CN111394320B

CN111394320B - Recombinant vaccinia virus expressing human tissue factor fusion protein and application thereof

Info

Publication number: CN111394320B
Application number: CN202010227429.XA
Authority: CN
Inventors: 阎辉; 刘美丽; 罗砚曦
Original assignee: Hangzhou Medical College
Current assignee: Hangzhou Medical College
Priority date: 2020-03-27
Filing date: 2020-03-27
Publication date: 2022-02-11
Anticipated expiration: 2040-03-27
Also published as: CN111394320A

Abstract

The invention discloses a recombinant vaccinia virus for expressing human tissue factor fusion protein, a related vaccinia vector expression plasmid and application thereof. The TK gene region of the recombinant vaccinia virus comprises a human tissue factor fusion protein gene, an artificially synthesized early/late vaccinia virus promoter drives the tissue factor fusion protein to express, and the fusion protein comprises a secretion signal peptide, a histidine tag, a connecting peptide, a truncated human tissue factor and a vascular targeting peptide (snake venom saw-scale viper) which are sequentially connected. The recombinant vaccinia virus can secrete and express tissue factor fusion protein capable of being combined with human umbilical vein endothelial cells (simulating tumor vascular endothelial cells) in a targeted manner after infecting target cells, so that blood coagulation in blood vessels is caused to form thrombus, and the blood supply of the tumor blood vessels is cut off by embolization to inhibit the growth of tumor cells.

Description

Recombinant vaccinia virus expressing human tissue factor fusion protein and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a recombinant vaccinia virus for expressing human tissue factor fusion protein, a related vaccinia vector expression plasmid and application thereof.

Background

Currently, malignant tumors remain serious diseases that greatly endanger human life health. With the progress of basic research in molecular biology, immunology, tumor biology and the like, the tumor biological treatment heteromilitary process becomes a 'fourth mode' of tumor treatment following traditional methods such as surgical operation, chemical drug therapy (chemotherapy), radiotherapy and the like, and increasingly draws attention, progresses rapidly and is expected to break through. Some protocols have approved clinical use, and have been shown to be effective in certain types of tumors (e.g., melanoma and renal cell carcinoma).

Tumor vascular targeted therapy is a particularly attractive approach in tumor biotherapeutic strategies. The occurrence and development of malignant tumors involve the abnormality of extremely complex cell signaling pathways and metabolic pathways, and the ideal curative effect cannot be achieved by aiming at any single-link therapeutic intervention, because tumor cells have evolved various adaptation and compensation functions which are often enough to counteract the single-link therapeutic intervention, so that drug resistance or radiotherapy tolerance is generated, and finally the treatment is failed. However, any type of tumor has a common "soft rib" or weak link, that is, tumor cells that grow more metabolically than normal cells need, without exception, sufficient, unobstructed blood vessels to supply abundant blood nutrients and oxygen, while carrying away metabolic waste products. Once the tumor capillaries are destroyed or the blood supply is blocked, which is equal to the "throat" of the tumor, any tumor cells with complex morphological and functional functions can not grow, which is a unique aspect of tumor vascular targeted therapy compared with other therapeutic methods.

In the strategy of tumor vascular targeted therapy, one successful scheme so far is to design and promote blood coagulation in tumor blood vessels to cause thrombosis and embolism in tumor micro blood vessels, thereby achieving the purpose of cutting off blood supply of the tumor blood vessels, and the principle is as follows: tissue Factor (TF) is a starting factor of a physiological blood coagulation system, a prokaryotic system is adopted to express a truncated Tissue factor recombinant fusion protein fused with a tumor targeting element (antibody or polypeptide), the fusion protein can specifically target and combine with tumor vascular endothelial cells, and the Tissue factor activates the blood coagulation system to cause blood coagulation and thrombosis in tumor blood vessels, so that the blood supply of the tumor is blocked, and the growth of the tumor is inhibited.

To date, the scheme of inducing coagulation in tumor blood vessels is a mode of injecting prokaryotic expression tissue factor recombinant fusion protein, however, the mode of tumor blood vessel targeted therapy of the type has a series of limitations. First, in physiological state, the tissue factor is a protein product expressed by eukaryotic cells in the body of mammals, and the prokaryotic expression system (mainly escherichia coli expression system) lacks glycosylation and post-translational modification functions when expressing the protein.

Secondly, regardless of the subcutaneous injection or intravenous injection administration mode, the tissue factor fusion protein follows the general pharmacokinetic rules of protein drug metabolism, excretion, attenuation and the like after entering the circulatory system of the body, the blood drug content can only be gradually reduced but can not be spontaneously regenerated, and particularly, the content of the tissue factor fusion protein entering the systemic circulation after being diluted by body fluid and degraded by protease in blood, transported to a tumor target site is very limited.

Finally, the tumor targeted therapy strategy based on the tissue factor fusion protein can not destroy the existing tumor blood vessels, and theoretically, the tissue factor fusion protein can not form embolism in all tumor micro-blood vessels, so that the practical requirements are provided for improving the existing strategy and achieving the synergistic effect based on different action mechanisms. In view of the above, the invention develops a new method for designing and adopting the recombinant vaccinia virus eukaryotic vector to express the tumor blood vessel targeting tissue factor fusion protein.

Vaccinia virus (vaccinia virus) is one of the largest, most complex viruses discovered to date, a live vaccine virus that prevents smallpox, and has a history of vaccination in large populations with good biosafety records with very low incidence of side effects. After smallpox is eradicated globally, vaccinia virus is used as a genetic engineering eukaryotic expression vector and is widely researched and applied. In particular, vaccinia virus vectors have natural tumor targeting. Studies have shown that almost all viruses will accumulate at the tumor site after intravenous injection of vaccinia virus. Recombinant vaccinia virus tumor targeting can be further enhanced if the foreign gene of interest is inserted into the TK gene region of the vaccinia vector, resulting in insertional inactivation of the TK gene. These properties of vaccinia virus make it an excellent vector for biological treatment of tumors.

On the other hand, it has been proved that the polypeptide snake venom echeverin (Ech) derived from the venom of echeverin has the ability of binding tumor vascular endothelial cell surface receptor integrin with high affinity, so in the invention, the Ech polypeptide is fused into human tissue factor fusion protein, and is used for targeting the human tissue factor fusion protein secreted by vaccinia vector expression to tumor blood vessels, triggering the blood coagulation in the tumor blood vessels to block the blood flow in the tumor blood vessels, cutting off the blood flow supply of the tumor, and generating antitumor therapeutic efficacy.

Disclosure of Invention

The invention aims to design a recombinant vaccinia virus expressing human tissue factor fusion protein (tTF-Ech) and application thereof, belonging to a eukaryotic expression system, aiming at the defects of the prior art.

The purpose of the invention is realized by the following technical scheme: the human tissue factor fusion protein gene (target gene) is inserted into the TK gene region of vaccinia virus, and is expressed by artificially synthesized early/late promoter (P-se/l) of vaccinia virus.

Further, the human tissue factor fusion protein expressed by the recombinant vaccinia virus sequentially comprises the following elements: the peptide sequence of the secretory signal peptide, the tandem histidine tag (6 XHis-tag), the ND2 connecting peptide (ND2-Linker), the truncated human tissue factor (tTF1-218) and the vascular targeting peptide (Ech) derived from snake venom echst viper are sequentially shown as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4 and SEQ ID No. 5.

Furthermore, the amino acid sequence of the human tissue factor fusion protein is shown as SEQ ID No. 6.

Further, the parent virus of the recombinant vaccinia virus expressing human tissue factor fusion protein is the vaccinia virus WR strain.

Further, the nucleic acid sequence of the artificially synthesized vaccinia virus early/late promoter is shown as SEQ ID No. 7.

Further, a selectable first marker gene expression cassette in tandem with the human tissue factor fusion protein gene expression cassette is included, wherein the selectable marker gene is a gpt gene, and the gpt gene is expressed by the vaccinia virus P7.5 early/late promoter. The nucleic acid sequence of the P7.5 promoter is shown as SEQ ID No.8, and the nucleic acid sequence of the gpt gene is shown as SEQ ID No. 9.

Further, the kit also comprises a selectable second marker gene expression cassette connected with the human tissue factor fusion protein gene expression cassette in series, wherein in the selectable second marker gene expression cassette, the selectable marker gene is mCherry red fluorescent protein and Zeocin resistance protein fusion gene mCherry-Zeocin, and has double phenotypes of red fluorescence and Zeocin drug resistance. The selectable marker gene is expressed from the vaccinia virus mH5 promoter. The mH5 promoter nucleic acid sequence is shown in SEQ ID No.10, and the mCherry-Zeocin fusion gene nucleic acid sequence is shown in SEQ ID No. 11.

Further, the amino acid sequence of the selectable first marker gene expression cassette is shown as SEQ ID No.12, and the amino acid sequence of the selectable second marker gene expression cassette is shown as SEQ ID No. 13.

Furthermore, the recombinant vaccinia virus construction process is constructed by infecting the wild type vaccinia virus WR strain after transfecting cells with the recombinant vaccinia vector expression plasmid pCZ-tTFEch and performing an intracellular homologous recombination mechanism. The whole nucleic acid sequence of the pCZ-tTFEch plasmid is shown in SEQ ID No. 14.

The invention also provides application of any recombinant vaccinia virus and related elements in preparation of antitumor drugs.

The invention has the beneficial effects that: the recombinant vaccinia virus vector expresses human tissue factor fusion protein, firstly constructs recombinant vaccinia virus vector expression plasmid pCZ-tTFEch, transfects Vero cells by the plasmid, then infects the cells by wild type vaccinia virus WR strain, and generates recombinant vaccinia virus by an intracellular homologous recombination mechanism. Then, the recombinant vaccinia virus can be conveniently screened out by expressing the selectable marker gene gpt connected with the target gene expression cassette in series and matching drug selective pressure of mycophenolic acid, xanthine and hypoxanthine with the red fluorescence phenotype and Zeocin drug resistance. Experiments prove that the recombinant vaccinia virus can secrete and express the human tissue factor fusion protein at the infected cell part without the time-consuming, labor-consuming and complex prokaryotic expression and protein purification processes as in the prior art, and the expression product has expected bioactivity, namely the fusion protein can be combined with human umbilical vein endothelial cells (the cells have high-level expression integrin receptors like tumor vascular endothelial cells and can be used as mimics of the tumor vascular endothelial cells) and trigger coagulation reaction.

Drawings

FIG. 1 is a splicing diagram of human tissue factor fusion protein genes. In the figure, P-se/l is the synthetic vaccinia virus early/late promoter; the secre-Sig is a secretion signal peptide; 6 × His-tag is a histidine tag connected in series; nd2-Linker is ND2 connecting peptide; tTF is truncated human tissue factor; mH5 is a modified vaccinia virus H5 promoter; the mCherry/Zeocin is a fusion gene of mCherry red fluorescent protein and Zeocin resistance protein;

FIG. 2 recombinant vaccinia vector expression plasmid pCZ-tTFEch map. The figure illustrates the same as figure 1.

FIG. 3 is a histogram of the ELISA assay results for recombinant vaccinia virus expressing the tTF-Ech fusion protein. Wherein, 1: cell culture supernatant; 2, cell lysate; 3, total protein; 4, the wild type WR strain infects Vero cells.

FIG. 4 is a Western blot detection result chart of recombinant vaccinia virus expression tTF-Ech fusion protein. And (3) carrying out Western blot detection by using a rabbit anti-human tissue factor antibody to verify the expression of the target protein. Wherein, M: a protein molecular weight marker; 1: a cell lysate; 2: a mixture of cell lysate and cell culture supernatant; 3: cell culture supernatant.

FIG. 5 is a diagram showing the results of the binding assay-ELISA assay of recombinant vaccinia virus expressing tTF-Ech fusion protein with umbilical vein endothelial cells (HUVEC). In the figure, 1: tTF-Ech + HUVEC; 2, the tTF-Ech + HUVEC is not added with primary antibody; 3, tTF-Ech + Vero; 4, tTF-Ech + Vero was not added with primary antibody.

Detailed Description

The recombinant vaccinia virus expressing human tissue factor fusion protein is named vv-tTF-Ech, and has the constitution that a WR strain of the vaccinia virus is taken as a parent, a human tissue factor fusion protein gene, namely tTF-Ech fusion gene, is inserted into a TK gene region of the virus, an artificially synthesized vaccinia virus early/late promoter driving the expression of an exogenous gene, namely a P-se/l promoter, is arranged at the upstream of the gene, and as the optimization, a selectable first marker gene which is connected with a target gene expression box in series and is used for screening the recombinant vaccinia virus is connected with the target gene expression box in series, namely: the gpt gene is used for pressure screening of recombinant viruses by mycophenolic acid, xanthine and hypoxanthine drugs, and is matched with a selectable second marker gene, namely: the mCherry-Zeocin fusion gene is used for screening recombinant vaccinia virus by the aid of a red fluorescence phenotype and a Zeocin drug resistance phenotype.

The expression plasmid of the recombinant vaccinia virus vector is pCZ-tTFEch, and the structural map of the expression plasmid is shown in figures 1 and 2.

The invention adopts a classical homologous recombination method to construct recombinant vaccinia virus. Firstly, constructing a human tissue factor fusion gene, cloning into a vaccinia expression vector plasmid pCB to generate a recombinant vaccinia vector expression plasmid pCZ-tTFEch, transfecting Vero cells by the plasmid pCZ-tTFEch, then infecting the transfected cells by a wild vaccinia virus WR strain, and screening the recombinant vaccinia virus by expressing a marker gene gpt, screening mycophenolic acid, xanthine and hypoxanthine medicaments and screening the red fluorescence phenotype of the marker gene mCherry.

Example 1: construction of human tissue factor fusion protein gene splicing and recombinant vaccinia expression plasmid pCZ-tTFEch

(1) PCR primer

Primer name and sequence

H5-up(SEQ ID No.15)TGTGGAGtctagaaaaaattgaaaataaatacaaag

D8-dn(SEQ ID No.16)gctacctgaatttaaattcagttttgtttttctcgcgaatatcg

Ech(SEQ ID No.17)acaaaactgaatttaaattcaggtagctggacccttgtgtgggtttctcgggcag

Sec(SEQ ID No.18)AGTCGACagatctgccaccatgtggtggcgcctgtggtggctgctgctgctgctgctg

Truncated human tissue factor (tTF1-218, shown in SEQ ID No.4 in sequence) is constructed into pCB plasmid to obtain pCBlac-tTf-NGR plasmid, and the pCBlac-tTf-NGR plasmid is used as a template to amplify tTF-Ech + BglII fragment (SEQ ID No.19) by using primers Ech and Sec. Both were amplified by a PCR reaction catalyzed by Q5 enzyme, except that the template and primers were different.

(2) The general PCR reaction system is as follows:

composition (I)	Amount of addition
		Double distilled water	Make up to 50. mu.L
5 XQ 5 reaction buffer	10μL
		10mM dNTPs	1μL
5×Q5 High GC Enhancer	10μL
		Primer 1 (10. mu.M)	2.5μL
Primer 2 (10. mu.M)	2.5μL
		Template plasmid	1μL
Q5 high fidelity DNA polymerase	0.5μL

The reaction process is as follows:

firstly, pre-denaturing at 98 ℃ for 30S,

② denaturation at 98 ℃ for 10S,

annealing at 55 ℃ for 30S,

extension for 50S at 72 ℃,

fifthly, the step II is carried out,

repeat 30 cycles, 72 ℃ extension for 2 min. 2 μ L of the PCR product was run through a 1% agarose gel for electrophoresis and the results were recorded by observation with a gel image analyzer.

(3) Fusion of two fragments of interest

The two target fragments obtained in the above steps were purified using a PCR column gel recovery kit.

The gel cutting and purifying process comprises the following steps:

the remaining PCR products were run through a 1% agarose gel electrophoresis and the band of interest was excised under UV light.

Firstly, transferring the gel block with the target fragment to a 1.5mL centrifuge tube (the centrifuge tube is weighed), weighing to obtain the weight of the gel block, adding Buffer B2 which is 3-6 times of the weight of the gel block, and carrying out warm bath on the gel block at 50 ℃ until the gel is completely melted to obtain a sol solution.

② transferring the sol solution into a column, centrifuging at 8000 Xg for 30s, discarding the filtrate in the collection tube, and sleeving the column back into a 2mL collection tube.

③ adding 500 μ L of Wash Solution (diluted with absolute ethanol) to the column, centrifuging at 9000 Xg for 30min, pouring off the liquid in the collecting tube, and placing the adsorption column in the same collecting tube.

And fourthly, repeating the step 3 once.

Fifthly, abandoning the filtrate in the collecting pipe, sleeving the column back in the 2mL collecting pipe, and centrifuging for 1min at 9000 Xg to spin-dry the residual liquid of the column matrix.

Sixthly, the column is arranged on a clean 1.5mL centrifuge tube, the metal bath is opened, the metal bath is placed for 2min to volatilize residual alcohol, 15-40 mu L of precipitation Buffer preheated to 60 ℃ is added in the center of the adsorption film, the mixture is placed for 1min, 9000 Xg is centrifuged for 1min, and DNA is eluted.

The process of overlap PCR and splicing of human tissue factor fusion protein genes is shown in FIG. 1.

The first PCR reaction system is as follows:

composition (I)	Amount of addition
		Double distilled water	Make up to 25. mu.L
5 XQ 5 reaction buffer	5μL
		10mM dNTPs	0.5μL
5×Q5 High GC Enhancer	5μL
		mCherry/Zeocin fragment (SEQ ID NO.11)	1μL
tTF-Ech + BglII fragment	1μL
		Q5 high fidelity DNA polymerase	0.25μL

The reaction process is as follows:

firstly, pre-denaturing at 98 ℃ for 30S,

② denaturation at 98 ℃ for 10S,

annealing at 55 ℃ for 30S,

extension for 1min at 72 ℃ for 15s,

fifthly, the step II is carried out,

repeat 10 cycles, 72 ℃ extension for 2 min. Collecting PCR products, wherein the second step of PCR reaction system is as follows:

composition (I)	Amount of addition
		Double distilled water	Make up to 50. mu.L
5 XQ 5 reaction buffer	5μL
		10mM dNTPs	0.5μL
5×Q5 High GC Enhancer	5μL
		H5-up(10μM)	2.5μL
Sec(10μM)	2.5μL
		Template plasmid (PCR product described above)	25μL
Q5 high fidelity DNA polymerase	0.25μL

The reaction process is as follows:

firstly, pre-denaturing at 98 ℃ for 30S,

② denaturation at 98 ℃ for 10S,

annealing at 55 ℃ for 30S,

extension for 1min at 72 ℃ for 15s,

fifthly, the step II is carried out,

PCR product gel cutting recovery

Running 1% agarose gel electrophoresis on the residual PCR product, cutting gel under a long-wave ultraviolet lamp (300-360nm), and recovering according to the specification of the raw cutting gel recovery kit, wherein the steps are as follows:

firstly, transferring the gel block with the target fragment to a 1.5mL centrifuge tube (the centrifuge tube is weighed), weighing to obtain the weight of the gel block, adding Buffer B2 of which the weight is 3-6 times of that of the gel block, and carrying out warm bath on the gel block at 50 ℃ until the gel is completely melted.

② transferring the sol solution to a column, 8000 Xg centrifuging for 30s. Discard the filtrate from the collection tube and return the column to the 2mL collection tube.

③ 500 μ L of Wash Solution (diluted with absolute ethanol) is added to the column, and the column is centrifuged at 9000 Xg for 30min, the liquid in the collection tube is decanted, and the adsorption column is placed in the same collection tube.

And fourthly, repeating the step 3 once.

Sixthly, the column is arranged on a clean 1.5mL centrifuge tube, the metal bath is opened, the metal bath is placed for 2min to volatilize residual alcohol, 15-40 mu L of precipitation Buffer preheated to 60 ℃ is added into the center of the adsorption film, the mixture is placed for 1min, 9000 Xg is centrifuged for 1min, and DNA is eluted, so that a fusion fragment mCherry/Zeocin-tTFEch is obtained.

(4) Ligation of vector plasmid and fusion Gene fragment

The fusion fragment mCherry/Zeocin-tTFEch and the plasmid pCB are cut by restriction enzymes BglII and XbaI.

The product of the enzyme digestion fusion fragment mCherry/Zeocin-tTFEch reacts as follows:

composition (I)	Amount of addition
		Double distilled water	Make up to 20. mu.L
10 × buffer:	2μL
		BglII enzyme	1μL
XbaI enzyme	1μL
		Fusion fragment mCherry/Zeocin-tTFEch	4μL

The restriction enzyme reaction system of the plasmid vector pCB:

the components are mixed evenly, centrifuged at low speed and cut by enzyme at 37 ℃ for 3 h.

The fusion fragment was ligated to the plasmid vector by T4 ligase in the following reaction:

reacting at 16 ℃ for 3 h.

(5) Transformation reaction of fusion fragment mCherry-Zeo-tTFEch connected with plasmid vector pCB

The competent cell E coli DH5 alpha is taken out from a refrigerator at-80 ℃ and placed in ice for thawing.

② taking 10 microliter of the ligation product from the super clean bench, adding the ligation product into 100 microliter of competent cells, and carrying out ice bath for 30 min.

③ heat shock for 90s at 42 ℃, and then ice bath for 2-3 min.

Adding 900 mu L of LB culture medium preheated to 37 ℃, placing the mixture on a 37 ℃ shaking table at 200rpm for 1 h.

Fifthly, taking the converted substance out of the shaking table, centrifuging for 5min at 3000rpm, discarding 900 mul of culture solution, resuspending the thallus with the remaining 100 mul of culture solution, coating the thallus on an LB Agar plate which is preheated to contain ampicillin 100 mul/mL and bleomycin 50 mul/mL, and drying.

Sixthly, the LB plate is placed in a thermostat at 37 ℃ for one night in an inverted mode, and the result is observed in the next morning.

The recombinant plasmid pCZ-tTFEch was confirmed to be correct in sequence by colony PCR and DNA sequencing. The map of the pCZ-tTFEch plasmid is shown in FIG. 2, wherein the human tissue factor fusion protein sequentially comprises the following elements: secretory signal peptide, serial histidine tag (6 × His-tag), ND2 connecting peptide (ND2-Linker), truncated human tissue factor (tTF1-218), and snake venom echeverin blood vessel targeting peptide (Ech).

Example 2: construction and screening of recombinant vaccinia virus vv-tTFEch for expressing human tissue factor fusion protein

(1) Packaging of recombinant vaccinia virus

Vero cells were seeded in 6-well plates to grow to the extent of 80% on the next day. Diluting 4 μ g pCZ-tTFEch plasmid in 250 μ L serum-free DMEM medium to obtain solution A, diluting 10 μ L liposome (Biomiga product) in 250 μ L serum-free DMEM medium to obtain solution B, mixing solution A and solution B, incubating at room temperature for 20min, adding 300 μ L serum-free DMEM, mixing, adding Hanks solution, and washing2 times at 37 deg.C and 5% CO₂After 4h of incubation in the incubator, the titer of each well was 2X 10⁶pfu/ml wild-type vaccinia virus WR strain (from ATCC) 10. mu.L, 37 ℃ C., 5% CO₂After further incubation in the incubator for 2h, 2mL of DMEM medium containing 2% FCS was added to each well at 37 ℃ with 5% CO₂Continuously culturing in incubator, collecting vaccinia virus infected cells after 48 hr, repeatedly freezing and thawing at-80 deg.C and 37 deg.C for 3 times, and storing at-80 deg.C for use.

(2) Recombinant vaccinia virus blind screen

Inoculating Vero cells into 6-well plate, removing culture medium when 80% -90% of cells grow into pieces the next day, washing twice with Hanks solution, adding 1mL virus solution generated in the above steps, 37 deg.C, and 5% CO₂After 2h of incubation in the incubator, the supernatant was discarded, washed twice with HanKs solution, and 2mL of DMEM medium containing 1 Xgpt selection medium (initial concentration: 400 Xhypoxanthine 10mg/mL, 40 Xxanthine 10mg/mL, 670 Xmycophenolic acid 10mg/mL) and 2% FCS containing 200. mu.g/mL Zeocin was added. And (4) observing the red fluorescence expression condition of the Vero cells under a fluorescence inverted microscope, and collecting virus liquid after the cells are completely diseased. Repeating the steps once.

(3) Recombinant vaccinia virus plaque purification

Inoculating Vero cells into 6-well plate, removing culture medium when 80-90% of cells grow into pieces the next day, washing twice with Hanks solution, adding virus solution 200 μ l diluted by 10 times, 37 deg.C, and 5% CO₂Incubate for 2h in an incubator with shaking of the 6-well plates every 15min to avoid drying of the cells, discard the supernatant, wash twice with HanKs solution, add 2mL DMEM medium containing 1 xgpt selection and 200 μ g/mL Zeocin and 2% FCS. Observing the red fluorescence expression condition of the Vero cells under a fluorescence inverted microscope, fixing the Vero cells by using noble agar after typical plaques are formed, and presetting a water bath at 45 ℃ for later use. Melting 2% noble agar in microwave oven, mixing with equal volume of 2 × DMEM culture solution containing 4% FCS, and placing in 45 deg.C water bath. Carefully adding 2mL of the prepared noble agar/DMEM mixture into each well, solidifying at room temperature or 4 deg.C, picking single plaque expressing red fluorescence in 500 μ L of 2% FCS DMEM medium, and freeze thawing at-80 deg.C and 37 deg.C for 3 times. Thereafter, each plaque was infected in one well, and the remaining steps were as above, until a more purified recombinant virus was obtained, designated vv-tTFEch.

Example 3: identification of recombinant vaccinia virus expression target protein

(1) ELISA detection of recombinant vaccinia virus expression target protein tTF-Ech

The procedures according to the specifications of the ELISA detection kit manufactured by doctor Decompany are as follows:

1) each 100. mu.l of 1000pg/ml, 500pg/ml, 250pg/ml, 125pg/ml, 62.5pg/ml, 31.3pg/ml and 15.6pg/ml of the standard was added to a row of 7 wells in sequence, and 1 well was added with only the sample diluent as a zero well to prepare duplicate wells. Adding 100 mu L of the stock solution of the sample to be detected, and making a compound hole. Wherein the sample to be tested is obtained by the following method: inoculating Vero cells into a 6-well plate, discarding the culture medium when the next day cells grow to 80% -90%, washing twice with Hanks solution, and adding Vero cells into each well with titer of 2.65 × 10⁷10 mul pfu/mL recombinant virus solution, and after 48h, respectively collecting cell culture supernatant, cell lysate and total protein as samples to be detected. In addition, Vero cells were infected with wild-type WR strain as a control group.

2) The microplate was coated with a cover film and reacted at 37 ℃ for 90 minutes.

3) After the reaction, the liquid in the ELISA plate is absorbed by an automatic plate washing machine; or throwing off the liquid in the enzyme label plate and then beating the enzyme label plate to the absorbent paper for several times.

4) The prepared biotin-labeled anti-human tissue factor antibody working solution was added to each well in 100. mu.l in sequence (except for TMB blank developing wells). The microplate was coated with a cover film and reacted at 37 ℃ for 60 minutes.

5) Wash 3 times with 1 XWash buffer, each soak for about 1 minute (at least 300. mu.l of wash per well).

6) The prepared ABC working solution was added in 100. mu.l per well (except for TMB blank color wells). The microplate was coated with a cover film and reacted at 37 ℃ for 30 minutes.

7) Wash 5 times with 1 XWash buffer, each soak for about 1-2 minutes (at least 300. mu.l of wash per well).

8) The TMB color developing solution which is balanced at 37 ℃ for 30 minutes is added in turn according to 90 mul per hole, and the light-shielding reaction is carried out at 37 ℃ for 25 to 30 minutes.

9) TMB stop solution was added in an amount of 100. mu.l per well, and the blue color immediately turned yellow.

10) OD was measured at 450nm with a microplate reader.

Experiments prove that the tTF-Ech fusion protein can be expressed at a high level after the recombinant vaccinia virus infects cells, and the expression amount secreted to the outside of the cells is more than half of the expression amount retained in the cells (figure 3).

(2) Western blot detection of recombinant vaccinia virus expression target protein tTF-Ech

Inoculating Vero cells into a 6-well plate, discarding the culture medium when the next day cells grow to 80% -90%, washing twice with Hanks solution, and adding Vero cells into each well with titer of 2.65 × 10⁷10 mu l of pfu/m recombinant virus solution, and respectively collecting cell culture supernatant, cell lysate and a mixture of the cell culture supernatant and the cell lysate as samples to be detected after 48 hours.

The Western blot detection experiment is operated according to standard experimental guidelines, a sample to be detected is loaded with SDS-PAGE gel, after conventional electrophoresis and membrane transfer, 5% skimmed milk is sealed at 4 ℃ overnight, and rabbit anti-human tissue factor antibody and 5% skimmed milk are diluted by 1:100 and incubated for 6h at 4 ℃ in a shaking table. Washing with TBST for 3 times, shaking at normal temperature for 10min, diluting with goat anti-rabbit HRP enzyme-labeled secondary antibody and TBST 1:10000, and incubating for 1h in shaking at normal temperature. Washing with TBST for 3 times, shaking at room temperature for 10min each time. Finally, 500. mu.l each of the solutions was added to the cartridge using A, B, and after mixing, the membrane was placed on the cartridge and was then reacted for 5 minutes with exclusion of light. Imagelab development, results are shown in figure 4.

Example 4: detection of biological activity of recombinant vaccinia virus expression target protein

(1) tTF-Ech fusion protein and human umbilical vein endothelial cell binding assay

Inoculating Vero cells into a 6-well plate, discarding the culture medium when the next day cells grow to 80% -90%, washing twice with Hanks solution, and adding Vero cells into each well with titer of 2.65 × 10⁷10 mu l of pfu/ml recombinant virus solution, collecting cell culture supernatant after 48h, determining the protein concentration by using a TaKaRa BCA protein quantitative detection kit, and diluting the protein by 0, 2, 4, 8, 16, 32, 64 and 128 times to obtain a sample to be detected.

The 96-well plate was seeded with integrin-highly expressed Human Umbilical Vein Endothelial Cells (HUVEC) as a mimic of tumor vascular endothelial cells, growing to the extent of 80-90% on the next day. Fixing 4% formalin at room temperature for 30min, eliminating endogenous peroxidase with 3% hydrogen peroxide, washing with 0.05% PBST 3 times after each reaction, each time for 2min, adding 100 μ L/well of sample to be tested at different dilutions, incubating with human umbilical vein endothelial cells and Vero cells, and setting 3 duplicate wells at each dilution. The reaction solution is sealed at room temperature for 2h at 4 ℃, the reaction solution is sealed at room temperature for 2h in 5% FCS, the anti-human tissue factor primary antibody is diluted at 1:100 and incubated at 37 ℃ for 2h, the HRP-labeled secondary antibody is diluted at 1:2500 and incubated at 37 ℃ for 1h, the reaction solution is washed 3 times in 0.05% PBST after each step and 2min each time, the secondary antibody is washed 5 times in 0.05% PBST after incubation, the EL-ABTS color development kit is developed every time for 3min, and the light absorption value is measured at 405 nm. Vero cells and Vero cells without primary antibody, HUVEC cells without primary antibody were used as negative controls (3 duplicate wells).

Experiments prove that the expression product secreted into the cell supernatant of the recombinant vaccinia virus infected cell supernatant can still be obviously combined with the HUVEC cells even after the cell supernatant is diluted 64 times, and the combination reaction is not seen in the negative control Vero cells or the HUVEC cells without the primary antibody (figure 5)

(2) Blood coagulation function detection of tTF-Ech fusion protein

Collecting samples: the blood was collected intravenously, and the supernatant (plasma) was collected by placing the blood into a blood collection tube containing 1/10 volumes of 0.109mol/L sodium citrate anticoagulant (1 part anticoagulant +9 parts whole blood), shaking the mixture gently upside down, and centrifuging the mixture at 3000rpm (or 2500g) for 15 minutes.

50 μ L of plasma was added to each EP tube, and a test sample containing fusion protein tTF-Ech (0, 1.12, 2.24, 4.48, 8.96 μmol/L) and calcium chloride (CaCl) at a final concentration of 25mmol/L or 0 were added to each EP tube in a series of concentrations₂) The solution is then processed as required by the coagulometer.

1) Putting a magnetic bead in the test cup, and sucking a 50uL sample into the test cup by using a liquid moving machine;

2) pre-heating the sample for 3 minutes according to requirements;

3) after the pre-heating is finished, moving the testing cup to a testing channel, adding 100uL of pre-heated PT reagent into the testing cup, and pressing the pressing cap to the bottom during sample adding to enable the instrument to emit a beep sound to start testing;

4) and recording and finishing the result.

5) Statistical analysis was performed using SPSS22.0 statistical software, and statistical methods using analysis of variance were considered statistically different when p < 0.05.

The experimental results are shown in table 1, and the results show that the treatment of the supernatant of the recombinant vaccinia virus infected cells can significantly shorten the blood coagulation time, and the difference is statistically significant compared with the negative control (P < 0.05).

TABLE 1 measurement of the blood coagulation Activity of recombinant vaccinia Virus expressing tTF-Ech fusion protein

Fusion protein tTF-Ech with concentration of 0.112, 0.224, 0.448 and 0.896. mu. mol/L and CaCl with concentration of 25mmol/L₂Mixing, adding 0. mu. mol/L of fusion protein tTF-Ech +25mmol/L of CaCl₂And 0.896 mu mol/L of fusion protein tTF-Ech and 0mmol/L of CaCl₂Groups were used as controls, 6 groups were run, 3 replicates per group, and the clotting time was determined by a coagulometer. a indicates that the difference is statistically significant compared to

groups

1, 2 and 6 (P)<0.05)。

Sequence listing

<110> Hangzhou college of medicine

<120> recombinant vaccinia virus expressing human tissue factor fusion protein and application thereof

<160> 19

<170> SIPOSequenceListing 1.0

<210> 1

<211> 63

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgtggtggc gcctgtggtg gctgctgctg ctgctgctgc tgctgtggcc catggtgtgg 60

gcc 63

<210> 2

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

caccatcatc atcatcat 18

<210> 3

<211> 15

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggatctaaag gacca 15

<210> 4

<211> 654

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcaggcacta caaatactgt ggcagcatat aatttaactt ggaaatcaac taatttcaag 60

acaattttgg agtgggaacc caaacccgtc aatcaagtct acactgttca aataagcact 120

aagtcaggag attggaaaag caaatgcttt tacacaacag acacagagtg tgacctcacc 180

gacgagattg tgaaggatgt gaagcagacg tacttggcac gggtcttctc ctacccggca 240

gggaatgtgg agagcaccgg ttctgctggg gagcctctgt atgagaactc cccagagttc 300

acaccttacc tggagacaaa cctcggacag ccaacaattc agagttttga acaggtggga 360

acaaaagtga atgtgaccgt agaagatgaa cggactttag tcagaaggaa caacactttc 420

ctaagcctcc gggatgtttt tggcaaggac ttaatttata cactttatta ttggaaatct 480

tcaagttcag gaaagaaaac agccaaaaca aacactaatg agtttttgat tgatgtggat 540

aaaggagaaa actactgttt cagtgttcaa gcagtgattc cctcccgaac agttaaccgg 600

aagagtacag acagcccggt agagtgtatg ggccaggaga aaggggaatt caga 654

<210> 5

<211> 147

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gaatgcgaat caggtccatg ctgtcgtaac tgcaagttcc ttaaggaagg taccatctgt 60

aagcgcgcac gtggtgatga tctcgacgac tactgcaacg gtaagacctg tgactgcccg 120

agaaacccac acaagggtcc agctacc 147

<210> 6

<211> 300

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Met Trp Trp Arg Leu Trp Trp Leu Leu Leu Leu Leu Leu Leu Leu Trp

1 5 10 15

Pro Met Val Trp Ala Gly His His His His His His Gly Ser Lys Gly

20 25 30

Pro Ser Gly Thr Thr Asn Thr Val Ala Ala Tyr Asn Leu Thr Trp Lys

35 40 45

Ser Thr Asn Phe Lys Thr Ile Leu Glu Trp Glu Pro Lys Pro Val Asn

50 55 60

Gln Val Tyr Thr Val Gln Ile Ser Thr Lys Ser Gly Asp Trp Lys Ser

65 70 75 80

Lys Cys Phe Tyr Thr Thr Asp Thr Glu Cys Asp Leu Thr Asp Glu Ile

85 90 95

Val Lys Asp Val Lys Gln Thr Tyr Leu Ala Arg Val Phe Ser Tyr Pro

100 105 110

Ala Gly Asn Val Glu Ser Thr Gly Ser Ala Gly Glu Pro Leu Tyr Glu

115 120 125

Asn Ser Pro Glu Phe Thr Pro Tyr Leu Glu Thr Asn Leu Gly Gln Pro

130 135 140

Thr Ile Gln Ser Phe Glu Gln Val Gly Thr Lys Val Asn Val Thr Val

145 150 155 160

Glu Asp Glu Arg Thr Leu Val Arg Arg Asn Asn Thr Phe Leu Ser Leu

165 170 175

Arg Asp Val Phe Gly Lys Asp Leu Ile Tyr Thr Leu Tyr Tyr Trp Lys

180 185 190

Ser Ser Ser Ser Gly Lys Lys Thr Ala Lys Thr Asn Thr Asn Glu Phe

195 200 205

Leu Ile Asp Val Asp Lys Gly Glu Asn Tyr Cys Phe Ser Val Gln Ala

210 215 220

Val Ile Pro Ser Arg Thr Val Asn Arg Lys Ser Thr Asp Ser Pro Val

225 230 235 240

Glu Cys Met Gly Gln Glu Lys Gly Glu Phe Arg Glu Cys Glu Ser Gly

245 250 255

Pro Cys Cys Arg Asn Cys Lys Phe Leu Lys Glu Gly Thr Ile Cys Lys

260 265 270

Arg Ala Arg Gly Asp Asp Leu Asp Asp Tyr Cys Asn Gly Lys Thr Cys

275 280 285

Asp Cys Pro Arg Asn Pro His Lys Gly Pro Ala Thr

290 295 300

<210> 7

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

aagcttaaaa attgaaattt tatttttttt ttttggaata taaataagct cga 53

<210> 8

<211> 186

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cactaattcc aaacccaccc gctttttata gtaagttttt cacccataaa taataaatac 60

aataattaat ttctcgtaaa agtagaaaat atattctaat ttattgcacg gtaaggaagt 120

agatcataac gatctctata atctcgcgca acctattttc ccctcgaaca ctttttaagc 180

cgtaga 186

<210> 9

<211> 459

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

atgagcgaaa aatacatcgt cacctgggac atgttgcaga tccatgcacg taaactcgca 60

agccgactga tgccttctga acaatggaaa ggcattattg ccgtaagccg tggcggtctg 120

gtaccgggtg cgttactggc gcgtgaactg ggtattcgtc atgtcgatac cgtttgtatt 180

tccagctacg atcacgacaa ccagcgcgag cttaaagtgc tgaaacgcgc agaaggcgat 240

ggcgaaggct tcatcgttat tgatgacctg gtggataccg gtggtactgc ggttgcgatt 300

cgtgaaatgt atccaaaagc gcactttgtc accatcttcg caaaaccggc tggtcgtccg 360

ctggttgatg actatgttgt tgatatcccg caagatacct ggattgaaca gccgtgggat 420

atgggcgtcg tattcgtccc gccaatctcc ggtcgctaa 459

<210> 10

<211> 71

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aaaaattgaa aataaataca aaggttcttg agggttgtgt taaattgaaa gcgagaaata 60

atcataaata a 71

<210> 11

<211> 1122

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

atggatgtag aagcttggtt aggagctaga gtaccattag tagaaactgt gagcaagggc 60

gaggaggata acatggccat catcaaggag ttcatgcgct tcaaggtgca catggagggc 120

tccgtgaacg gccacgagtt cgagatcgag ggcgagggcg agggccgccc ctacgagggc 180

acccagaccg ccaagctgaa ggtgaccaag ggtggccccc tgcccttcgc ctgggacatc 240

ctgtcccctc agttcatgta cggctccaag gcctacgtga agcaccccgc cgacatcccc 300

gactacttga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag 360

gacggcggcg tggtgaccgt gacccaggac tcctccctgc aggacggcga gttcatctac 420

aaggtgaagc tgcgcggcac caacttcccc tccgacggcc ccgtaatgca gaagaagacc 480

atgggctggg aggcctcctc cgagcggatg taccccgagg acggcgccct gaagggcgag 540

atcaagcaga ggctgaagct gaaggacggc ggccactacg acgctgaggt caagaccacc 600

tacaaggcca agaagcccgt gcagctgccc ggcgcctaca acgtcaacat caagttggac 660

atcacctccc acaacgagga ctacaccatc gtggaacagt acgaacgcgc cgagggccgc 720

cactccaccg gcggcatgga cgagctgtac aaggccaagt tgaccagtgc cgttccggtg 780

ctcaccgcgc gcgacgtcgc cggagcggtc gagttctgga ccgaccggct cgggttctcc 840

cgggacttcg tggaggacga cttcgccggt gtggtccggg acgacgtgac cctgttcatc 900

agcgcggtcc aggaccaggt ggtgccggac aacaccctgg cctgggtgtg ggtgcgcggc 960

ctggacgagc tgtacgccga gtggtcggag gtcgtgtcca cgaacttccg ggacgcctcc 1020

gggccggcca tgaccgagat cggcgagcag ccgtgggggc gggagttcgc cctgcgcgac 1080

ccggccggca actgcgtgca cttcgtggcc gaggagcagg ac 1122

<210> 12

<211> 152

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 12

Met Ser Glu Lys Tyr Ile Val Thr Trp Asp Met Leu Gln Ile His Ala

1 5 10 15

Arg Lys Leu Ala Ser Arg Leu Met Pro Ser Glu Gln Trp Lys Gly Ile

20 25 30

Ile Ala Val Ser Arg Gly Gly Leu Val Pro Gly Ala Leu Leu Ala Arg

35 40 45

Glu Leu Gly Ile Arg His Val Asp Thr Val Cys Ile Ser Ser Tyr Asp

50 55 60

His Asp Asn Gln Arg Glu Leu Lys Val Leu Lys Arg Ala Glu Gly Asp

65 70 75 80

Gly Glu Gly Phe Ile Val Ile Asp Asp Leu Val Asp Thr Gly Gly Thr

85 90 95

Ala Val Ala Ile Arg Glu Met Tyr Pro Lys Ala His Phe Val Thr Ile

100 105 110

Phe Ala Lys Pro Ala Gly Arg Pro Leu Val Asp Asp Tyr Val Val Asp

115 120 125

Ile Pro Gln Asp Thr Trp Ile Glu Gln Pro Trp Asp Met Gly Val Val

130 135 140

Phe Val Pro Pro Ile Ser Gly Arg

145 150

<210> 13

<211> 374

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 13

Met Asp Val Glu Ala Trp Leu Gly Ala Arg Val Pro Leu Val Glu Thr

1 5 10 15

Val Ser Lys Gly Glu Glu Asp Asn Met Ala Ile Ile Lys Glu Phe Met

20 25 30

Arg Phe Lys Val His Met Glu Gly Ser Val Asn Gly His Glu Phe Glu

35 40 45

Ile Glu Gly Glu Gly Glu Gly Arg Pro Tyr Glu Gly Thr Gln Thr Ala

50 55 60

Lys Leu Lys Val Thr Lys Gly Gly Pro Leu Pro Phe Ala Trp Asp Ile

65 70 75 80

Leu Ser Pro Gln Phe Met Tyr Gly Ser Lys Ala Tyr Val Lys His Pro

85 90 95

Ala Asp Ile Pro Asp Tyr Leu Lys Leu Ser Phe Pro Glu Gly Phe Lys

100 105 110

Trp Glu Arg Val Met Asn Phe Glu Asp Gly Gly Val Val Thr Val Thr

115 120 125

Gln Asp Ser Ser Leu Gln Asp Gly Glu Phe Ile Tyr Lys Val Lys Leu

130 135 140

Arg Gly Thr Asn Phe Pro Ser Asp Gly Pro Val Met Gln Lys Lys Thr

145 150 155 160

Met Gly Trp Glu Ala Ser Ser Glu Arg Met Tyr Pro Glu Asp Gly Ala

165 170 175

Leu Lys Gly Glu Ile Lys Gln Arg Leu Lys Leu Lys Asp Gly Gly His

180 185 190

Tyr Asp Ala Glu Val Lys Thr Thr Tyr Lys Ala Lys Lys Pro Val Gln

195 200 205

Leu Pro Gly Ala Tyr Asn Val Asn Ile Lys Leu Asp Ile Thr Ser His

210 215 220

Asn Glu Asp Tyr Thr Ile Val Glu Gln Tyr Glu Arg Ala Glu Gly Arg

225 230 235 240

His Ser Thr Gly Gly Met Asp Glu Leu Tyr Lys Ala Lys Leu Thr Ser

245 250 255

Ala Val Pro Val Leu Thr Ala Arg Asp Val Ala Gly Ala Val Glu Phe

260 265 270

Trp Thr Asp Arg Leu Gly Phe Ser Arg Asp Phe Val Glu Asp Asp Phe

275 280 285

Ala Gly Val Val Arg Asp Asp Val Thr Leu Phe Ile Ser Ala Val Gln

290 295 300

Asp Gln Val Val Pro Asp Asn Thr Leu Ala Trp Val Trp Val Arg Gly

305 310 315 320

Leu Asp Glu Leu Tyr Ala Glu Trp Ser Glu Val Val Ser Thr Asn Phe

325 330 335

Arg Asp Ala Ser Gly Pro Ala Met Thr Glu Ile Gly Glu Gln Pro Trp

340 345 350

Gly Arg Glu Phe Ala Leu Arg Asp Pro Ala Gly Asn Cys Val His Phe

355 360 365

Val Ala Glu Glu Gln Asp

370

<210> 14

<211> 7162

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cgcgcgtaat acgactcact atagggcgaa ttggagctct ttttatctgc gcggttaacc 60

gcctttttat ccatcaggtg atctgttttt attgtggagt ctagaaaaaa ttgaaaataa 120

atacaaaggt tcttgagggt tgtgttaaat tgaaagcgag aaataatcat aaataagctg 180

cagcacgtgt tgacaattaa tcatcggcat agtatatcgg catagtataa tacgactcac 240

tataggaggg ccaccccacc atggatgtag aagcttggtt aggagctaga gtaccattag 300

tagaaactgt gagcaagggc gaggaggata acatggccat catcaaggag ttcatgcgct 360

tcaaggtgca catggagggc tccgtgaacg gccacgagtt cgagatcgag ggcgagggcg 420

agggccgccc ctacgagggc acccagaccg ccaagctgaa ggtgaccaag ggtggccccc 480

tgcccttcgc ctgggacatc ctgtcccctc agttcatgta cggctccaag gcctacgtga 540

agcaccccgc cgacatcccc gactacttga agctgtcctt ccccgagggc ttcaagtggg 600

agcgcgtgat gaacttcgag gacggcggcg tggtgaccgt gacccaggac tcctccctgc 660

aggacggcga gttcatctac aaggtgaagc tgcgcggcac caacttcccc tccgacggcc 720

ccgtaatgca gaagaagacc atgggctggg aggcctcctc cgagcggatg taccccgagg 780

acggcgccct gaagggcgag atcaagcaga ggctgaagct gaaggacggc ggccactacg 840

acgctgaggt caagaccacc tacaaggcca agaagcccgt gcagctgccc ggcgcctaca 900

acgtcaacat caagttggac atcacctccc acaacgagga ctacaccatc gtggaacagt 960

acgaacgcgc cgagggccgc cactccaccg gcggcatgga cgagctgtac aaggccaagt 1020

tgaccagtgc cgttccggtg ctcaccgcgc gcgacgtcgc cggagcggtc gagttctgga 1080

ccgaccggct cgggttctcc cgggacttcg tggaggacga cttcgccggt gtggtccggg 1140

acgacgtgac cctgttcatc agcgcggtcc aggaccaggt ggtgccggac aacaccctgg 1200

cctgggtgtg ggtgcgcggc ctggacgagc tgtacgccga gtggtcggag gtcgtgtcca 1260

cgaacttccg ggacgcctcc gggccggcca tgaccgagat cggcgagcag ccgtgggggc 1320

gggagttcgc cctgcgcgac ccggccggca actgcgtgca cttcgtggcc gaggagcagg 1380

accaaaaata tatcgaagag aataaaacat tcgcaattat tgccatagta ttcgtgttta 1440

tacttaccgc tattctcttt tttatgagtc gacgatattc gcgagaaaaa caaaactgaa 1500

tttaaattca ggtagctgga cccttgtgtg ggtttctcgg gcagtcacag gtcttaccgt 1560

tgcagtagtc gtcgagatca tcaccacgtg cgcgcttaca gatggtacct tccttaagga 1620

acttgcagtt acgacagcat ggacctgatt cgcattctct gaattcccct ttctcctggc 1680

ccatacactc taccgggctg tctgtactct tccggttaac tgttcgggag ggaatcactg 1740

cttgaacact gaaacagtag ttttctcctt tatccacatc aatcaaaaac tcattagtgt 1800

ttgttttggc tgttttcttt cctgaacttg aagatttcca ataataaagt gtataaatta 1860

agtccttgcc aaaaacatcc cggaggctta ggaaagtgtt gttccttctg actaaagtcc 1920

gttcatcttc tacggtcaca ttcacttttg ttcccacctg ttcaaaactc tgaattgttg 1980

gctgtccgag gtttgtctcc aggtaaggtg tgaactctgg ggagttctca tacagaggct 2040

ccccagcaga accggtgctc tccacattcc ctgccgggta ggagaagacc cgtgccaagt 2100

acgtctgctt cacatccttc acaatctcgt cggtgaggtc acactctgtg tctgttgtgt 2160

aaaagcattt gcttttccaa tctcctgact tagtgcttat ttgaacagtg tagacttgat 2220

tgacgggttt gggttcccac tccaaaattg tcttgaaatt agttgatttc caagttaaat 2280

tatatgctgc cacagtattt gtagtgcctg atggtccttt agatccatga tgatgatgat 2340

ggtgtccggc ccacaccatg ggccacagca gcagcagcag cagcagcagc caccacaggc 2400

gccaccacat ggtggcagat ctgtcgactt cgagcttatt tatattccaa aaaaaaaaaa 2460

taaaatttca atttttaagc tttcactaat tccaaaccca cccgcttttt atagtaagtt 2520

tttcacccat aaataataaa tacaataatt aatttctcgt aaaagtagaa aatatattct 2580

aatttattgc acggtaagga agtagatcat aacgatctct ataatctcgc gcaacctatt 2640

ttcccctcga acacttttta agccgtagat aaacaggctg ggacacttca catgagcgaa 2700

aaatacatcg tcacctggga catgttgcag atccatgcac gtaaactcgc aagccgactg 2760

atgccttctg aacaatggaa aggcattatt gccgtaagcc gtggcggtct ggtaccgggt 2820

gcgttactgg cgcgtgaact gggtattcgt catgtcgata ccgtttgtat ttccagctac 2880

gatcacgaca accagcgcga gcttaaagtg ctgaaacgcg cagaaggcga tggcgaaggc 2940

ttcatcgtta ttgatgacct ggtggatacc ggtggtactg cggttgcgat tcgtgaaatg 3000

tatccaaaag cgcactttgt caccatcttc gcaaaaccgg ctggtcgtcc gctggttgat 3060

gactatgttg ttgatatccc gcaagatacc tggattgaac agccgtggga tatgggcgtc 3120

gtattcgtcc cgccaatctc cggtcgctaa tcttttcaac gcctggcact gccgggcgtt 3180

gttcttttta acttcaggcg ggttacaata gtttccagta agtattctgg aggctgcatc 3240

catgacacag gcaaacctgc ggatcccagc ttttgttccc tttagtgagg gttaattgcg 3300

cgcagttata gtagccgcac tcgatgggac atttcaacgt aaaccgttta ataatatttt 3360

gaatcttatt ccattatctg aaatggtggt aaaactaact gctgtgtgta tgaaatgctt 3420

taaggaggct tccttttcta aacgattggg tgaggaaacc gagatagaaa taataggagg 3480

taatgatatg tatcaatcgg tgtgtagaaa gtgttacatc gactcataat attatatttt 3540

ttatctaaaa aactaaaaat aaacattgat taaattttaa tataatactt aaaaatggat 3600

gttgtgtcgt tagataaacc gtttatgtat tttgaggaaa ttgataatga gttagattac 3660

gaaccagaaa gtgcaaatga ggtcgcaaaa aaactgccgt atcaaggaca gttaaaacta 3720

ttactaggag aattattttt tcttagtaag ttacagcgac acggtatatt agatggtgcc 3780

accgtagtgt atataggatc tgctcccggt acacatatac gttatttgag agatcatttc 3840

tataatttag gagtgatcat caaatggatg ctaattgacg gccgccatca tgatcctatt 3900

ttaaatggat tgcgtgatgt gactctagtg actcggttcg ttgatgagga atatctacga 3960

tccatcaaaa aacaactgca tccttctaag attattttaa tttctgatgt gagatccaaa 4020

cgaggaggaa atgaacctag tacggcggat ttactaagta attacgctct acaaaatgtc 4080

atgattagta ttttaaaccc cgtggcgtct agtcttaaat ggagatgccc gtttccagat 4140

caatggatca aggactttta tatcccacac ggtaataaaa tgttacaacc ttttgctcct 4200

tcatattcag ctgaaatgag attattaagt atttataccg gtgagaacat gagactgact 4260

cgggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat 4320

cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc 4380

cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc 4440

gcctttctcc cttcgggaag cgtggcgctt tctcaatgct cacgctgtag gtatctcagt 4500

tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac 4560

cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg 4620

ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca 4680

gagttcttga agtggtggcc taactacggc tacactagaa ggacagtatt tggtatctgc 4740

gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc cggcaaacaa 4800

accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa 4860

ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac 4920

tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta 4980

aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg gtctgacagt 5040

taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata 5100

gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc 5160

agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc agcaataaac 5220

cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag 5280

tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag tttgcgcaac 5340

gttgttgcca ttgctgcagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc 5400

agctccggtt cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg 5460

gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc 5520

atggttatgg cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct 5580

gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc 5640

tcttgcccgg cgtcaacacg ggataatacc gcgccacata gcagaacttt aaaagtgctc 5700

atcattggaa aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc 5760

agttcgatgt aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc 5820

gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca 5880

cggaaatgtt gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt 5940

tattgtctca tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt 6000

ccgcgcacat ttccccgaaa agtgccacct gacgtctaag aaaccattat tatcatgaca 6060

ttaacctata aaaataggcg tatcacgagg ccctttcgtc ttcgaataaa tacctgtgac 6120

ggaagatcac ttcgcagaat aaataaatcc tggtgtccct gttgataccg ggaagccctg 6180

ggccaacttt tggcgaaaat gagacgttga tcggcacgta agaggttcca actttcacca 6240

taatgaaata agatcactac cgggcgtatt ttttgagtta tcgagatttt caggagctaa 6300

ggaagctaaa atggagaaaa aaatcactgg atataccacc gttgatatat cccaatggca 6360

tcgtaaagaa cattttgagg catttcagtc agttgctcaa tgtacctata accagaccgt 6420

tcagagcttt tgcgatcaat aaatggatca caaccagtat ctcttaacga tgttcttcgc 6480

agatgatgat tcatttttta agtatttggc tagtcaagat gatgaatctt cattatctga 6540

tatattgcaa atcactcaat atgtagctag actttctgtt attattattg atccaatcaa 6600

aaaataaatt agaagccgtg ggtcattgtt atgaatctct ttcagaggaa tacagacaat 6660

tgacaaaatt cacagacttt caagatttta aaaaactgtt taacaaggtc cctattgtta 6720

cagatggaag ggtcaaactt aataaaggat atttgttcga ctttgtgatt agtttgatgc 6780

gattcaaaaa agaatcctct ctagctacca ccgcaataga tcctgttaga tacatagatc 6840

ctcgtcgcaa tatcgcattt tctaacgtga tggatatatt aaagtcgaat aaagtgaaca 6900

ataattaatt ctttattgtc atcatgaacg gcggacatat tcagttgata atcggcccca 6960

tgttttcagg taaaagtaca gaattaatta gacgagttag acgttatcaa atagctcaat 7020

ataaatgcgt gactataaaa tattctaacg ataatagata cggaacggga ctatggacgc 7080

atgataagaa taattttgaa gcattggaag caactaaact atgtgatctc ttggaatcaa 7140

ttacagattt ctccgtgata gg 7162

<210> 15

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tgtggagtct agaaaaaatt gaaaataaat acaaag 36

<210> 16

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gctacctgaa tttaaattca gttttgtttt tctcgcgaat atcg 44

<210> 17

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

acaaaactga atttaaattc aggtagctgg acccttgtgt gggtttctcg ggcag 55

<210> 18

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

agtcgacaga tctgccacca tgtggtggcg cctgtggtgg ctgctgctgc tgctgctg 58

<210> 19

<211> 801

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

tcaggcacta caaatactgt ggcagcatat aatttaactt ggaaatcaac taatttcaag 60

acaattttgg agtgggaacc caaacccgtc aatcaagtct acactgttca aataagcact 120

aagtcaggag attggaaaag caaatgcttt tacacaacag acacagagtg tgacctcacc 180

gacgagattg tgaaggatgt gaagcagacg tacttggcac gggtcttctc ctacccggca 240

gggaatgtgg agagcaccgg ttctgctggg gagcctctgt atgagaactc cccagagttc 300

acaccttacc tggagacaaa cctcggacag ccaacaattc agagttttga acaggtggga 360

acaaaagtga atgtgaccgt agaagatgaa cggactttag tcagaaggaa caacactttc 420

ctaagcctcc gggatgtttt tggcaaggac ttaatttata cactttatta ttggaaatct 480

tcaagttcag gaaagaaaac agccaaaaca aacactaatg agtttttgat tgatgtggat 540

aaaggagaaa actactgttt cagtgttcaa gcagtgattc cctcccgaac agttaaccgg 600

aagagtacag acagcccggt agagtgtatg ggccaggaga aaggggaatt cagagaatgc 660

gaatcaggtc catgctgtcg taactgcaag ttccttaagg aaggtaccat ctgtaagcgc 720

gcacgtggtg atgatctcga cgactactgc aacggtaaga cctgtgactg cccgagaaac 780

ccacacaagg gtccagctac c 801

Claims

1. A recombinant vaccinia virus expressing human tissue factor fusion protein is characterized in that the human tissue factor fusion protein gene is inserted into the gene region of vaccinia virus TK and expressed by the early/late promoter of artificially synthesized vaccinia virus; the construction process of the recombinant vaccinia virus is constructed by transfecting a Vero cell based on a recombinant vaccinia vector expression plasmid pCZ-tTFEch, infecting a wild type vaccinia virus WR strain and performing intracellular homologous recombination; the whole nucleic acid sequence of the pCZ-tTFEch plasmid is shown in SEQ ID No. 14.

2. The recombinant vaccinia virus of claim 1, wherein the human tissue factor fusion protein comprises the following elements in order: the nucleic acid sequences of the secretory signal peptide, the histidine tag, the ND2 connecting peptide, the truncated human tissue factor and the snake venom saw-scale viper vascular targeting peptide are sequentially shown as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4 and SEQ ID No. 5.

3. The recombinant vaccinia virus of claim 2, wherein the amino acid sequence of the human tissue factor fusion protein is set forth in SEQ ID No. 6.

4. The recombinant vaccinia virus of claim 1, wherein the parent virus of the recombinant vaccinia virus is vaccinia virus WR strain.

5. The recombinant vaccinia virus of claim 1, wherein the synthetic early/late vaccinia virus promoter has the nucleic acid sequence shown in SEQ ID No. 7.

6. The recombinant vaccinia virus of claim 1, further comprising a gene expression cassette string fused to human tissue factorA linked selectable first marker gene expression cassette in which the selectable marker gene isgptThe gene(s) is (are),gptthe gene is expressed by the early/late promoter of vaccinia virus P7.5; the nucleic acid sequence of the P7.5 early/late promoter is shown as SEQ ID No.8gptThe nucleic acid sequence of the gene is shown as SEQ ID No. 9.

7. The recombinant vaccinia virus of claim 6, further comprising a selectable second marker gene expression cassette in tandem with the human tissue factor fusion protein gene expression cassette in which the selectable marker gene is mCherry red fluorescent protein fused to Zeocin resistance protein gene mCherry-Zeocin, the selectable marker gene being expressed from the vaccinia virus mH5 promoter; the nucleic acid sequence of the mH5 promoter is shown in SEQ ID No.10, and the nucleic acid sequence of the mCherry-Zeocin fusion gene is shown in SEQ ID No. 11.

8. The recombinant vaccinia virus of claim 7, wherein the selectable first marker gene expression cassette encodes an amino acid sequence set forth in SEQ ID No.12 and the selectable second marker gene expression cassette encodes an amino acid sequence set forth in SEQ ID No. 13.

9. Use of a recombinant vaccinia virus of any of claims 1-8 in the preparation of a medicament for triggering a coagulation response.