KR101875825B1 - Yellow fluorescent protein fragment-fusion yeast gene library and method of analysis of protein-protein interaction using the same - Google Patents

Abstract

The present invention relates to a yeast strain library and a use thereof which can analyze an interaction between proteins expressed at a genome level in a cell of Saccharomyces cerevisiae which is a budding yeast, and more specifically, to a Saccharomyces cerevisiae strain library, a manufacturing method thereof, and a use for analysis of a protein-protein interaction thereof, wherein a C-terminal fragment gene of a yellow fluorescent protein is operably connected to a 3′-terminal of a gene encoding a protein on the genomic DNA of Saccharomyces cerevisiae.

Description

(Yellow fluorescent protein fragment-fusion yeast gene library and method for analysis of protein-protein interaction using the same)

The present invention relates to a yeast strain library capable of analyzing the interaction between proteins expressed in a Saccharomyces cerevisiae cell, which is a budding yeast, at a genome level, and a use thereof. Specifically, the present invention relates to a method for screening a gene encoding Saccharomyces cerevisiae , which is operably linked to the C-terminal fragment gene of the yellow fluorescent protein at the 3'-end of the gene encoding the protein on the genomic DNA of Saccharomyces cerevisiae . Saccharomyces cerevisiae strain library, its preparation method and its protein interaction assay.

The genetic information preserved and transmitted in living organisms is ultimately expressed in protein form and functions in cells. The understanding of protein function is essential for understanding life phenomena because life phenomena occurring in life such as cytoskeletal organization and response to stimulation and various signal transduction are mediated by proteins. Rather than acting alone in a cell, proteins often bind to a variety of other proteins to form a protein complex. Therefore, research on protein-protein interaction is a process that must be followed to understand the intracellular function of proteins.

Because of this importance, experimental methods for analyzing protein interactions have also been developed with the history of life sciences. Immunoprecipitation is the most commonly used analytical method. Immunoprecipitation is based on the principle that when a specific protein is purified using an antibody, other proteins in the cell together with the protein are purified together. Assuming that proteins A and B are complexed, a complex precipitate (BAa) combining antibody and protein complex is obtained by using antibody a for protein A and separated by electrophoresis to obtain information on B protein have. Since 2000, mass spectrometric techniques for isolated proteins have been extremely precise, and several hundreds to thousands of proteins have been separated by immunoprecipitation and then analyzed for their interacting proteins Nature 2002, 415: 141-147, Ho et al., Nature 2002, 415: 180-183, Krogan et al., Nature 2006, 440: 637-643).

In addition to the immunoprecipitation method, yeast two-hybrid can be exemplified as a commonly used method for analyzing protein interactions. Unlike the immunoprecipitation method, it is possible to observe the interaction between living yeast cells and non-extracellular cells through the transcription of the reporter gene. In the case of the yeast-2 hybrid method using Gal4, the Gal4 transcription factor of yeast is divided into two parts to separate and express the DNA binding region and the transcription active region, and the Gal4 binding region sequence is formed on the reporter gene (e.g., lacZ) promoter . When the two proteins interacting with each other are attached to the DNA binding region and the transcription active region of Gal4 and expressed together, the protein having the DNA binding region of Gal4 binds to the Gal4 binding region sequence, And this Gal4 transcriptional activation region interacts with RNA polymerase II to finally express lacZ, a reporter gene.

The principle of fluorescence resonance energy transfer (FRET) is also commonly used for protein interaction analysis. Fluorescent proteins absorb light of different wavelengths and are excited. When the energy is radiated as light or heat, the fluorescence protein is restored to the ground state and emits light of a unique wavelength band for each fluorescent protein. The fluorescence resonance energy transfer principle is a phenomenon in which light emitted after excitation of a short wavelength fluorescent protein induces excitation of a long wavelength fluorescent protein to emit fluorescence when two different fluorescent proteins are within 10-100 Å. Using these phenomena, two fluorescent proteins were attached to the two proteins after the two proteins to be detected, and the fluorescence resonance energy transfer phenomenon occurred when the two fluorescent proteins were brought close to each other by 10-100 Å due to protein interaction Protein interaction can be analyzed by detecting fluorescence. For example, a fluorescent protein that is excited by light at a wavelength of 488 nm emits fluorescence at a wavelength of 520 nm, which acts as a wavelength to stimulate another fluorescent protein that is paired again and emits fluorescence at a wavelength of 630 nm . Therefore, the interaction of the two proteins can be analyzed by exciting at 488 nm and detecting fluorescence at the 630 nm wavelength band. In a 2006 study, this system was used to analyze the interaction between calmodulin and calmodulin-binding peptides. (Miyawaki et al., Nature 1997, 388: 882-887)

However, all of the above protein interaction assay methods have limitations. In the case of immunoprecipitation, since it is experimented in an in vitro condition, it is often different from the actual in vivo interaction, and since loss is likely to occur during the purification of the protein, It is difficult to do. Although the yeast two-hybrid system is a living cell assay, it is not suitable for analyzing protein interactions existing outside the nucleus because it is a system of complementary binding of transcription factors. Finally, the fluorescence resonance energy transfer principle has the advantage that it can analyze the dynamic interaction of proteins in living cells and has no relation to the inside and the outside of the nucleus. However, in order to detect a subtle change in fluorescence wavelength, And there is a disadvantage that expensive equipment is required for fluorescence resonance energy transfer analysis.

Cell biomolecular fluorescence complementation (BiFC) has been reported to be capable of analyzing protein interactions using these in relatively higher animal cells (Hu et al., Mol. Cell 2002, 9: 789-798). The fluorescence complementary technique utilizes complementary action of two fragments when the fluorescent protein is divided into N-terminal and C-terminal fragments. When two proteins are brought close to each other to interact with each other, two fragments of the fluorescent protein are combined to analyze the fluorescence that appears when a complete fluorescent protein is formed. Hu et al. , The yellow fluorescent protein was divided into N-terminal and C-terminal fragments, followed by attaching them to the transcription factors Fos and Jun proteins, Is a protein interactions between these two transcription factors to be expressed in the cells consists of water are reported to play an important role in the ZIP domain combination thereof.

However, since the diphtheria fluorescence complement system developed so far is intended to artificially express a gene sequence encoding a protein and a sequence encoding a fragment of a fluorescent protein in a plasmid and then artificially expressing the target protein, And there is a limit to accurately showing intracellular protein interactions in their natural state.

In the present specification, in order to analyze the interaction of a specific protein in a yeast cell with the aid of a fluorescence complementary technique, it is preferable that the protein coding gene on the internal genome of the cell, A library of yeast strains attached with a fluorescent protein segment coding gene and an analysis technique using the same.

In order to solve the disadvantages of conventional bifunctional fluorescence complementary techniques, the inventors of the present invention have found that a fluorescent protein fragment gene is inserted into the C-terminal coding region (3 ') of the target protein gene on the genome (chromosome) of Saccharomyces cerevisiae, (Sung & Huh, Yeast 2007, 24: 767-775) by attaching the target protein-fluorescent protein fragment-binding protein to the target protein gene through its own promoter. In addition, by attaching the N-terminal fragment gene of the yellow fluorescent protein to the C-terminal of each of the 6,000 protein genes expressed in the cell in Saccharomyces cerevisiae as a yeast yeast, We have developed a yeast strain library system that can be analyzed at the lowest level. (Sung et al., Genome research 2013, 23: 736-746)

It is an object of the present invention to provide a method for detecting intracellular protein interactions in Saccharomyces cerevisiae at a broader level by introducing into the Saccharomyces cerevisiae a C- '-Terminal) with a C-terminal fragment gene of a yellow fluorescent protein. To accomplish the object of the present invention, a tandem affinity purification (TAP) tag at the C-terminus of each protein gene using an epitope tag substitution system (Huh et al., Yeast 2008, 25: 301-311) In the 6,000 yeast strains with the gene attached, the continuous affinity purification tag gene was replaced with the C-terminal fragment gene of the yellow fluorescent protein. As a result, 5,960 yeast strains expressing the target protein-fluorescent protein C-terminal fragment protein fusions by a promoter unique to the target protein on the chromosome were prepared. Then, the mating type of 5,960 yeast strains was changed from a to alpha so that the library could be applied to the bifunctional fluorescence complementary technique together with the yellow fluorescent protein N-terminal fragment attachment library. As a result, a library of yeast strains with a total of 5,671 yeast strains of yellow protein C-terminal fragments were constructed. Using this, a novel interaction protein was identified by analyzing homologs of homologs in protein interactions at the genome level .

In addition, the library of yellow fluorescent protein C-terminal truncated yeast strains of the present invention can be used for other in vitro analysis methods used for protein interaction analysis or in vivo analysis methods involving non-natural protein expression , It is possible to confirm the presence or absence of interaction in the protein state expressed in a natural state from the unique promoter and the intracellular position of the interaction with respect to the whole proteins of the yeast. In addition, when applied along with the library of yellow fluorescent protein N-terminal truncated yeast strains, the interaction of all the proteins of the yeast can be readily analyzed without the need for any additional process.

As used herein, the term "yeast" is, unless otherwise noted, "the Roman Isis Saccharomyces serenity busy (Saccharomyces cerevisiae ').

'Fluorescent protein' refers to all proteins that emit a detectable fluorescent signal in a conventional manner. Although illustrated herein as a yellow fluorescent protein, a yellow fluorescent protein (eg, Enhanced Yellow Fluorescent Protein (EYFP), Citrine, Venus and Ypet), cyan fluorescent proteins (ECFP, Cerulean, CyPet, mTurquoise2 etc.), green fluorescent proteins (such as EGFP, mKG (monomeric Kusabira Green), Dronpa, For example, mRFP1-Q66T, mCherry, far-red fluorescent protein (e.g., mRaspberry, mKate, mKate2, mPlum, mNeptune, -fluorescent protein), blue fluorescent protein (e.g., EBFP, EBFP2, Azurite, mKalase1, etc.), and the like.

Hereinafter, in-vivo analysis using a fluorescent protein will be described by selecting a yellow fluorescent protein as a representative example of the fluorescent protein.

The 'yellow fluorescent protein' is a protein that emits a yellow fluorescent signal, which may be obtained in nature (separation and / or purification), synthetically or recombinantly produced. For example, 'yellow fluorescent protein' refers to the fluorescent protein of GenBank Accession No. AAQ96629.1, AGM20711.1, ABN59499.1, ABN59461.1, AJW76812.1, AJW76809.1, AJW76798.1, AAO48599.1, AAO48597.1, AEE98867.1, ACS44346.1, BAL45846.1, BAL45818. 1, AFW89951.1, AAO48591.1, AAR85349.1, BAI43897.1, BAI43869.1, AAT48431.1, ACI23596.1, ABV26713.1, ABU48528.1, BAD84181.1, CAD53302.1, CAD53299.1, CAD53296.1, CAD53312.1, and the like, or may contain one or more amino acid sequences selected from Protein Data Bank (PDB) Accession Nos. 5LTQ, 3W1C, 3W1D, 4HE4, 3V3D, 1XA9, 1XAE, 1MYW, and the like, but the present invention is not limited thereto.

The 'C-terminal fragment' and the 'N-terminal fragment' of a yellow fluorescent protein are fragments of a fragment containing a C-terminal fragment (C-terminal fragment) generated by cleaving a yellow fluorescent protein at a specific point (C-terminal fragment), respectively, wherein the cleavage site to generate the C-terminal fragment and the cleavage site to generate the N-terminal fragment may be the same or different. For example, when the cleavage point for generating the C-terminal fragment and the cleavage point for generating the N-terminal fragment are the same, the C-terminal fragment contains the last amino acid of the N-terminal fragment in the amino acid sequence of the yellow fluorescent protein and the C- And the amino acid sequence from the adjacent amino acid to the last amino acid. In another example, when the cleavage site that produces the C-terminal fragment is different from the cleavage site that produces the N-terminal fragment, the C-terminal fragment and the N-terminal fragment are separated by the two cleavage sites of the amino acid sequence of the yellow fluorescent protein (In the case where the cleavage site that produced the C-terminal fragment is located closer to the N-terminal than the cleavage site that produced the N-terminal fragment), either of the two fragments (S) between the two cleavage sites (if the cleavage site that produced the C-terminal fragment is located at the C-terminal side of the cleavage site that produced the N-terminal fragment). In this case, in consideration of the efficiency of fluorescence observation, it is preferable that the cleavage site that generated the C-terminal fragment is located at the N-terminal side (i.e., the cleavage site that generated the N-terminal fragment is C -Terminal fragment and the N-terminal fragment are overlapped with the amino acid residue (s) between the two cleavage points of the amino acid sequence of the yellow fluorescent protein, wherein the C-terminal fragment and the N- . ≪ / RTI > In one example, the number of amino acid residues that are included redundantly is determined depending on the cleavage point, and is about 1 to 50, 1 to 40, 1 to 30, 1 to 20, 5 to 50, 40, 5 to 30, 5 to 20, 10 to 50, 10 to 40, 10 to 30, 10 to 20, 15 to 50, 15 to 40, 15 to 30, or 15 To 20, but is not limited thereto.

The two cleavage sites are each independently an amino acid residue in a loop structure (linker connecting a beta-barrel structure) located at one end of a beta-barrel structure of a yellow fluorescent protein (for example, a non-conservative amino acid residue , But is not limited thereto.

For example, the 'C-terminal fragment' of a yellow fluorescent protein may contain two or more, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, and at least 70 C- May refer to a protein fragment that comprises at least 80, at least 90, at least 100, at least 110, or at least 120 consecutive amino acids (C-terminal to terminal) (C-terminal fragment The upper limit value of the number of amino acids contained in the fluorescent protein is smaller than the total number of amino acids of the yellow fluorescent protein). For example, a "C-terminal fragment" may comprise 50 to 150, 50 to 120, 50 to 90, 70 to 150, 70 to 120, or 70 to 90 consecutive But are not limited to, amino acids (arising from the C-terminus). The 'N-terminal fragment' of the yellow fluorescent protein may contain at least 2, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, , At least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, or at least 170 consecutive amino acids (The upper limit of the number of amino acids contained in the N-terminal fragment is smaller than the total number of amino acids of the yellow fluorescent protein). For example, an 'N-terminal fragment' may comprise 100 to 230, 100 to 200, 100 to 180, 150 to 230, 150 to 200, or 150 to 180 contiguous amino acids of the N-terminus of the yellow fluorescent protein (Starting from the N-terminus), but is not limited thereto.

In one embodiment, the 'N-terminal fragment' of the yellow fluorescent protein is the amino acid of the yellow fluorescent protein (PDB No. 1MYW_A; see http://www.rcsb.org/pdb/explore/remediatedSequence.do?structureId=1MYW ) (For example, SEQ ID NO: 12) comprising a total of 172 amino acids from the first to the 172th amino acid in the N-terminal methionine (M) in the sequence, and the 'C-terminal fragment' (For example, SEQ ID NO: 11) (in this case, the two fragments comprise a total of 17 amino acids from the 156th to the 172th amino acid sequence of the yellow fluorescent protein, .

One example of the present invention is that the C-terminal fragment encoding gene of the yellow fluorescent protein works on the C-terminal coding region (3'-terminal) of the gene encoding the protein on the genomic DNA of Saccharomyces cerevisiae ( Saccharomyces < / RTI >< RTI ID = 0.0 > S. cerevisiae strain library.

The "C-terminal fragment coding gene of yellow fluorescent protein" is a polynucleotide encoding the C-terminal fragment of the yellow fluorescent protein as described above, and is a polynucleotide which is optimized, for example, to be suitable for expression in Saccharomyces cerevisiae Lt; / RTI >

Quot; operably linked "means that the C-terminal fragment encoding gene of the inserted yellow fluorescent protein is linked so that it does not affect the expression of the endogenous gene in Saccharomyces cerevisiae.

The gene for Saccharomyces cerevisiae is preferably selected from about 6,000 genes known to be expressed as proteins in the cells of Saccharomyces cerevisiae. For example, the library may be constructed so that any gene selected from 5,671 genes listed in Table 1 below is recombined in each strain, that is, the C-terminal fragment encoding gene of the yellow fluorescent protein is operable at the 3 'end of the gene , And 5,671 strains linked to each other. The number of strains constituting the library may be the number (for example, 5,671) in which all the 5,671 recombinant genes can be contained or may be a number (for example, one or more, more than 100, More than 2000, more than 3000, more than 4000, or more than 5000), but the present invention is not limited thereto.

In this strain library, a list of genes (ORFs) on genomic DNA in Saccharomyces cerevisiae to which the C-terminal fragment encoding gene of the yellow fluorescent protein is operably linked at the 3 'end is shown in Table 1 below:

The detailed gene information of the genes listed in Table 1 can be confirmed through a route well known in the art (see, for example, www.yeastgenome.org).

A strain containing a recombinant gene (first recombinant gene) to which the C-terminal fragment encoding gene of the yellow fluorescent protein is ligated to the 3 'end included in the strain library interacts with the protein encoded by the recombinant gene Forming a first recombinant gene and a second recombinant gene obtained by crossing with a strain containing a recombinant gene (second recombinant gene) encoding the protein to which the N-terminal fragment encoding gene of the yellow fluorescent protein is linked at the 3 'end And the yellow fluorescent signal is obtained by expressing the full-length yellow fluorescent protein in the strain containing all of them.

Thus, a library comprising a recombinant yeast strain having a recombinant gene to which a C-terminal fragment encoding gene of a yellow fluorescent protein is linked at the 3 'end provided in the present specification can be used as a protein interrelator in a cell (Saccharomyces cerevisiae) Protein interactions (e. G., Protein-protein interactions, e. G., Protein-protein interactions), e. G. Complex formation) analysis, identification, and / or testing.

In one embodiment, the protein-protein interaction may be an interaction between the same proteins, for example, a homomer (e.g., homodimer) formation that forms the same inter-protein complex. In this case, the library may include a recombinant gene to which at least the C-terminal fragment encoding gene of the yellow fluorescent protein is linked to the 3 'end of the coding gene (the gene on the yeast genome DNA) of the same protein as the analysis target protein. In addition, the library includes a yeast strain (yeast strain containing N-terminal fragment of a yellow fluorescent protein) containing a recombinant gene to which an N-terminal fragment encoding gene of a yellow fluorescent protein is linked at the 3 'end of the coding gene of the protein to be analyzed May be further included. In this case, genome-wide protein-protein interaction analysis in yeast cells is possible.

The genes coding for proteins that form an allogeneic complex in vivo in Saccharomyces cerevisiae analyzed by the above method are set forth in Table 2 below:

In one embodiment, the recombinant Saccharomyces cerevisiae strain library provided herein is obtained by introducing into Saccharomyces cerevisiae a protein encoded by the genes listed in Table 2 above in vivo (Or detecting, measuring, or observing) the formation of a homozygote of at least one protein selected from the group consisting of:

One example of the present invention provides a homozygote of a protein encoded by a gene selected from the genes listed in Table 2 present in vivo in Saccharomyces cerevisiae.

In other embodiments, the protein-protein interaction may be a heteromer (e. G., Heterodimer) formation that forms interactions between different proteins, e. G., Different inter-protein complexes. In this case, the library includes at least the C-terminal fragment coding (SEQ ID NO: 2) of the yellow fluorescent protein at the 3 'end of a partner protein or partner candidate protein encoding gene (yeast genomic DNA gene) interacting Or a recombinant gene to which the gene is linked. In addition, the library comprises a yeast strain (a recombinant yeast strain containing an N-terminal fragment of a yellow fluorescent protein) containing a recombinant gene to which an N-terminal fragment encoding gene of a yellow fluorescent protein is ligated to the 3 ' . ≪ / RTI >

In yet another embodiment, the protein-protein interaction may be any protein-protein interaction in the yeast cell, wherein the library comprises a gene (e. G., Selected from the genes listed in Table 1) on the yeast genomic DNA The yeast strain containing the recombinant gene to which the C-terminal fragment encoding gene of the yellow fluorescent protein is linked at the 3 'end is substituted with the protein coding gene (3' terminal end of the recombinant gene shown in Table 1) (Including the C-terminal fragment of the yellow fluorescent protein) and further comprising a gene (for example, selected from the genes listed in Table 1) on the yeast genome DNA End of the yeast strain, which contains the recombinant gene to which the N-terminal fragment encoding gene of the yellow fluorescent protein is linked (Including the N-terminal fragment of the yeast strain of yellow fluorescent protein), as well as any one or more, for example, all of the protein coding genes described in Table 1.

Another example provides a method for producing Saccharomyces cerevisiae strain library using vector DNA for epitope tag substitution. Specifically,

(1) amplifying a substitution module using a vector DNA for epitope tag substitution (that is, a vector DNA comprising a C-terminal fragment gene of a yellow fluorescent protein) as a template;

(2) transforming yeast cells ( Saccharomyces cerevisiae ) by introducing the amplified substitution module into cells having a replacement target gene; And

(3) selecting cells containing the recombinant gene to which the substitution target gene is linked with the substitution target gene

. ≪ / RTI >

Since the mating types of the yeast strains of the N-terminal fragment-containing yeast strain library of the yellow fluorescent protein to be reacted (mated) with the C-terminal fragment-containing yeast strain library of the yellow fluorescent protein must be different from each other, A step of switching the mating type of the yeast strain library containing the C-terminal fragment of the fluorescent protein or the library containing the N-terminal fragment of the yellow fluorescent protein.

For example, the library production method may further include, after the step (3)

(4) introducing a mating type switching induction vector containing a gene for mating type conversion into the cells selected in the above step (3)

. ≪ / RTI >

Further, the above-mentioned library production method may further comprise, after the step (4)

(5) a step of selecting mating type-transformed cells

. ≪ / RTI >

For example, when the mating type of the starting yeast is a and the mating type of the yeast of the yeast strain library containing the N-terminal fragment of the yellow fluorescent protein is a, the method for producing a library may further comprise, after step (3) May further comprise: < RTI ID = 0.0 >

(4-1) introducing a mating type conversion induction vector containing a gene for mating type conversion into cells selected in step (3), and transforming the cells; And

Optionally, (5-1) screening mating type alpine cells.

Further, in order to prevent unintended further switching after switching to a desired mating type, the library manufacturing method may further include, after the step (5) or (5-1)

(6) removing the mating type conversion inducing vector

. ≪ / RTI >

The transfected cells (host cells) in the step (2) may be selected from the group consisting of prokaryotic cells, eukaryotic cells such as yeast cells, animal cells, and the like. For example, the cell may be a yeast cell to which a continuous affinity purification tag gene is attached. In order to facilitate selection of successfully transformed cells, a specific nutrient (sugar, amino acid, lipid, DNA Quot; is a nutritional requirement cell lacking one or more genes encoding a protein associated with the biosynthesis of < RTI ID = 0.0 > The deficient gene may be at least one, including at least the selectable marker gene described below.

As used herein, the term " vector " refers to a DNA molecule capable of binding and transferring another DNA thereto. In one example, the vector may be a vector capable of self-replication and expression of the nucleic acid bound thereto.

The above-mentioned "epitope tag substitution vector" is a vector in which an epitope tag attached to the C-terminal coding region (3 'end) of a specific gene is inserted into a VC tag (yellow fluorescent protein C- terminal fragment (84 aa) Quot; epitope tag substitution vector "may include a C-terminal fragment encoding gene (VC) of a yellow fluorescent protein and a selective marker gene for screening for transformation, The selection marker gene can be located in the order of VC, selection marker gene, selection marker and VC sequence in the direction of the target gene. The selection marker gene can be used for biosynthesis of antibiotic resistance gene, specific nutrients (sugar, amino acid, lipid, DNA LEU1, LEU2, the URA family (e.g., URA3 (eg, KlURA3)), genes encoding the genes involved in MET synthesis (for example, (For example, MET15, etc.)), etc. If the cell is a nutrient requirement cell lacking one or more of a specific nutrient biosynthetic protein encoding gene, In one embodiment, the epitope tag substitution vector is selected from the group consisting of SEQ ID NO: 1 (pFA6a-VC155-LEU2) comprising the LEU2 gene as a selectable marker, and the selectable marker may be selected from the genes deficient in the auxotrophic cells. Or a recombinant vector having a sequence (Fig. 1).

The substitution module refers to a polynucleotide fragment comprising a C-terminal fragment encoding gene (VC) of a yellow fluorescent protein contained in the above-described epitope tag substitution vector and a selective marker gene for screening for transformation. Amplification of the replacement module may be accomplished through any conventional means known to those skilled in the art. For example, the amplification of the substitution module can be carried out using the C-terminal fragment encoding gene (VC) of the yellow fluorescent protein and the 5'-terminal region of the polynucleotide containing the selectable marker gene for screening for transformation (about 5-100 bp, 50 bp, or 5 to 30 bp) and a primer capable of hybridizing (complementarily binding) to the 3'-terminal region (about 5 to 100 bp, 5 to 50 bp, or 5 to 30 bp).

The "substitution target gene" refers to a gene that binds (recombines) the C-terminal fragment encoding gene of the yellow fluorescent protein to the 3'-terminal among the genes in the genome of a cell (eg, yeast).

Said "transformation" means that foreign DNA or RNA is absorbed into the cell genome and the genotype of the cell is changed.

The step (step (3)) of selecting the cells containing the recombinant gene to which the substitution target gene is linked with the substitution target gene may include a step of culturing the transformed cells in the selection medium in step (2).

The selection medium means a medium containing a replacement module containing the above-mentioned selection mark, that is, a cell in which a cell in which the replacement module has been successfully transformed is viable and a cell in which a replacement module is not contained can not survive . When the selection mark is an antibiotic resistance gene, the selection medium may be a medium containing an antibiotic resistant to the antibiotic resistance gene. When the selection marker is a nutrient biosynthesis-related protein-encoding gene, the selection medium may be a medium lacking the biosynthesis nutrients. For example, when the selection marker is an LEU2 gene, the selection medium may be a leucine deficient medium, and when the selection marker is KlURA3, the selection medium may be a uracil deficient medium.

In one embodiment, in order to facilitate selection of the transformed cells, the cell may further comprise at least two nutritional biosynthetic-related protein-encoding genes deficient in the selectable marker gene (in the case of a protein encoding the nutrient biosynthesis-related protein) (Step (3)) of selecting a cell containing a recombinant gene to which the substitution target gene is linked,

(3-1) culturing the cells transformed in step (2) in a selection medium to obtain growth cells; And

(3-2) culturing the cells obtained in the step (3-1) in a medium lacking one or more nutrients other than the nutrients related to the selection marker,

. ≪ / RTI >

In one example, when the cell (host cell) is a histidine, leucine, methionine, and uracil auxotrophic strains and the selectable marker is the LEU2 gene,

The step (step (3)) of selecting a cell containing a recombinant gene to which the substitution target gene is linked with the substitution target gene,

(3-1) culturing the transformed cells in the leucine-deficient medium in the step (2), thereby obtaining cells growing; And

(3-2) culturing the cells obtained in the step (3-1) in a medium lacking at least one selected from the group consisting of histidine, methionine and uracil to obtain cells that do not grow

. ≪ / RTI >

The "mating type switching vector" means a vector comprising a gene encoding a protein that mediates mating type switching (for example, conversion from a type to alpha type) in yeast cells. The protein mediating the mating type conversion (e.g., converting from a type to alpha type) may be HO endonuclease, etc., and the gene encoding the protein may be the HO gene, etc.

The selection step (step (5) or step (5-1)) of selecting mating type-transformed cells (for example, mating type alpine cells) after switching the mating type may be performed by using the selection marker (for example, KlURA3 gene, etc.) And a selection medium (a medium lacking the product associated with the selection marker, for example, uracil deficient medium when the selection marker is KlURA3 gene).

The step of removing the mating type conversion inducing vector (step (6)) may be performed by any means known in the art. For example, the step (6) may be performed by treating at least one cell selected from the group consisting of 5-fluorouracetic acid (5-FOA) and the like in the cell selected in the step (5).

In another example, the C-terminal fragment encoding gene of the yellow fluorescent protein works on the C-terminal coding region (3'-terminal) of the gene encoding the protein on the genomic DNA of Saccharomyces cerevisiae described above Linked recombinant Saccharomyces cerevisiae ( Saccharomyces there is provided an application for use in the analysis of protein interactions in vivo in Saccharomyces cerevisiae of a S. cerevisiae strain library (a recombinant yeast strain library containing C-terminal fragment encoding gene of yellow fluorescent protein).

One example provides a composition for analyzing protein interactions in vivo in Saccharomyces cerevisiae comprising a recombinant yeast strain library containing a C-terminal fragment encoding gene of the yellow fluorescent protein. The above composition further comprises a yeast strain (recombinant yeast strain containing N-terminal fragment of a yellow fluorescent protein) containing a recombinant gene to which an N-terminal fragment encoding gene of a yellow fluorescent protein is linked at the 3 'end of the coding gene of the protein to be analyzed . The yeast strain library is as described above.

In another example, a strain of the recombinant yeast strain library containing the C-terminal fragment encoding gene of the yellow fluorescent protein is inoculated to the Saccharomyces cerevisiae, which contains the strain in each of the divided sections which are regularly arranged for each recombinant gene And a chip for analyzing protein interaction. The chip further comprises a yeast strain (recombinant yeast strain containing N-terminal fragment of a yellow fluorescent protein) containing a recombinant gene to which the N-terminal fragment encoding gene of the yellow fluorescent protein is linked at the 3 'end of the coding gene of the protein to be analyzed . In the above chip, the yeast strain library is as described above.

In one embodiment, a composition and / or a chip for analyzing protein interactions in vivo in the Saccharomyces cerevisiae is provided in a cell (in vivo) to Saccharomyces cerevisiae, (Or detecting or measuring or observing) the formation of a homozygote of at least one protein selected from the proteins encoded by the gene of interest.

Yet another example provides a method for analyzing protein interactions in vivo in Saccharomyces cerevisiae using the library.

Specifically, the analysis method comprises:

(a) a recombinant Saccharomyces cerevisiae operably linked to the C-terminal fragment coding gene of the yellow fluorescent protein operably linked to the C-terminal coding region (3'-terminal) of the gene on the genomic DNA of Saccharomyces cerevisiae Preparing a strain library (a C-terminal fragment recombinant yeast strain library of yellow fluorescent protein) in Cerebida;

(b) a recombinant Saccharomyces cerevisiae gene operably linked to the C-terminal coding region (3'-end) of the gene on the genomic DNA of Saccharomyces cerevisiae with a yellow fluorescent protein N- Preparing a strain library (N-terminal fragment recombinant yeast strain library of yellow fluorescent protein);

(c) crossing a strain of the C-terminal fragment recombinant yeast strain library of the prepared yellow fluorescent protein with an N-terminal fragment recombinant yeast strain of the yellow fluorescent protein to produce diploid cells;

(d) selecting the resulting diploid cells; And

(e) detecting a yellow fluorescence signal in the diploid cell

. ≪ / RTI > The order of execution of steps (a) and (b) may be reversed.

The C-terminal fragment recombinant yeast strain library of the yellow fluorescent protein and the N-terminal fragment recombinant yeast strain of the yellow fluorescent protein are as described above.

As described above, since the mating types of yeast of the C-terminal fragment-containing yeast strain library of the yellow fluorescent protein and the yeast of the yeast strain library containing the N-terminal fragment of the yellow fluorescent protein are different from each other, the hybridization is possible, Prior to step (c) of mating, the mating types of the yeast strain library containing the C-terminal fragment-containing yeast strain library of yellow fluorescent protein or the N-terminal fragment of yellow fluorescent protein were switched, And may further comprise different steps.

The yeast strain contained in the C-terminal fragment recombinant yeast strain library of the yellow fluorescent protein may include a first selection marker and the N-terminal fragment recombinant yeast strain of the yellow fluorescent protein may include a second selection marker . The first selection marker and the second selection marker may be selected from among the markers described above and may be different for the sorting efficiency. In this case, the host cell may be a nutritional requirement strain lacking two or more nutrient biosynthesis-related genes including a first selection marker and a second selection marker.

The step of selecting the diploid cells (step (d)) comprises culturing both the first selection medium deficient in the first selection marker-related nutrients and the second selection medium deficient in the second selection marker-related nutrients ) Cells. ≪ / RTI >

For example, the step of selecting the diploid cells (step (d)

(d-1) culturing the cells in a first selection medium lacking the first selection marker-related nutrients to obtain growth cells; And

(d-2) culturing the cells in a second selection medium lacking nutrients related to the second selection marker,

(The order of steps (d-1) and (d-1) may be changed).

The detection of the yellow fluorescence signal in the step (e) can be carried out through any conventional means, for example, by observation with a fluorescence microscope.

When the yellow fluorescent signal is detected in step (e), the protein (first protein) encoded by the recombinant gene in the N-terminal fragment recombinant yeast strain of the yellow fluorescent protein is a C- It can be judged that the yeast strain contained in the truncated recombinant yeast strain library forms a complex with a protein encoded by the recombinant gene (a second protein, for example, a first protein and a homologous protein).

In one embodiment, a method for analyzing the interaction of proteins in vivo with the Saccharomyces cerevisiae can be performed by inoculating the Saccharomyces cerevisiae in vivo with the genes listed in Table 2 above (Or detecting, measuring, or observing) the formation of a homozygote of one or more proteins selected from the proteins encoded by the protein. A procedure for confirming the formation of homotypic complexes using the C-terminal fragment recombinant yeast strain library and the N-terminal fragment recombinant yeast library of the yellow fluorescent protein in the protein interaction assay is illustrated in FIG.

The present invention relates to a library system consisting of 5,671 yeast strains attached to each gene of a yellow fluorescent protein C-terminal fragment gene so that the interaction of specific proteins in living yeast cells can be analyzed at the genome level using a bifunctional fluorescence complementary technique This library provides a method for analyzing the interaction between the target protein and the whole intracellular protein. The present invention is based on a bimolecular fluorescence complementary technique, and unlike an artificial protein expression method using an extracellular assay method or a plasmid, a protein is expressed by its own unique promoter, . This library will be useful for analyzing intracellular protein interactions because it will be able to find the unknown protein interacting with the target protein relatively easily and economically among the whole proteins expressed in yeast cells.

Figure 1 is a sequence map of pFA6a-VC-LEU2, a recombinant vector for epitope tag substitution.
Fig. 2 schematically shows the preparation of a vector for substituting an epitope tag and the substitution method of a C-terminal epitope tag.
Figure 3 shows the process of confirming the epitope tag substitution.
Fig. 4 (A) is a schematic diagram showing a process of switching mating types of strains attached with C-terminal fragment of yellow fluorescent protein, showing the principle of mating type conversion by HO protein in yeast cells, ) Shows the process of selecting strains in which the mating type has been successfully transformed.
Fig. 5 shows a method of obtaining a diploid strain succeeded in crossing. A diploid strain was successfully identified by selection of the medium. The library strain expressing the VN binding protein and the library strain expressing the VC binding protein were cultured together in the YPD medium for two hours and then transferred to the SC-Leu-Ura medium and cultured at 30 ° C for 48 hours. The white colonies shown in the figure show that successful crosses can grow on SC-Leu-Ura medium.
FIG. 6 shows a result of analyzing fluorescence signals of a protein forming homol-type complex using a bimolecular fluorescence complementary technique. Fluorescence images were obtained using a standard fluoro neoisothiocyanate filter set (450-490 nm; beam splitter, 510 nm; emission band pass filter, 515-565 nm).
FIG. 7 is a schematic diagram showing an example of cross-breeding of a C-terminal fragment attachment library and a N-terminal fragment attachment library of a yellow fluorescent protein and observation of allogeneic complexes.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example  One: Epitope  Fabrication of plasmids for tag displacement and amplification of displacement modules

1.1. Epitope  Preparation of vector for tag substitution

The vector pFA6a-VC-LEU2 (FIG. 1) for substitution of the yellow fluorescent protein C-terminal fragment epitope tag with SEQ ID NO: 1 and a substitution module capable of substituting the C-terminal fragment of the yellow fluorescent protein Respectively.

Specifically, a vector (pFA6a-VC-KlURA3; SEQ ID NO: 2) containing a yellow fluorescent protein C-terminal fragment was prepared in order to construct a vector (pFA6a-VC-LEU2) for yellow fluorescent protein C- terminal fragment epitope tag substitution A plasmid obtained by removing the KlURA3 gene by BglII-PmeI restriction enzyme treatment was obtained, and the 2,150 bp LEU2 gene obtained by PCR was ligated to the KlURA3 site of the plasmid (primer: SEQ ID NO: 5 &

1.2. Epitope  For tag substitution PCR  Amplification of sections

For PCR amplification, 2.5 μl (microliter) of 10 x Taq buffer, 2.5 μl of 10 x Pfu Buffer, 5 μl of 2 mM each dNTP, 5 μl of 5 μM each oligonucleotide primer (F2CORE (SEQ ID NO: 4), R1CORE No. 5)), pFA6a-VC-LEU2 vector DNA, Pfu DNA polymerase and Taq DNA polymerase, and the total volume was adjusted to 50 μl. PCR amplification conditions were 94 ° C for 2 minutes 30 seconds (1 cycle), 94 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 2 minutes and 30 seconds (40 cycles), and finally 72 ° C for 10 minutes ).

Example  2: single step PCR  one-step PCR ) Epitope  Tag substitution

2.1. Yeast strains and growth medium

During the course of the library production, all strains of Saccharomyces cerevisiae were transformed with Saccharomyces cerevisiae strain Yeast strains with sequencing-affinity purification tag gene derived from BY4741 ( MAT a △ his3 △ leu2 △ met15 △ ura3 ) (Ghaemmaghami et al., Nature 2003, 425: 737-741). Yeast cells were grown in YPD (Yeast Peptone Dextrose; 1% yeast extract, 2% peptone, 2% glucose) medium and cultured at 30 ° C to OD ₆₀₀ = 0.7-1.0.

2.2. Transformation of yeast cells and Epitope  Selection of tagged cells

Strains with the continuous affinity purification tagged gene cultured in YPD (see Example 2.1) were transformed using a known lithium acetate method (Gietz et al., Yeast 1995, 11: 355- 360). When the epitope tag substitution method is applied by the lithium acetate method, the continuous affinity purification epitope tag is replaced with the yellow fluorescent protein C-terminal fragment tag as shown in FIG. The substitution method will be described in detail with reference to FIG. 2 as follows: VC-LEU (SEQ ID NO: 3) is constructed by using the pFA6a-VC-LEU2 vector as a template and F2 CORE primer Were amplified by PCR. The yellow fluorescent protein C-terminal fragment cassette amplified by PCR was introduced into the yeast cells to be substituted with the continuous affinity purified tag cassette on the yeast chromosome by homologous recombination. Such a substituted strain expresses a protein in which a yellow fluorescent protein C-terminal fragment (ligated with the LEU2 gene: VC-LEU2) is bound to a specific protein coding gene (substitution target gene) (3'-terminal).

The transformed cells were seeded in a selective medium without synthetic leucine (SC-Leu) and cultured at 30 ° C for 3 days. Several colonies were picked and inoculated into new SC-Leu liquid medium (0.67% yeast nitrogen base w / o amino acids, Leu-dropout supplement, 2% glucose, 2% agar). After incubation at 30 ° C for 24 hours, the cells were inoculated simultaneously with SC-Leu solid medium and synthetic complete without histidine (SC-His) and cultured at 30 ° C for 48 hours. As a result, strains which grew in the SC-Leu solid medium (colony formation) but did not grow in the SC-His solid medium were selected as cells with yellow fluorescent protein C-terminal fragment tags properly substituted (see FIG.

Primer and yeast strains used in the examples provided herein are shown in Table 3 and Table 4 below:

≪ Oligonucleotide primers used in Examples > primer The sequence (5 '- > 3') F2CORE GGTCGACGGATCCCCGGGTT (SEQ ID NO: 4) R1CORE TCGATGAATTCGAGCTCGTT (SEQ ID NO: 5) pCgLEU2-600 GTCAGGATCCAAGGCTTCAAGTCATATAGC (SEQ ID NO: 6) pCgLEU2 + 1320R CGTCATTGGTAGTCATTATGCGGATTTGG (SEQ ID NO: 7) T (TEF) -F3-L CGTAAATCCGCATAATGACTACCAATGACGTTCCCTAC (SEQ ID NO: 8) T (TEF) -R CATCGATGAATTCGAGCTCG (SEQ ID NO: 9)

≪ Yeast strains used in Examples > Strain genotype source TAP-tagged yeast
library MAT a his3Δ1 leu2Δ0 met15Δ0 ura3Δ0
Gene X-TAP :: His3MX6 Ghaemmaghami et al. (2003) VN-tagged yeast library (used for observing BiFC signals) MAT a his3Δ1 leu2Δ0 met15Δ0 ura3Δ0
Gene X- VN :: Klura3 Sung et al. (2013)

A yeast strain library with a yellow fluorescent protein C-terminal fragment containing a total of 5,960 yeasts was obtained by the above method.

Example  3: The yeast strain library Mating  Type conversion

The mating type of a total of 5,960 yeast strains contained in the yeast strain library with the C-terminal fragment of the yellow fluorescent protein obtained in Example 2.2 was transformed into a pJH132 (GAL-HO-URA3) vector , Brandeis University; "Jensen and Herskowitz, 1984") were introduced into the cells. The vector has the HO gene encoding the protein that mediates the mating type conversion of yeast under the GAL promoter and is encoded together with the KlURA3 gene so that it can be used as a selective marker gene. For the vector transformation, the lithium acetate method described in Example 2.2 was used in the same manner. Then, in order to induce the expression of the HO gene, 5% galactose was added to an SC-free glucose-free medium, Cells were cultured for 4 hours and strains successfully mating type were selected. (See Fig. 4).

Fig. 4 (A) is a schematic diagram showing a process of switching mating types of strains attached with C-terminal fragment of yellow fluorescent protein, showing the principle of mating type conversion by HO protein in yeast cells, ) Shows the process of selecting strains in which the mating type has been successfully transformed. The strains which were expected to be mated to alpha were cultured in YPD medium to OD 1.0, followed by the same amount of mating type a strain cultivated up to OD 1.0, followed by incubation at 30 ° C for 2 hours. The mating types alpha and a met When mating occurs, broad-shaped sediments such as those in the left three wells of (B) are identified.

5-FOA (5-Fluoroorotic acid) was treated to prevent further unintentional mating type switching since the yeast cells constituting the library continued to have the pJH132-PGAL-HO-KlURA3 vector, The vector was removed.

As a result, a mating type was converted to an alpha type and a yeast strain library consisting of a total of 5,671 yeasts (see Table 4) with a yellow fluorescent protein C-terminal fragment attached was obtained:

Example  4: crossing yeast cells of the yeast strain library with the yellow fluorescent protein N-terminal fragment attachment library

Example As described in 2.1, yellow C- terminal fragment attached to a yeast strain library consecutive affinity purification tag attached gene library yeast strain used to produce the fluorescent protein is BY4741 in my process serenity busy with saccharide (MAT a his3 △ △ leu2 △ △ met15 ura3) was produced by the strain to the base, a yellow fluorescent protein C- terminal first part because the selected marker gene used in the attachment is LEU2, strains that make up the library are histidine, methionine (methionine), and nutrition of the uracil It is an auxotrophic strain.

The yellow fluorescent protein N-terminal fragment attachment yeast strain library (refer to Korean Patent No. 1139589, which is incorporated herein by reference, see Table 1 of the above document) is also used for S. aureus BY4741 ( MAT a ? His3 ? Leu2 ? Met15 ?? 3 ) was used as the basic strain, and the selective marker gene used for attaching the yellow fluorescent protein N-terminal fragment (SEQ ID NO: 10) was KlURA3. Therefore, when the strains of two libraries are crossed, the diploid strain can be screened in a medium in which both uracil and leucine are deficient.

To analyze allogeneic complex proteins present in yeast cells, yeast cells in which the C-terminal and N-terminal fragments of the yellow fluorescent protein were attached to the same gene were crossed in the library to obtain leucine-uracil deficient medium (SC-Leu- Ura) were screened for a yeast strain of diploids in which both N-terminal and C-terminal fragments of fluorescent protein were expressed. The mating process is as follows. The yeast library strain having the C-terminal of the fluorescent protein and the yeast library strain having the N-terminal of the fluorescent protein were immobilized in a 96-well deep well plate containing 200 μl of YPD medium at 30 ° C. OD ₆₀₀ = 1.0. Then, 100 μl of C-terminal fragment or N-terminal fragment attached to the same gene was added to each well, followed by incubation for about 2 hours at 30 ° C. in an incubator . The thus cultured yeast strain was inoculated on leucine-uracil-deficient medium to select the diploid strain, and cultured for about 3 days to select strains growing on the medium (FIG. 5).

Example  5: Analysis of Protein Interaction through Microscopic Observation

In order to analyze the homozygous complexes in the protein interactions using the heterozygous strains obtained by crossing the C-terminal fragment-integrated yeast strain library and the N-terminal fragment-integrated yeast strain library, OD ₆₀₀ = 0.7 in a synthetic complete liquid medium A certain amount of cultured cells was taken and observed with a fluorescence microscope. The microscope analysis was performed using a Carl Zeiss Axiovert 200M fluorescent-lighted microscope equipped with a monochrome CCD camera. To detect fluorescence emitted by the complementary binding of the N-terminal and C-terminal fragments of the yellow fluorescent protein by protein interaction, light of 450 to 490 nm wavelength was irradiated using a Carl Zeiss B10 shift free Blue wide band to BP filter Light of 515 ~ 565 nm wavelength was detected and exposure time was set to 2000 ms.

Example  6: Protein interaction analysis using the yeast strain library of the present invention

To confirm that the yeast strain library selected in Example 4 above is suitable for studying intracellular protein interactions in Saccharomyces cerevisiae, homogeneous complexes analysis was carried out in yeast.

Protein complexes are divided into several groups according to their constituent elements. Among them, allogeneic complexes are composed of two or more proteins of the same kind to form a functional and functional unit. In human cells, 199 of the 452 enzymes have been reported to be homozygous for activity (N. J. Marianayagam et al., 2004). By making proteins homologous, cells can produce large and complex structures using simple small proteins, create new active sites, or mask existing sites of activity. It is also possible to control the concentration of the protein simply by inducing a state in which the same type of complex is formed or not. This simple strategy is a widely used strategy for controlling the function of proteins in cells because it is a way to obtain various effects. Therefore, allogeneic complex studies are indispensable for deep understanding of proteins. Since yeast cells have not yet been studied for a homogeneous complex at a wide range of levels, the yellow fluorescent protein C-terminal fragment attachment library and the N-terminal fragment attachment library are crossed to observe allogeneic complex proteins present in the yeast cells through a fluorescence microscope Respectively.

FIG. 6 shows a part of the results obtained by observing the fluorescence complement of the homologous complex protein using the yeast library with respect to the cell organellation, together with the DIC (Differential Interference Contrast) microscopic image. In Fig. 6, Protein X, Protein Y, and Protein Z represent Pet10, Tip1, and Alb1, respectively. As shown in FIG. 6, it can be seen that the fluorescence signal appears in various shapes depending on the organelle.

<110> Seoul National University R & DB Foundation <120> Yellow fluorescent protein fragment-fusion yeast gene library and          method of analysis of protein-protein interaction using the same <130> DPP20165974KR <160> 12 <170> Kopatentin 2.0 <210> 1 <211> 5284 <212> DNA <213> Artificial Sequence <220> <223> pFA6a-VC-LEU2 vector <400> 1 gaacgcggcc gccagctgaa gcttcgtacg ctgcaggtcg acggatcccc gggttaatta 60 accgtccggc gtgcaaaatc ccgaacgacc tgaaacagaa agtcatgaac cacgacaagc 120 agaagaacgg catcaaggcc aacttcaaga tccgccacaa catcgaggac ggcggcgtgc 180 agctcgccga ccactaccag cagaacaccc ccatcggcga cggccccgtg ctgctgcccg 240 acaaccacta cctgagctac cagtccgccc tgagcaaaga ccccaacgag aagcgcgatc 300 acatggtcct gctggagttc gtgaccgccg ccgggatcac tctcggcatg gacgagctgt 360 acaagtaggg cgcgcctctc tgcttttgtg cgcgtatgtt tatgtatgta cctctctctc 420 tatttctatt tttaaaccac cctctcaata aaataaaaat aataaagtat ttttaaggaa 480 aagacgtgtt taagcactga ctttatctac tttttgtacg ttttcattga tataatgtgt 540 tttgtctctc ccttttctac gaaaatttca aaaattgacc aaaaaaagga atatatatac 600 gaaaaactat tatatttata tatcatagtg ttgataaaaa atgtttatca gatctaaggc 660 ttcaagtcat atagcgttta aatttccata tgtatattag aatacactaa gaactttcat 720 ttttacatat aattttttcc aaattcccat cctttttacc aatagatagc ggtttaatat 780 aaggtttcaa caagaaatat tttgtgaaaa tcaaaagtta atagtttcac tgtcgaaaat 840 atgaaagttt aagttttcag ttcatcccat tgtagttatc aaatttctgt gtttcccgta 900 tatgtgtgct ctgtattcat cgctatcttg aaactggtta tgatcgttgc gcatgtgacc 960 tgtatcgctc aaaagagccc ggcaccggta ccgggcaaaa gcccctagca agctaaaatg 1020 attcaacttt cgtagtaatt tgttcaaccg gtcacagtaa agtcaatgac taacttttga 1080 atcgaggatg tatttccaat tgaaagcaat gtatatata accattgtgt tgaagcttgt 1140 cttacagttt tcttgtatcc tcccattgtt catatagtac ttaaagtacc ataatcctta 1200 aagaacaaac ttgaaagaga atacactata cacaactaat aaataaagaa taatcatggc 1260 tgtgaccaag acaattgtag ttctaccagg tgaccatgtt ggtcaagaaa tcactgaaga 1320 ggccattaaa gttttaaatg ctattcagga atgtcgtcca gacaaggtca atttcaagtt 1380 tgatcatcat ttgatcggtg gtgctgcaat tgatgccact ggtgttccat taccagacga 1440 agctttggag gcctctaaga aagctgatgc cgtgcttctg ggtgctgttg gtggtccaaa 1500 atggggtact ggcgctgtca gaccagaaca aggtcttttg aaaatccgta aggagttgca 1560 attgtatgct aatctaagac catgtaattt tgcatctgat tccttactag atctatcgcc 1620 attgaagcct gaaattgcaa gaggtacaga tttcgtcgtt gttagagaac tagtgggtgg 1680 tatttatttc ggggagagaa aagaagatga aggtgatggt gtcgcctggg atagcgaaaa 1740 gtattctgtg cccgaagttc aaagaatcac tagaatggct gctttcatgg ctctgcaaca 1800 caacccacct ttacctattt ggtctctaga taaagccaac gttctagcat catcaagatt 1860 atggagaaaa acagtggaag agacgattaa gaatgaattc ccacaattga ctgttcaaca 1920 tcaattgatt gattccgctg ctatgatctt ggttaagaac ccaactcatc taaatggtat 1980 tattatcaca aacaatatgt ttggtgatat tatctccgat gaagcctccg tgatcccagg 2040 ttcgttagga ttacttccat ctgcctcctt ggcatctctt ccagataaga atacggcatt 2100 tggtttatat gagccatgtc atggctctgc tccagactta ccaaagggaa aggttaaccc 2160 cgtagcaaca atcctatctg ctgctatgat gttgaagttg tctctggacc tgttcgaaga 2220 aggtgaaatt atagaacaag cagtcaagaa agtgttggat tctggtatca gaacagcgga 2280 tctaaagggt accaactcta ctactgaggt cggtgatgca gtagcgaaag ctgtcaggga 2340 actattagct tagacttagt agatgtacag ttgcatacat aagtctgaac agaaagaagt 2400 aaatatcata tctagttcgg tttagaaatc agtgactata ttggttttga ccagatcgca 2460 atccttgcaa gcatttagta atgactatca aaccggtgaa tcatctgata aggctatatt 2520 agcttgtgca ttcgcatgta tcgggaaacg aactttacgt aaatccgcat aatgactacc 2580 aatgacgttc cctcaaccaa aggtgttttg atgtgaagta ctgacaataa aaagattctt 2640 gttttcaaga acttgtcatt tgtatagttt ttttatattg tagttgttct attttaatca 2700 aatgttagcg tgatttatat tttttttcgc ctcgacatca tctgcccaga tgcgaagtta 2760 agtgcgcaga aagtaatatc atgcgtcaat cgtatgtgaa tgctggtcgc tatactgctg 2820 tcgattcgat actaacgccg ccatccagtt taaacgagct cgaattcatc gatgatatca 2880 gatccactag tggcctatgc ggccgcggat ctgccggtct ccctatagtg agtcgtatta 2940 atttcgataa gccaggttaa cctgcattaa tgaatcggcc aacgcgcggg gagaggcggt 3000 ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg 3060 ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg 3120 gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag 3180 gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga 3240 cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct 3300 ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc 3360 tttctccctt cgggaagcgt ggcgctttct caatgctcac gctgtaggta tctcagttcg 3420 gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc 3480 tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca 3540 ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag 3600 ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct 3660 ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc 3720 accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga 3780 tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca 3840 cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat ccttttaaat 3900 taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc tgacagttac 3960 caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc atccatagtt 4020 gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc tggccccagt 4080 gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc aataaaccag 4140 ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc catccagtct 4200 attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt gcgcaacgtt 4260 gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt ttggtatggc ttcattcagc 4320 tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa aaaagcggtt 4380 agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt atcactcatg 4440 gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg cttttctgtg 4500 actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc gagttgctct 4560 tgcccggcgt caatacggga taataccgcg ccacatagca gaactttaaa agtgctcatc 4620 attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt gagatccagt 4680 tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt caccagcgtt 4740 tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag ggcgacacgg 4800 aaatgttgaa tactcatact cttccttttt caatattatt gaagcattta tcagggttat 4860 tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat aggggttccg 4920 cgcacatttc cccgaaaagt gccacctgac gtctaagaaa ccattattat catgacatta 4980 acctataaaa ataggcgtat cacgaggccc tttcgtctcg cgcgtttcgg tgatgacggt 5040 gaaaacctct gacacatgca gctcccggag acggtcacag cttgtctgta agcggatgcc 5100 gggagcagac aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg gggctggctt 5160 aactatgcgg catcagagca gattgtactg agagtgcacc atatggacat attgtcgtta 5220 gaacgcggct acaattaata cataacctta tgtatcatac acatacgatt taggtgacac 5280 tata 5284 <210> 2 <211> 4767 <212> DNA <213> Artificial Sequence <220> <223> pFA6a-VC-KlURA3 vector <400> 2 gaacgcggcc gccagctgaa gcttcgtacg ctgcaggtcg acggatcccc gggttaatta 60 accgtccggc gtgcaaaatc ccgaacgacc tgaaacagaa agtcatgaac cacgacaagc 120 agaagaacgg catcaagctg aacttcaaga tccgccacaa catcgaggac ggcggcgtgc 180 agctcgccga ccactaccag cagaacaccc ccatcggcga cggccccgtg ctgctgcccg 240 acaaccacta cctgagctac cagtccgccc tgagcaaaga ccccaacgag aagcgcgatc 300 acatggtcct gctggagttc gtgaccgccg ccgggatcac tctcggcatg gacgagctgt 360 acaagtaggg cgcgcctctc tgcttttgtg cgcgtatgtt tatgtatgta cctctctctc 420 tatttctatt tttaaaccac cctctcaata aaataaaaat aataaagtat ttttaaggaa 480 aagacgtgtt taagcactga ctttatctac tttttgtacg ttttcattga tataatgtgt 540 tttgtctctc ccttttctac gaaaatttca aaaattgacc aaaaaaagga atatatatac 600 gaaaaactat tatatttata tatcatagtg ttgataaaaa atgtttatca gatctcggag 660 acaatcatat gggagaagca attggaagat agaaaaaagg tactcggtac ataaatatat 720 gtgattctgg gtagaagatc ggtctgcatt ggatggtggt aacgcatttt tttacacaca 780 ttacttgcct cgagcatcaa atggtggtta ttcgtggatc tatatcacgt gatttgctta 840 agaattgtcg ttcatggtga cacttttagc tttgacatga ttaagctcat ctcaattgat 900 gttatctaaa gtcatttcaa ctatctaaga tgtggttgtg attgggccat tttgtgaaag 960 ccagtacgcc agcgtcaata cactcccgtc aattagttgc accatgtcca caaaatcata 1020 taccagtaga gctgagactc atgcaagtcc ggttgcatcg aaacttttac gtttaatgga 1080 tgaaaagaag accaatttgt gtgcttctct tgacgttcgt tcgactgatg agctattgaa 1140 acttgttgaa acgttgggtc catacatttg ccttttgaaa acacacgttg atatcttgga 1200 tgatttcagt tatgagggta ctgtcgttcc attgaaagca ttggcagaga aatacaagtt 1260 cttgatattt gaggacagaa aattcgccga tatcggtaac acagtcaaat tacaatatac 1320 atcgggcgtt taccgtatcg cagaatggtc tgatatcacc aacgcccacg gggttactgg 1380 tgctggtatt gttgctggct tgaaacaagg tgcgcaagag gtcaccaaag aaccaagggg 1440 attattgatg cttgctgaat tgtcttccaa gggttctcta gcacacggtg aatatactaa 1500 gggtaccgtt gatattgcaa agagtgataa agatttcgtt attgggttca ttgctcagaa 1560 cgatatggga ggaagagaag aagggtttga ttggctaatc atgaccccag gtgtaggttt 1620 agacgacaaa ggcgatgcat tgggtcagca gtacagaacc gtcgacgaag ttgtaagtgg 1680 tggatcagat atcatcattg ttggcagagg acttttcgcc aagggtagag atcctaaggt 1740 tgaaggtgaa agatacagaa atgctggatg ggaagcgtac caaaagagaa tcagcgctcc 1800 ccattaatta tacaggaaac ttaatagaac aaatcacata tttaatctaa tagccacctg 1860 cattggcacg gtgcaacact cacttcaact tcatcttaca aaagatcacg tgatctgttg 1920 tattgaactg aaaatttttt gtttgcttct ctctctctct ttcattatgt gagagtttaa 1980 aaaccagaaa ctacatcatc gaaaaagagt ttaaaccatt acaaccattg cgataagccc 2040 tctcaaactt cctccagaac caatgacgtt ccctcaacca aaggtgtttt gatgtgaaga 2100 gtactgacaa taaaaagatt cttgttttca agaacttgtc atttgtatag tttttttata 2160 ttgtagttgt tctattttaa tcaaatgtta gcgtgattta tatttttttt cgcctcgaca 2220 tcatctgccc agatgcgaag ttaagtgcgc agaaagtaat atcatgcgtc aatcgtatgt 2280 gaatgctggt cgctatactg ctgtcgattc gatactaacg ccgccatcca gtttaaacga 2340 gctcgaattc atcgatgata tcagatccac tagtggccta tgcggccgcg gatctgccgg 2400 tctccctata gtgagtcgta ttaatttcga taagccaggt taacctgcat taatgaatcg 2460 gccaacgcgc ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc tcgctcactg 2520 actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa 2580 tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc 2640 aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc 2700 ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat 2760 aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc 2820 cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcaatgct 2880 cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg 2940 aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc 3000 cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga 3060 ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa 3120 ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta 3180 gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc 3240 agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg 3300 acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga 3360 tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatatg 3420 agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct 3480 gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg 3540 agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc 3600 cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa 3660 ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc 3720 cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt 3780 cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc 3840 ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt 3900 tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc 3960 catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt 4020 gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata 4080 gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa ctctcaagga 4140 tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac tgatcttcag 4200 catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa 4260 aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt 4320 attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa tgtatttaga 4380 aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgtctaag 4440 aaaccattat tatcatgaca ttaacctata aaaataggcg tatcacgagg ccctttcgtc 4500 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 4560 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 4620 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 4680 accatatgga catattgtcg ttagaacgcg gctacaatta atacataacc ttatgtatca 4740 tacacatacg atttaggtga cactata 4767 <210> 3 <211> 255 <212> DNA <213> Artificial Sequence <220> <223> Nuceotide Sequence Encoding C-terminal fragment of yellow          포프 피 protein <400> 3 gacaagcaga agaacggcat caaggccaac ttcaagatcc gccacaacat cgaggacggc 60 ggcgtgcagc tcgccgacca ctaccagcag aacaccccca tcggcgacgg ccccgtgctg 120 ctgcccgaca accactacct gagctaccag tccgccctga gcaaagaccc caacgagaag 180 cgcgatcaca tggtcctgct ggagttcgtg accgccgccg ggatcactct cggcatggac 240 gagctgtaca agtag 255 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F2CORE primer <400> 4 ggtcgacgga tccccgggtt 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> R1CORE primer <400> 5 tcgatgaatt cgagctcgtt 20 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pCgLEU2-600 primer <400> 6 gtcaggatcc aaggcttcaa gtcatatagc 30 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pCgLEU2 + 1320R primer <400> 7 cgtcattggt agtcattatg cggatttacg 30 <210> 8 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> T (TEF) -F3-L primer <400> 8 cgtaaatccg cataatgact accaatgacg ttccctac 38 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> T (TEF) -R primer <400> 9 catcgatgaa ttcgagctcg 20 <210> 10 <211> 516 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide Sequence encoding N-terminal Fragment of Yellow          Fluorescent Protein <400> 10 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60 ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120 ggcaagctga ccctgaagct gatctgcacc accggcaagc tgcccgtgcc ctggcccacc 180 ctcgtgacca ccctgggcta cggcctgcag tgcttcgccc gctaccccga ccacatgaag 240 cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300 ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360 gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420 aagctggagt acaactacaa cagccacaac gtctatatca ccgccgacaa gcagaagaac 480 ggcatcaagg ccaacttcaa gatccgccac aacatc 516 <210> 11 <211> 84 <212> PRT <213> Artificial Sequence <220> <223> Amino Acid Sequence of C-terminal Fragment of Yellow          Fluorescent Protein <400> 11 Asp Lys Gln Lys Asn Gly Ile Lys Ala Asn Phe Lys Ile Arg His His   1 5 10 15 Ile Glu Asp Gly Gly Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr              20 25 30 Pro Ile Gly Asp Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser          35 40 45 Tyr Gln Ser Lys Leu Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met      50 55 60 Val Leu Leu Glu Phe Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp  65 70 75 80 Glu Leu Tyr Lys                 <210> 12 <211> 172 <212> PRT <213> Artificial Sequence <220> <223> Amino Acid Sequence of N-terminal Fragment of Yellow          Fluorescent Protein <400> 12 Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu   1 5 10 15 Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly              20 25 30 Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Leu Ile          35 40 45 Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr      50 55 60 Leu Gly Tyr Gly Leu Gln Cys Phe Ala Arg Tyr Pro Asp His Met Lys  65 70 75 80 Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu                  85 90 95 Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu             100 105 110 Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly         115 120 125 Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr     130 135 140 Asn Tyr Asn Ser His Asn Val Tyr Ile Thr Ala Asp Lys Gln Lys Asn 145 150 155 160 Gly Ile Lys Ala Asn Phe Lys Ile Arg His Asn Ile                 165 170

Claims (14)

Which comprises a strain library operably linked to the C-terminal fragment gene of the yellow fluorescent protein at the 3'-end of the gene encoding the protein on the genomic DNA of Saccharomyces cerevisiae , The present invention relates to a composition for confirming whether or not a protein of the present invention is formed in a cell by Saccharomyces cerevisiae,
Wherein the gene encoding the protein of Saccharomyces cerevisiae is at least one selected from the 186 genes listed in Table 2. &lt; Desc / Clms Page number 24 &gt; The gene coding for the protein on the genomic DNA of Saccharomyces cerevisiae according to claim 1, wherein at least one gene selected from the genes other than the 186 genes listed in Table 2 is added to the genes encoding 5,671 genes listed in Table 1 Wherein the protein of Saccharomyces cerevisiae is used to confirm whether or not a homocomplex is formed in a cell in Saccharomyces cerevisiae. The recombinant Saccharomyces cerevisiae strain according to claim 1 or 2, wherein the N-terminal fragment gene of the yellow fluorescent protein is operably linked to the 3'-end of the gene encoding the protein on the genomic DNA of Saccharomyces cerevisiae A composition for confirming whether or not a protein of Saccharomyces cerevisiae contains a strain of Saccharomyces cerevisiae in a cell, which further comprises a strain in a bacterium. delete [Claim 2] The method according to claim 1, wherein the homocysteine complex is a homocysteine complex of at least one protein selected from the proteins encoded by the genes listed in Table 2, wherein the protein of Saccharomyces cerevisiae is a homologous compound of Saccharomyces cerevisiae A composition for identifying whether a complex is formed. delete delete delete The protein of Saccharomyces cerevisiae is operably linked to the C-terminal fragment gene of the yellow fluorescent protein at the 3'-end of the gene encoding the protein on the genomic DNA of Saccharomyces cerevisiae . As a library of strains in Saccharomyces cerevisiae to confirm whether a homologous complex is formed in a cell in a Roman Isis cerevisiae,
The library encoding 186 genes described in Table 2 is a gene encoding the protein. 10. The method according to claim 9, wherein the gene coding for the protein on the genomic DNA of Saccharomyces cerevisiae further comprises one or more genes selected from the genes other than the 186 genes listed in Table 2 from the 5,671 genes listed in Table 1 A library of strains of Saccharomyces cerevisiae in order to confirm whether or not the protein of Saccharomyces islet Cerebisius is homo-complex formed in Saccharomyces cerevisiae in a cell. 10. The method of claim 9, wherein the homocomplex is a homologous complex of at least one protein selected from the proteins encoded by the genes set forth in Table 2, wherein the protein of Saccharomyces cerevisiae is a homologous complex in the cell of Saccharomyces cerevisiae A library of strains in Saccharomyces cerevisiae for confirmation of complex formation. (a) preparing a composition for confirming whether a protein of Saccharomyces cerevisiae of claim 1 or 2 is formed in a cell with a homocomplex in a Saccharomyces cerevisiae ;
(b) preparing a strain in recombinant Saccharomyces cerevisiae operatively linked with the N-terminal fragment gene of the yellow fluorescent protein at the 3'-end of the gene encoding the protein on the genomic DNA of Saccharomyces cerevisiae step;
(c) crossing the strain to Saccharomyces cerevisiae prepared in step (a) and the strain to Saccharomyces cerevisiae prepared in step (b) to produce diploid cells;
(d) selecting the resulting diploid cells; And
(e) detecting a yellow fluorescence signal in the diploid cell
Wherein the protein of Saccharomyces cerevisiae is formed in a cell by the same method. delete 13. The method of claim 12, wherein the homocysteine complex is a homocysteine complex of at least one protein selected from the proteins encoded by the genes listed in Table 2, wherein the protein of Saccharomyces cerevisiae is a homocysteine complex How to confirm the formation.

Images