrophobic amino acids (Ile, Leu, Val), aromatic amino acids (Phe, Tyr, Trp), acidic amino acids (Asp, Glu), basic amino acids (His, Lys, Arg, Gln, Asn ) And sulfur-containing amino acids (Cys, Met). The deletion of the amino acid is preferably located at a site that is not directly involved in the activity of the hydroxylase.

The present invention also relates to a method for producing a recombinant expression vector, comprising the steps of: preparing a recombinant expression vector by inserting a gene encoding the hybrid hydroxylase into an expression vector; Transforming the cells with the recombinant expression vector; And culturing the transformed cells in a medium containing a polyene. The present invention also provides a method for hydroxylation of a polyene.

Specifically, the cell may be, but is not limited to, Pseudonocardia autotrophica .

Specifically, the polyene may be 10-deoxy nystatin-like Pseudonocardia polyene (10-deoxy NPP) or 10-deoxy nystatin , But is not limited thereto.

Specifically, the polyene hydroxylation is characterized by converting 10-deoxy NPP to NPP or 10-deoxynistatin to nystatin.

Preferably, the gene is represented by SEQ ID NO: 3 or SEQ ID NO: 4, but is not limited thereto and provides equivalent nucleic acid sequences to the sequence.

The " equivalent nucleic acid sequence " includes the codon degenerate sequence of the above-mentioned hydroxylase sequence. The term " codon degenerate sequence " means a nucleic acid sequence which differs from the above sequence but encodes a polypeptide having the same sequence as the hydroxylase disclosed in the present invention.

In the present invention, " vector " means a DNA molecule that is replicated by itself, which is used to carry the clone gene (or another fragment of the clone DNA).

In the present invention, an "expression vector" means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. The expression vector may preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include antibiotic resistance genes such as ampicilin, kanamycin, G418, Bleomycin, hygromycin, chloramphenicol, and apramycin. And is suitably selectable by a person skilled in the art.

The issues related to the genetic engineering techniques used in the present invention are described in Sambrook et al. Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) Frederick M. Ausubel et al., Current Protocols in Molecular Biology Volume 1,2,3, John Wiley & Sons, Inc. (1994)).

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

< Experimental Example >

The following experimental examples are intended to provide experimental examples that are commonly applied to the respective embodiments according to the present invention.

1. Strain, culture condition

Rare actinomycetes Pseudonocardia autotrophica KCTC9441 was purchased from the Korean Collection for Type Cultures (KCTC, Korea). P. autotrophica and P. autotrophica were cultured in ISP2 liquid medium (glucose 0.4%, yeast extract 0.4% and malt extract 1%) at 28 ° C, yeast extract medium (yeast extract 0.3% peptone 0.5%, malt extract 0.3%, glucose 1%, sucrose 34% and MgCl ₂ .H ₂ O 2.5 mM). All E. coli strains were cultured in Luria-Bertani liquid or Luria-Bertani agar medium supplemented with appropriate antibiotics at 37 ° C. E. coli ET12567 / pUZ8002 was used as a donor strain for E. coli - Streptomyces junction.

2. Mutation CYP  Construction of genes

All mutant CYP genes were constructed using the In-Fusion HD cloning kit (Clontech, CA, USA). The linearized vector was constructed using restriction enzyme ( Xba I) and the DNA fragment was amplified by PCR. The linearized vector and the DNA fragment were fused by in-fusion cloning reaction at 50 DEG C for 15 minutes. The reaction mixture was transformed into competent E. coli to obtain the desired clones. The primer and template DNA used to prepare the mutant CYP genes are shown in Table 1 and the primer sequences are shown in Table 2.

Mutant CYP  gene Fragment Primer Template DNA CYP - PsL001 upstream Infusion nppL (F), psL001 (R) pCYP-nppL downstream psL001 (F), Infusion nysL (R) pCYP-nysL CYP - SpL001 upstream Infusion nysL (F), spL001 (R) pCYP-nysL downstream spL001 (F), Infusion nppL (R) pCYP-nppL CYP - PaL001 upstream Infusion nppL (F), psL001 (R) pCYP-nppL downstream paL001 (F), Infusion amphL (R) pCYP-amphL CYP - ApL001 upstream Infusion amphL (F), apL001 (R) pCYP-amphL downstream apL001 (F), Infusion nppL (R) pCYP-nppL CYP - SaL001 upstream Infusion nysL (F), spL001 (R) pCYP-nysL downstream saL001 (F), Infusion amphL (R) pCYP-amphL CYP - AsL001 upstream Infusion amphL (F), apL001 (R) pCYP-amphL downstream asL001 (F), Infusion nysL (R) pCYP-nysL CYP - PsL002 upstream Infusion nppL (F), psL002 (R) pCYP-nppL downstream psL002 (F), Infusion nysL (R) pCYP-nysL CYP - SpL002 upstream Infusion nysL (F), spL002 (R) pCYP-nysL downstream spL002 (F), Infusion nppL (R) pCYP-nppL CYP - PaL002 upstream Infusion nppL (F), psL002 (R) pCYP-nppL downstream paL002 (F), Infusion amphL (R) pCYP-amphL CYP - ApL002 upstream Infusion amphL (F), apL002 (R) pCYP-amphL downstream apL002 (F), Infusion nppL (R) pCYP-nppL CYP - SaL002 upstream Infusion nysL (F), spL002 (R) pCYP-nysL downstream (F), Infusion amphL (R) pCYP-amphL CYP - AsL002 upstream Infusion amphL (F), apL002 (R) pCYP-amphL downstream asL002 (F), Infusion nysL (R) pCYP-nysL CYP - PsL003 upstream Infusion nppL (F), spL002 (R) pCYP-psL001 downstream spL002 (F), Infusion nysL (R) pCYP-spL002 CYP - SpL003 upstream Infusion nysL (F), psL002 (R) pCYP-spL001 downstream psL002 (F), Infusion nppL (R) pCYP-psL002

Primer Sequence (5 '- &gt; 3') Infusion nppL (F) GGTTGGTAGGATCCTCTAGAGACCTGGCTCGCCGAGCT Infusion nppL (R) GGGCTGCAGGTCGACTCTAGACGGGGCGGGTGTGCC Infusion nysL (F) TGCCGGTTGGTAGGATCCATGAGCACACCGACCG Infusion nysL (R) GGGCTGCAGGTCGACTCTAGATCACCAGGTGACGGGCA Infusion amphL (F) TGCCGGTTGGTAGGATCCGCACCTCACCACTCTCCC Infusion amphL (R) CAGGTCGACTCTAGAGCGGGGAGGTCACCAGGT psL001 (F) CTGTTCGCGACCCACCCGGACCAGCTCGCCGC spL001 (F) CTGTTCATCCAGCACCCCGACCAGCTGGCGGC paL001 (F) CTGTTCGCGACCCACCCGGACCAGCTGAAGGAG apL001 (F) CTGTTCACGCAGTAC CCCGACCAGCTGGCGGC saL001 (F) CTGTTCATCCAGCACCCGGACCAGCTGAAGGAGG asL001 (F) CTGTTCACGCAGTACCCGGACCAGCTCGCCGC psL002 (F) CTGTTCGCGACCCACCCGGACCAGCTCGCCGC spL002 (F) CACCTGACGTTCGGCCACGGCATGTGGCACTGCA pAL002 (F) CACCTGACCTTCGGACACGGCATGTGGCACTGC apL002 (F) CACCTGACGTTCGGGCACGGCATGTGGCACTGC SA002 (F) CGCACCTGACGTTCGGCCACGGCATGTGGCACTGCA asL002 (F) GAGCACCTGACGTTCGGGCACGGCATGTGGCACTG psL001 (R) GTGGGTCGCGAACAGCAGT spL001 (R) GTGCTGGATGAACAGCACC apL001 (R) GTACTGCGTGAACAGCAC psL002 (R) TCCGAAGGTCAGGTGCGG spL002 (R) GCCGAACGTCAGGTGCGG apL002 (R) CCCGAACGTCAGGTGCTC

3. Actinomycetes ( Actinomycetes ) In  Expression of heterozygous host

Mutant CYPs were expressed in heterozygous hosts in Streptomyces via junctions. E. coli containing each recombinant plasmid ET12567 / pUZ8002 was used as a donor strain, P. autotrophica △ nppL, P. autotrophica △ nppY △ nppL were used to granting strains. The list of insert plasmids and acceptor strains is shown in Table 3. The donor strain was washed twice with LB medium, and the donor strain was rinsed once with 2XYT liquid medium (tryptone 1.6%, yeast extract 1%, NaCl 0.5%). The resulting strain was germinated and then contacted with mISP4 solid medium (ISP4 37%, yeast extract 0.5%, tryptone 1.5%) at 50 캜 for 10 minutes. After reacting at 30 DEG C for 16 hours, distilled water containing hygromycin and nalidixic acid was flowed on the plate for selection of the recombinant strains. Mutagenic strains were obtained by repeated subculture on ISP2 solid medium containing hygromycin.

Plasmid Characteristic pMMBL005 Integrative plasmid, Hyg ^r Strain   Characteristic Pseduconocardia autotrophica
KCTC9441 Wild-type, NPP producing strain P. autotrophica △ nppL nppL mutant producing 10-deoxy NPP P. autotrophica △ nppY △ nppL nppY nppL double mutant producing 10-deoxy nystatin

4. For the polyene-specific hydroxylation reaction Live conversion  Analysis and HPLC  analysis

The polyene derivatives were extracted with the same amount of butanol, then centrifuged and dissolved in methanol. The extracts were analyzed using a Shimadzu SPD M10A (Shimadzu, Japan) equipped with a Zorbax SB-C18 column (5 mu m particles, 4.6 x 150 mm, Agilent). The column was equilibrated with 50% solvent A (0.05M ammonium acetate, pH 6.5) and 50% solvent B (methanol) and then analyzed with the following solvent gradient. B (0 min), 75% B (3 min), 100% B (30 min), 50% B (33 min) and 50% B (40 min) at a flow rate of 1.0 ml / Vis detection was performed at 305 nm. Quantification of polyene derivatives was carried out by HPLC using Nystatin A1 (Sigma Aldrich) as a standard.

< Example  1> polyenes specific CYP  Expression of heterozygous host

Each hydroxylase was expressed in a heterozygous host to elucidate whether polyene - specific hydroxylases have substrate specificity and which substrates are preferred. In the biosynthetic process of the polyene compound amphotericin, nystatin, and nystatin-like pseudonocardia polyene (NPP) (FIG. 1A), the CYP- AmphL, CYP-NysL, and CYP-NppL were selected, and heterologous host was expressed using a vector inserted into the actinomycete chromosome (FIG. 1B). The substrate is 10-deoxy N-terminal containing mycosamine and 10-deoxy NPP (10-deoxy N-terminal) containing mycosamine and N-acetyl glucosamine. deoxy NPP), and this was used as a strain of P. autotrophica nppY △ △ nppL, P. autotrophica △ nppL each production as a host. As a result, CYP-AmphL favored one mycosamine as a substrate, whereas CYP-NppL favored two sugars (mycosamine, N-acetyl glucosamine). Finally, it was confirmed that CYP-NysL recognizes both one sugar and two sugars at a high ratio (Fig. 1C). These results indicate that polyene - specific hydroxylases have a favorable substrate, that is, substrate specificity.

< Example  2> domain Swapping (Domain swapping) and convergence Of CYPs  Expression of heterozygous host

Previous studies have shown that polyene-specific hydroxylases have substrate specificity. Domain swapping was carried out to reveal the region exhibiting such substrate specificity. CYP-PimD, a polyene hydroxylase that has been studied in various ways including the tertiary structure of proteins, has selected two domains that are within 6 Å from the substrate and have important functions for interaction with the substrate. CYP-Npl, CYP-NysL, and CYP-AmphL, which show more than 50% complementarity with PimD (Fig. 2a). Each of the hydroxylases was mixed based on the two domains, and a total of 12 fusion CYPs (FIG. 2b) were prepared using the infusion method (FIG. 2c). This allows the joint (conjugation) method in P. autotrophica nppY △ △ △ nppL and P. autotrophica nppL substrate specificity was analyzed by two kinds of expression host.

< Example  3> fusion Of CYPs  Expression of heterozygous hosts for analyzing live exchange rates

To identify substrate specificity of polyenes-specific hydroxylase, CYP-NppL, CYP-NysL, and CYP-AmphL were substituted on the basis of specific positions and a total of 12 fusion CYPs were substituted with 10- statins (10-deoxy Nystatin) and 10 were used two kinds of host expression in P. oxy NPP autotrophica nppY △ △ △ nppL and P. autotrophica nppL producing (10-deoxy NPP), including two parties. For the production of useful polyene derivatives, it is necessary to identify CYPs involved in polyene biosynthesis. In other words, it is important to identify the site that indicates the substrate specificity of CYP. For this purpose, when polyphene CYP, NppL and AmphL, which show distinct specificity only on a specific substrate, are mixed with NysL, the original substrate specificity is lost and fusion CYP, which recognizes both substrates in a high ratio like NysL (Fig. 3A).

pCYP-PsL001 (56%, 57%) and pCYP-PsL002 (84%, 71%) were found to contain pCYP-NysL in the C-terminus based on pCYP-NppL We lost both properties and recognized both substrates as pCYP-NysL. In addition, pCYP-AsL001 (74%, 90%) contained pCYP-NysL at the C-terminus based on pCYP-AmphL and thus lost the property of pCYP-AmphL which recognized a sugar as a substrate. Were all recognized. In other words, the C-terminal portion of CYP was substituted, thereby losing original substrate specificity.

However, CYP-AsL002 did not recognize both substrates even though it contained pCYP-NysL at the C-terminus. The pCYP-AmphL contained in the N-terminus of CYP-AsL is a wild-type strain of S. nodosus , which has no hydroxyl group at carbon number 8 and heptaene-type 8-deoxy It is a hydroxylase that functions by recognizing 8-deoxy Amphotericin as a substrate (Fig. 3B). However, the substrates used in the study are 10-deoxy Nystatin and 10-deoxy NPP, which are tetraene-type aglycons, which have no hydroxyl groups at the 10th carbon position. Due to the structural differences of these substrates, CYP-AsL002, in which pCYP-AmphL occupies more than CYP-AsL001 at the first position, ie, CYP-AmphL at the first position based on position 2, Other substrate specificities were determined to have failed to function normally in P. autotrophica . To verify this, CYP-AsL002 was compensated for in S. nodosus , S. nodosus △ amphL , which had no CYP function. P. autotrophica nppY △ △ nppL the other hand, caused by the conversion to the 10-oxy whether statins age (10-deoxy Nystatin) as a substrate in a 20% conversion, in the S. nodosus △ amphL the conversion rate is increased to 40% 8 Amphotericin was biosynthesized using 8-deoxy Amphotericin as a substrate (Fig. 3C). It was concluded that the different substrate specificity of CYP-AmphL and the difference of strains used for heterologous host expression resulted in different results.

The domain was subdivided and analyzed to identify more specific positions of the C-terminal end of the CYP specifically affected by the part. Due to the different substrate specificity of pCYP-AmphL, we analyzed the fusion CYP of pCYP-NppL and pCYP-NysL, which recognizes aglycon of the same structure as a substrate. Based on position 1 of the C-terminus, the rear portion was referred to as A region, and the rear portion as base position 2 was referred to as B region (FIG. 4A). We analyzed the role of pCYP-PsL001, pCYP-PsL003, and pCYP-PsL002, which are substituted for pCYP-NysL in regions A and B and regions A and B, respectively, based on pCYP-NppL (Fig. 4B).

PCYP-PsL001, in which all of the A and B regions were replaced by pCYP-NysL, recognized both substrates. However, pCYP-PsL003, which was substituted with pCYP-NysL only in region A, did not show the properties of pCYP-NysL and specifically recognized substrates containing two sugars such as pCYP-NppL. PCYP-PsL002 in which only region B was substituted with pCYP-NysL showed the property of pCYP-NysL. That is, it was confirmed that the activity was changed by substituting CYP at the rear part of the B-site based on the 2-position of the C-terminal.

The present inventors have found that there is substrate specificity of polyene-specific hydroxylase, that there is no hydroxyl group at 10 carbon position, and substrate specificity according to the number of sugars in tetraene structure is confirmed. In addition, the site specificity was identified through the change of the substrate specificity according to the CYP in the B region, which is commonly located on the second position.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that such detail is solved by the person skilled in the art without departing from the scope of the invention. will be. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> INHA-INDUSTRY PARTNERSHIP INSTITUTE &Lt; 120 > Novel polyene-specific hybrid < RTI ID = 0.0 &          swapping <130> ADP-2015-0268 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 394 <212> PRT <213> Artificial Sequence <220> <223> hybrid hydroxylase_AsL001 <400> 1 Met Val Asn Pro Thr Pro Pro Pro Ser Leu Glu Asp Ala Ala Pro Ser   1 5 10 15 Val Leu Arg Leu Ser Pro Leu Leu Arg Glu Leu Gln Met Arg Ala Pro              20 25 30 Val Thr Lys Ile Arg Thr Pro Ala Gly Asp Glu Gly Trp Leu Val Thr          35 40 45 Arg His Ala Glu Leu Lys Gln Leu Leu His Asp Glu Arg Leu Ala Arg      50 55 60 Ala His Ala Asp Pro Ala Asn Ala Pro Arg Tyr Val Lys Ser Pro Leu  65 70 75 80 Met Asp Leu Leu Ile Met Asp Asp Val Glu Ala Ala Arg Ala Ala His                  85 90 95 Ala Glu Leu Arg Thr Leu Leu Thr Pro Gln Phe Ser Ala Arg Arg Val             100 105 110 Leu Asn Met Met Pro Met Val Glu Gly Ile Ala Glu Gln Ile Leu Asn         115 120 125 Gly Phe Ala Ala Gln Glu Gln Pro Ala Asp Leu Arg Gly Asn Phe Ser     130 135 140 Leu Pro Tyr Ser Leu Thr Val Leu Cys Ala Leu Ile Gly Ile Pro Leu 145 150 155 160 Gln Glu Gln Gly Gln Leu Leu Ala Val Leu Gly Glu Met Ala Thr Leu                 165 170 175 Asn Asp Ala Glu Ser Val Ala Arg Ser Gln Ala Lys Leu Phe Gly Leu             180 185 190 Leu Thr Asp Leu Ala Gly Arg Lys Arg Ala Glu Pro Gly Asp Asp Val         195 200 205 Ile Ser Arg Leu Cys Glu Thr Val Pro Glu Asp Glu Arg Ile Gly Pro     210 215 220 Ile Ala Ale Le Leu Ale Gly Leu Asp Ser Val Ala Thr His 225 230 235 240 Val Asp Leu Gly Val Val Leu Phe Thr Gln Tyr Pro Asp Gln Leu Ala                 245 250 255 Ala Ala Leu Ala Asp Glu Lys Leu Met Arg Gly Ala Val Glu Glu Ile             260 265 270 Leu Arg Ser Ala Lys Ala Gly Gly Ser Val Leu Pro Arg Tyr Ala Thr         275 280 285 Ala Asp Val Pro Ile Gly Asp Val Thr Ile Arg Ala Gly Asp Leu Val     290 295 300 Leu Leu Asp Phe Thr Leu Val Asn Phe Asp Arg Thr Val Phe Asp Glu 305 310 315 320 Pro Glu Leu Phe Asp Ile Arg Arg Ala Pro Asn Pro His Leu Thr Phe                 325 330 335 Gly His Gly Met Trp His Cys Ile Gly Ala Pro Leu Ala Arg Val Asn             340 345 350 Leu Arg Thr Ala Tyr Thr Leu Leu Phe Thr Arg Leu Pro Gly Leu Arg         355 360 365 Leu Val Arg Pro Val Glu Glu Leu Arg Val Leu Ser Gly Gln Leu Ser     370 375 380 Ala Gly Leu Thr Glu Leu Pro Val Thr Trp 385 390 <210> 2 <211> 401 <212> PRT <213> Artificial Sequence <220> <223> hybrid hydroxylase_PsL002 <400> 2 Met Thr Ser Pro Thr Thr Cys Pro Val Thr Gly Gly Gly Pro Pro Pro   1 5 10 15 Ser Leu Glu Gly Gln Thr Pro Pro Val Leu Arg Leu Ser Pro Leu Leu              20 25 30 Arg Glu Leu Gln Gln Gln Ala Pro Val Cys Arg Val Thr Pro Thr          35 40 45 Gly Asp Glu Ala Trp Leu Val Thr Arg Tyr Ala Glu Leu Lys Ala Leu      50 55 60 Leu His Asp Glu Arg Leu Gly Arg Ala His Ala Asp Pro Ala Asn Ala  65 70 75 80 Pro Arg Tyr Val Arg Asn Pro Phe Leu Asp Leu Leu Val Val Asp Asp                  85 90 95 Ala Gln Gln Ala Arg Asp Leu His Thr Glu Met Arg Arg Leu Leu Thr             100 105 110 Pro Gln Phe Ser Ala Arg Arg Val Leu Gly Leu Ala Pro Thr Val Ser         115 120 125 Ala Val Ala Glu Gln Val Leu Asp Gly Phe Val Ala Ala Gly Asn Pro     130 135 140 Gly Asp Leu His Gly Gly Phe Ser Met Pro Tyr Ser Leu Thr Val Leu 145 150 155 160 Cys Glu Leu Ile Gly Ile Pro Pro Gln Asp Arg Pro Glu Leu Val Arg                 165 170 175 Thr Ile Met Thr Met Gly Glu Val Asp Asp Ala Glu Arg Val Ala Thr             180 185 190 Val Gln Ala Glu Leu Phe Gly Leu Leu Ser Ala Val Ala Arg Arg Lys         195 200 205 Arg Ala Glu Pro Thr Asp Val Val Ser Arg Leu Cys Ala Gln Val     210 215 220 Pro Asp Glu Arg Ile Gly Pro Ile Ala Gly Leu Leu Phe Ala Gly 225 230 235 240 Leu Asp Ser Val Ala Ser His Val Asp Leu Gly Val Leu Leu Phe Ala                 245 250 255 Thr His Pro Asp Gln Leu Ala Ala Ala Leu Ala Asp Glu Arg Thr Met             260 265 270 Arg Glu Gly Val Glu Glu Ile Leu Arg Cys Ala Lys Ala Gly Gly Ser         275 280 285 Val Leu Pro Arg Tyr Ala Thr Asp Asp Val Glu Ile Gly Gly Val Thr     290 295 300 Leu Arg Thr Gly Asp Leu Val Leu Leu Asp Phe Thr Leu Val Asn Phe 305 310 315 320 Asp Thr Gln Val Phe Asp Glu Pro Glu Val Phe Asp Ile Arg Arg Glu                 325 330 335 Ser Asn Pro His Leu Thr Phe Gly His Gly Met Trp His Cys Ile Gly             340 345 350 Ala Pro Leu Ala Arg Val Asn Leu Arg Thr Ala Tyr Thr Leu Leu Phe         355 360 365 Thr Arg Leu Pro Gly Leu Arg Leu Val Arg Pro Val Glu Glu Leu Arg     370 375 380 Val Leu Ser Gly Gln Leu Ser Ala Gly Leu Thr Glu Leu Pro Val Thr 385 390 395 400 Trp     <210> 3 <211> 1185 <212> DNA <213> Artificial Sequence <220> <223> hybrid hydroxylase_AsL001 <400> 3 atggtcaacc cgacaccgcc gccctctctc gaggatgccg cgccttcggt gctccgcctc 60 agcccgctgc tgcgcgagct ccagatgcgt gctcccgtca ccaagatccg caccccggcc 120 ggcgacgagg gctggctggt gacccggcac gccgagctga agcagctgct gcacgacgag 180 cgcctggccc gtgcgcacgc cgacccggcc aacgcgcccc gctacgtcaa gagccccttg 240 atggacctgc tcatcatgga cgacgtggag gcggcccgcg ccgcgcacgc cgagctgcgc 300 accctgctca ccccgcagtt ctccgcccgc cgggtgctca acatgatgcc catggtggag 360 gggatcgcgg agcagatcct gaacggcttc gccgcccagg aacaacccgc cgatctgcgg 420 ggcaacttct cgctgccgta ctcgctgacc gtgctgtgcg ccctgatcgg catcccgctg 480 caggagcagg gccaactcct cgcggtgctg ggcgagatgg ccacgctgaa cgacgcggag 540 agcgtcgcca ggagccaggc gaagctgttc gggctgctga ccgacctggc cggccgcaag 600 cgggccgaac ccggcgacga cgtgatctcc cggctgtgcg agacggtccc ggaggacgag 660 cgcatcggcc ccatcgccgc gagcctgctc ttcgccggcc tcgacagcgt tgccacccat 720 gtcgacctgg gcgtcgtgct gttcacgcag tacccggacc agctcgccgc ggccctggcc 780 gacgagaagc tgatgcgcgg cgccgtcgag gagatcctgc ggtccgccaa ggccggcggt 840 tcggtgctcc cgcggtacgc gaccgccgat gtaccgatcg gcgacgtgac catcagggcc 900 ggcgacctgg tgctgctgga cttcaccctg gtgaacttcg accgcacggt cttcgacgag 960 ccggagctct tcgacatccg gcgcgccccc aacccgcacc tgacgttcgg ccacggcatg 1020 tggcactgca tcggcgcgcc gctggcccgg gtcaatctgc gcaccgccta caccctgctg 1080 ttcacccgcc tgcccggcct gcggctggtg cgcccggtcg aggaactgcg ggtgctgtcg 1140 gggcagttgt cggccggcct gacggagctg cccgtcacct ggtga 1185 <210> 4 <211> 1206 <212> DNA <213> Artificial Sequence <220> <223> hybrid hydroxylase_PsL002 <400> 4 atgaccagcc cgacgacctg cccggtcacc ggcggcgggc ccccgccgtc cctggagggc 60 cagaccccgc cggtgctgcg gctgagcccg ctgctgcggg agctgcagca gcaggcaccc 120 gtgtgccggg tccggacccc caccggcgac gaggcctggc tggtcacccg ctacgccgag 180 ctgaaagcac tgctgcacga cgagcgcctc ggccgcgcgc acgccgatcc ggcgaacgcg 240 ccgcggtacg tgcgcaaccc gttcctggac ctgctggtcg tcgacgacgc ccagcaggcc 300 cgggacctgc acaccgagat gcggcgcctg ctcaccccgc agttctccgc gcgccgggtg 360 ctgggcctgg cgcccacggt gtccgcggtc gccgagcagg tgctcgacgg gttcgtcgcc 420 gcgggcaacc ccggcgacct gcacggcggg ttctccatgc cgtactcgct gacggtgctg 480 tgcgaactca tcgggatccc gccgcaggac cgacccgagc tggtgcggac catcatgacg 540 atgggtgagg tggacgacgc cgagcgcgtc gccacggtcc aggccgagct gttcgggctg 600 ctgtccgccg tcgcccggcg caagcgggcc gagcccaccg acgacgtcgt gtcccggctg 660 tgcgcgcagg tgcccgacga gcggatcggc ccgatcgccg ccggtctgct gttcgccggg 720 ctcgacagcg tcgccagcca cgtcgacctg ggcgtactgc tgttcgcgac ccaccccgac 780 cagctggcgg ccgcgctcgc cgacgagcgc accatgcgcg agggcgtcga ggagatcctg 840 cgctgcgcca aggcgggcgg atcggtgctg ccccgctatg ccaccgacga cgtcgagatc 900 ggtggcgtca ccctgcgcac cggcgacctg gtgctgctgg acttcaccct ggtcaacttc 960 gacacccagg tgttcgacga gccggaggtg ttcgacatcc gccgggagtc gaacccgcac 1020 ctgaccttcg gacacggcat gtggcactgc atcggcgcac cgctggcccg ggtcaatctg 1080 cgcaccgcct acaccctgct gttcacccgc ctgcccggcc tgcggctggt gcgcccggtc 1140 gaggaactgc gggtgctgtc ggggcagttg tcggccggcc tgacggagct gcccgtcacc 1200 tggtga 1206

Claims (9)

A polyene-specific hybrid hydroxylase consisting of an amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2, wherein the polyene-specific hybrid hydroxylase is 10-deoxynistatin-like pseudonocadia polyenes (10-deoxy NPP) and 10-deoxy nystatin (10-deoxy nystatin) into NPP and nisatin, respectively. 2. The hybrid enzyme according to claim 1, wherein the 252nd to 394th amino acids of SEQ ID NO: 1 or the 345th to 401st amino acids of SEQ ID NO: 2 determine the substrate specificity of the polyene. delete delete Preparing a recombinant expression vector by inserting a gene encoding the hybrid hydroxylase of claim 1 or 2 into an expression vector;
Transforming the cells with the recombinant expression vector; And
10-deoxy NPP and 10-deoxynistatin, which comprises culturing the transformed cells in a medium containing 10-deoxy NPP and 10-deoxynistatin, (Hydroxylation). 6. The method according to claim 5, wherein the gene is represented by SEQ ID NO: 3 or SEQ ID NO: 4. 6. The method according to claim 5, wherein the cell is Pseudonocardia autotrophica . delete delete

Images